Figures (6)  Tables (5)

    • Figure 1. 

      Sampling location of the natural population of P. bournei.

    • Figure 2. 

      Mantel test of genetic differentiation between populations and geographical distance (A) and altitude difference (B)

    • Figure 3. 

      Genetic distance and genetic consistency between populations. Note: Below the diagonal was genetic distance, above the diagonal was genetic consistency.

    • Figure 4. 

      The relationship between the optimal group number K and the inferred value ΔK

    • Figure 5. 

      Population genetic structure based on STRUCTURE analysis

    • Figure 6. 

      Cluster analysis based on genetic distance among individuals

    • Serial number Population code Location Sample numbers Longitude (E) Latitude (N) Altitude (m)
      1 FJJO Jian'ou, Fujian 28 118.37 27.08 148.16
      2 FJJY Jianyang, Fujian 50 117.84 27.39 197.82
      3 FJMX Mingxi, Fujian 56 117.27 26.41 442.37
      4 FJSC Shunchang, Fujian 69 117.94 26.87 434.72
      5 FJYX Youxi, Fujian 55 118.28 26.27 308.68
      6 FJZH Zhenghe, Fujian 50 118.62 27.44 299.60
      7 GDLZ Lianzhou, Guangdong 50 112.20 25.05 195.85
      8 GZTJ Taijiang, Guizhou 50 108.31 26.58 802.62
      9 JXCY Chongyi, Jiangxi 52 115.17 26.36 219.98

      Table 1. 

      Sample numbers and geographic information for experimental analysis of nine natural populations of P. bournei

    • Locus Primer sequence (5'-3') Length (bp) Repeat motif Annealing temperature (°C) References
      L1 F:TCGATTTGCAGAAGATAAGCC 449 (ATT)14 63 Zhou et al., 2021
      R:GGGGTAGAAAAGTGAAAGAGTTG
      L2 F:AGAGGGCCTGTGCGTACGTTT 352 (TCT)12 63 Zhou et al., 2021
      R:ACATTTGAGTCGGTTCCGGTTCC
      L3 F:GCTAGAGCTCAAAGGATCCC 344 (GAA)12 63 Zhou et al., 2021
      R:GGTGGTGATTGGACTGGTAGGAG
      L5 F:GCCTGTGTTTGGAGTATGGA 229 (AG)35 63 Zhou et al., 2021
      R:TTGAGTGGAGGAAGAAGTAGAAG
      L6 F:GAGAAGGGCATCAACACCAAC 259 (CT)31 63 Zhou et al., 2021
      R:GCCTCTCCTAAGCTTTACCCA
      L8 F:GTGCTCTCTCTTGATTGTTCG 237 (CT)32 63 Zhou et al., 2021
      R:CGGATAGGGTGATATTGTGTG
      L11 F:AAGTCCGATCTCGCAAAC 283 (AG)34 63 Zhou et al., 2021
      R:CTCTTACCCTTCTTCCACC
      L13 F:CGTCTTCGTTTCGCTACT 218 (GAA)10 63 Zhou et al., 2021
      R:CCTTCTACTTCCCCAATCT
      L14 F:TCTCGCCATCCTACTTCG 432 (TTC)10 63 Zhou et al., 2021
      R:GGTTTACGGTGACCTTCG
      L15 F:AGGTTCGTCGGAGTTAGG 333 (AG)33 63 Zhou et al., 2021
      R:TTGCGTCAATGTTGCTTC
      L17 F:AACAGGAGAAGGGAAGCAATGG 375 (CTT)10 63 Zhou et al., 2021
      R:GCCTTCAGCAATGGTGTCGG
      L18 F:CAAGGGTGCCATGGTAGTGATAA 260 (GA)36 63 Zhou et al., 2021
      R:AGCCTGACCCACGCACCTATAC
      L21 F:AGTAATACCAGCAGTACCAGTC 126 (AGA)11 63 Zhou et al., 2021
      R:CAGATAGCATCAGAAGCAGA
      L23 F:AGGAATTGGAGCCGTTGGTTGT 266 (TCT)12 60 Zhou et al., 2021
      R:TACATTTGAGTCGGTTCCGGTTC
      L24 F:GTCACAGCCCCCAAAGAATA 100 (AGG)5 60 Liu, 2019
      R:GTTTCCCGCCATCACTCTTA
      L30 F:CCCCAAAATCACATTTCACC 218 (CCTTC)5 60 Liu, 2019
      R:TCAACAGTTGCTTGGAATCG

      Table 2. 

      Characteristics of sixteen SSR loci

    • Locus Na Ne I Ho He PIC Gst Nm F Null HW
      L1 9 4.36 1.65 0.41 0.76 0.91 0.149 1.26 0.46 0.15 NS
      L2 7 4.80 1.74 0.46 0.78 0.84 0.088 2.25 0.42 0.00 NS
      L3 7 4.64 1.67 0.45 0.76 0.86 0.113 1.76 0.45 0.11 NS
      L5 8 6.37 2.05 0.99 0.83 0.94 0.106 1.96 −0.20 0.00 NS
      L6 17 9.27 2.26 0.57 0.84 0.95 0.109 1.84 0.37 0.00 NS
      L8 13 3.93 1.45 0.34 0.67 0.82 0.175 1.09 0.55 0.01 **
      L11 9 7.08 2.02 0.68 0.81 0.94 0.134 1.49 0.16 0.10 NS
      L13 7 2.69 1.00 0.35 0.51 0.70 0.291 0.58 0.31 0.07 **
      L14 11 6.32 1.88 0.47 0.80 0.90 0.108 1.84 0.45 0.09 NS
      L15 15 6.90 2.03 0.46 0.81 0.96 0.139 1.38 0.43 0.08 NS
      L17 7 4.67 1.63 0.63 0.76 0.84 0.096 1.99 0.17 0.12 NS
      L18 9 6.13 1.94 0.32 0.81 0.94 0.129 1.51 0.61 0.21 NS
      L21 8 3.83 1.38 0.81 0.67 0.80 0.179 1.10 −0.18 0.13 NS
      L23 9 5.69 1.83 0.70 0.80 0.88 0.095 2.15 0.16 0.00 NS
      L24 6 2.48 0.93 0.45 0.50 0.74 0.350 0.45 0.15 0.00 **
      L30 8 2.98 1.18 0.64 0.64 0.70 0.133 1.52 0.01 0.00 *
      Total 150 82.14
      Over all 9.38 5.13 1.67 0.55 0.73 0.86 0.15 1.51 0.27 0.07
      Na number of alleles, Ne effective number of alleles, I Shannon's information index, