Internal reference genes for normalizing quantitative real-time PCR in different tissues of <i>Gelsemium elegans</i> or under low temperature, MeJA, and SA stresses

Chuihuai You; Shoujian Zang; Tianzhen Cui; Xinlu Sun; Yachun Su; Qing Lin; Hailing Lin; Youxiong Que; Wancai Que; Chuihuai You; Shoujian Zang; Tianzhen Cui; Xinlu Sun; Yachun Su; Qing Lin; Hailing Lin; Youxiong Que; Wancai Que

doi:10.48130/mpb-0024-0014

Figures (6) Tables (3)

Figure 1.
CT value distribution of the seven candidate internal reference genes in different tissue samples (root, stem, and leaf) and under different stresses (cold stress, MeJA stress, and SA stress) of G. elegans by GraphPad 6.0. The smaller the CT value, the higher the gene expression abundance. The change of the CT value of the same candidate internal reference gene in different samples reflects the gene expression stability. CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; APRT, adenine phosphoribosyl transferase; TUB, β-tubulin; Actin, actin; PRR, pseudo response regulator; UBQ, polyubiquitin.
Figure 2.
Stability of the seven candidate internal reference genes by geNorm. DTS, different G. elegans tissue samples; LTS, G. elegans leaves under low-temperature stress; CTS, both of the DTS and LTS samples. CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; APRT, adenine phosphoribosyl transferase; TUB, β-tubulin; Actin, actin; PRR, pseudo response regulator; UBQ, polyubiquitin.
Figure 3.
Stability of the seven candidate internal reference genes by NormFinder. DTS, different G. elegans tissue samples; LTS, G. elegans leaves under low-temperature stress; CTS, both of the DTS and LTS samples. CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; APRT, adenine phosphoribosyl transferase; TUB, β-tubulin; Actin, actin; PRR, pseudo response regulator; UBQ, polyubiquitin.
Figure 4.
Stability of the seven candidate internal reference genes by Delta CT. DTS, different G. elegans tissue samples; LTS, G. elegans leaves under low-temperature stress; CTS, both of the DTS and LTS samples. CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; APRT, adenine phosphoribosyl transferase; TUB, β-tubulin; Actin, actin; PRR, pseudo response regulator; UBQ, polyubiquitin.
Figure 5.
Comprehensive stability of the seven candidate internal reference genes. DTS, different G. elegans tissue samples; LTS, G. elegans leaves under low-temperature stress; CTS, both of the DTS and LTS samples. CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; APRT, adenine phosphoribosyl transferase; TUB, β-tubulin; Actin, actin; PRR, pseudo response regulator; UBQ, polyubiquitin.
Figure 6.
Expression patterns of GPPS, ERF, and 60S in different tissues (DTS) of G. elegans and at different time points after low temperature (LTS), MeJA, and SA stresses. CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; GPPS, geranyl diphosphate synthase; ERF, ethylene-responsive transcription factor; 60S, 60S ribosomal protein. All data points were means ± standard error (n = 3). Data analysis was conducted using DPS 7.05 software, and Duncan's new multiplex range test was employed to assess the significance of differences. Lowercase letters were utilized to indicate significant distinctions between groups, with each letter corresponding to a unique group. (p-value < 0.05).

