Figures (3)  Tables (3)

    • Figure 1. 

      Vectors used and infection flow chart in this study. The plasmid profile of pTRV1 (A), pTRV2 (B), pTRV2::PDS410 (C), pTRV2::CeTCP14 (D). Color change of leaves by leaf injection (E) and bulb vacuum injection methods (F).

    • Figure 2. 

      VIGS system constructing in taro. (a) Empty vector phenotype at 20d of leaf infection with OD600 = 0.6, (b) VIGS-PDS410 phenotype at 20d of leaf infection OD600 = 0.6, (c) VIGS-PDS410 phenotype at 30d of leaf infection with OD600 = 0.6, (d) Mock phenotype after 20d infection, (e) RdRp gene expression in TRV1 and CP gene expression in TRV2 were detected by RT-PCR with actin as the internal reference, (f) The detection of CePDS expression level for photobleaching phenotype plants, (g) Chlorophyll content detection for photobleaching phenotype plants. Scale bar = 3 cm.

    • Figure 3. 

      Detection of taro VIGS system for CeTCP14 in Ganyu No.2. (a) RdRp gene expression in pTRV1 and fragement expression in pTRV2 were detected by RT-PCR, (b) The detection of CeTCP14 expression at 20d after bulb vacuum infiltration. (c) Starch content detection for VIGS-CeTCP14 plants.

    • prime namePrimer sequence (5 '- 3')Lengthpurpose
      CePDS-EcoRI-FGGAATTCATGGGCTTTACCAGTTCTCTTTCGG410 bpused for fragments amplified of CePDS and CeTCP14 inserted in TRV2 vector
      CePDS-BamHI-RCGGGATCCTCCAGCAATATAGGCTTATGACCTG
      TRV2-TCP14_FGTGAGTAAGGTTACCGAATTCATGGGGGAGAGCCACCAG300 bp
      TRV2-TCP14_RCGTGAGCTCGGTACCGGATCCATCGACGGCCTTGCTGGG
      qCePDS-FGGTCGTTGGGGAGGAAGC140 bpUsed for the qRT-PCR of CePDS
      qCePDS-RTCTAGTCGGGCGTGGTGA
      qCeTCP14_FCCACACCGCCATCCAGTT110 bpUsed for the qRT-PCR of CeTCP14
      qP_TCP14_RCGAGCTCGTCTATGGCGG
      CeActinFCTAGTGGTCGCACAACAGGT191 bpUsed for the qRT-PCR of reference genes
      CeActinRTTCACGCTCAGCAGTGGTAG
      TRV1F1CGTGTTGCATTTCGATGAA525 bpUsed for the detection of RdRp in TRV1
      TRV1R1GACAACGCCACGATTAAGT
      TRV2F1GTTGAAGAAGTTACACAGCA407 bpUsed for the detection of coat protein in TRV2
      TRV2R1TCTTCAACTCCATGTTCTCT
      pTRV2_FTGTCAACAAAGATGGACATTGTTAC198bp/480bpUsed for the detection of TRV2 and TRV2-CeTCP14 expression
      pTRV2_RACACGGATCTACTTAAAGAA
      TRV2_FTGTTACTCAAGGAAGCACGATGAGCT−Used for vector construction sequencing and colony PCR detection
      TRV2_RGTACAGACGGGCGTAATAACGCTTA
      note: underlined for cleavage sites, bold for protective bases

      Table 1. 

      Primers used in this study

    • OD600 Total number of inoculation plants The number of photobleaching phenotype The percentage of photobleaching phenotype (%)
      0 10 0 c 0
      0.6 30 3.00 ± 1.00 bc 10
      0.8 30 5.33 ± 0.58 b 17.77
      1.0 30 8.33 ± 0.58 a 27.77
      1.2 30 7.67 ± 0.58 a 25.57

      Table 2. 

      Bacterial concentrations optimization for VIGS system

    • Infection type Total number of inoculation plants The number of photobleaching phenotype The percentage of photobleaching phenotype (%)
      Leaf injection 30 8.33 ± 0.58 a 27.77
      Bulb evacuation 30 8.00 ± 0.58 a 26.67

      Table 3. 

      Comparsion of VIGS system based on infection type