Figures (5)  Tables (1)
    • Figure 1.  Identification of GLKs that are expressed in P. alba × P. berolinensis. (a): Phylogenetic relationship among GLKs from P. alba × P. berolinensis, P. trichocarpa, and Arabidopsis. (b): A multiple sequence alignment of the identified PabGLKs. The colored region was used for RNAi. (c): Tissue specific expression levels of the PabGLKs in P. alba × P. berolinensis quantified with qRT-PCR. 18S rRNA and α-Tubulin were used as endogenous control. (d): Nucleotide sequence similarities among differnt PabGLKs in P. alba × P. berolinensis.

    • Figure 2.  Relative PabGLK5 transcript levels in PabGLK5 overexpression lines and the total transcript levels of all five PabGLKs in PabGLK RNAi lines. OE, overexpression lines of PabGLK5; RE, repression lines of PabGLKs; WT, wildtype.

    • Figure 3.  Phenotypic characterization of the PabGLK transgenic lines. (a): The yellow-green leaf phenotype of the PabGLK RNAi lines. (b) and (c): L* and b* values of the transgenic lines and WT measured by the CIELab color system. (d): Plant heights of one-year-old WT and transgenic lines. OE, overexpression lines of PabGLK5; RE, repression lines of PabGLKs; WT, wildtype.

    • Figure 4.  Pigment contents and photosynthetic and fluorescence parameters of the WT and transgenic lines. OE, overexpression lines of PabGLK5; RE, repression lines of PabGLKs; WT, wildtype. (a), (b) and (c) show the contents of chlorophyll a, chlorophyll b, and carotenoid in the WT and transgenic lines, respectively. (d) and (e) show photosynthetic parameters Pn and Fv/Fm, respectively.

    • Figure 5.  Expression profiles of photosynthesis-related genes in transgenic poplar. OE, overexpression lines of PabGLK5; RE, repression lines of PabGLKs; WT, wildtype.

    • PrimersSequences (5'-3')
      PaGLK-RNAi-Cis-NcoICATGCCATGGCCATCCCCAATGCATATGTG
      PaGLK-RNAi-Cis-AscITTGGCGCGCCGCAGGAAATCTAGTTGCCAGT
      PaGLK-RNAi-Anti- XbaIGCTCTAGACCATCCCCAATGCATATGTG
      PaGLK-RNAi-Anti-BamHICGCGGATCCGCAGGAAATCTAGTTGCCAGT

      Table 1.  Primers used for RNAi vector construction.