Gene name	Gene description	Gene ID	Primer name	Primer sequence (5'-3')	Product length (bp)
Actin	Actin	Ge.c133917	Actin-F	TGCGGCGATCATCTACTCCG	127
Actin	Actin	Ge.c133917	Actin-R	AGCGAGGCTGGAAATCCGAA
APRT	Adenine phosphoribosyl transferase	Ge.c138712	APRT-F	AGACAACGGTCCCAAGAAGCA	90
APRT	Adenine phosphoribosyl transferase	Ge.c138712	APRT-R	ACCATGGGATTGGTCGGTCC
CUL	Cullin	Ge.c140024	CUL-F	GTTCTTACAGGCACGACACAA	115
CUL	Cullin	Ge.c140024	CUL-R	CCAAGCACCTTCAGCATCAT
eEF-1α	Eukaryotic elongation factor 1-alpha	Ge.c81268	eEF-1α-F	GCGATGTTCCCCATGTCACC	117
eEF-1α	Eukaryotic elongation factor 1-alpha	Ge.c81268	eEF-1α-R	CGGTTGGAAGCCTCAGGTCAT
PRR	Pseudo response regulator	Ge.c146065	PRR-F	ACGCATCAATCACAGCCCAC	210
PRR	Pseudo response regulator	Ge.c146065	PRR-R	GTACGTGGCTCATACACGGC
TUB	β-tubulin	Ge.c147995	TUB-F	AGGTGTCCGCAGACTTGACA	291
TUB	β-tubulin	Ge.c147995	TUB-R	GCTGCGGCATATTGAAGGCA
UBQ	Polyubiquitin	Ge.c122802	UBQ-F	CTCCGTCTCCGTGGTGGATT	80
UBQ	Polyubiquitin	Ge.c122802	UBQ-R	TGGCCAAACTTCGGTGTAACCT
GPPS	Geranyl diphosphate synthase	Ge.c151190	GPPS-F	GTGAGTTTGTTGGTGGTGAGA	93
GPPS	Geranyl diphosphate synthase	Ge.c151190	GPPS-R	GGAGATGTTGGTGAGTGTATGTAG
ERF	Ethylene-responsive transcription factor	Ge.c141467	ERF-F	AGGAAGTGGTAGAAGACATTATCG	157
ERF	Ethylene-responsive transcription factor	Ge.c141467	ERF-R	CTTGAGAGCTGCTTCATCGTAT
60S	60S ribosomal protein	Ge.c131257	60S-F	CACCTGAGACCTGCTGAATATAAG	84
60S	60S ribosomal protein	Ge.c131257	60S-R	AGACAACACGCCACCATAAG

Table 1.

Sequences of RT-qPCR primers.

Gene	Slope (k)	Amplification efficiency (%)	Correlation coefficient (R²)
CUL	−3.023	1.142	0.999
eEF-1α	−3.099	1.102	0.999
APRT	−3.013	1.147	0.999
TUB	−3.154	1.075	0.996
Actin	−2.992	1.159	0.993
PRR	−3.117	1.093	0.996
UBQ	−3.314	1.003	0.999

Table 2.

Primer amplification parameters for the seven candidate internal reference genes in Gelsemium elegans.

Group	Gene	geo mean	AR mean	Min	Max	SD	Stability rank
DTS	APRT	24.89	24.89	23.66	25.79	0.56	1
	TUB	24.14	24.15	23.00	25.54	0.73	2
	eEF-1α	20.25	20.28	18.40	22.10	0.79	3
	CUL	23.75	23.77	22.44	25.76	0.80	4
	Actin	23.63	23.65	22.44	25.68	0.84	5
	UBQ	18.80	18.84	17.13	20.97	0.99	6
	PRR	23.15	23.25	20.90	26.89	1.98	7
LTS	CUL	24.38	24.39	23.95	25.55	0.27	1
	eEF-1α	20.99	20.99	20.53	21.98	0.32	2
	TUB	26.15	26.16	25.35	27.28	0.34	3
	Actin	26.46	26.46	26.01	27.60	0.36	4
	APRT	26.17	26.17	25.67	27.56	0.41	5
	PRR	24.32	24.32	23.59	25.18	0.42	6
	UBQ	18.03	18.06	16.19	20.01	0.82	7
MeJA	CUL	24.13	24.13	23.28	24.99	0.31	1
	eEF-1α	22.34	22.35	21.54	23.08	0.41	2
	TUB	25.01	25.02	24.00	26.55	0.58	3
	UBQ	18.03	18.04	17.02	19.30	0.63	4
	APRT	25.35	25.36	23.97	27.00	0.74	5
	Actin	24.38	24.39	23.37	25.94	0.77	6
	PRR	21.88	21.89	20.14	23.13	0.79	7
SA	CUL	26.54	26.54	25.95	27.46	0.35	1
	eEF-1α	22.21	22.22	20.98	23.00	0.49	2
	PRR	25.59	25.60	24.29	27.28	0.67	3
	UBQ	19.42	19.44	18.21	20.97	0.70	4
	TUB	27.69	27.72	25.58	29.39	0.79	5
	APRT	27.50	27.52	25.11	29.74	0.83	6
	Actin	27.73	27.75	26.12	29.28	0.84	7
Notes: geo mean, geometric mean; AR mean, average mean; Min, minimum mean; Max, max mean; SD, standard deviation. DTS, different G. elegans tissue samples; LTS, G. elegans leaves under low temperature stress; CUL, cullin; eEF-1α, eukaryotic elongation factor 1-alpha; APRT, adenine phosphoribosyl transferase; TUB, β-tubulin; Actin, actin; PRR, pseudo response regulator; UBQ, polyubiquitin.

Table 3.

Expression stability of the seven candidate internal reference genes by BestKeeper.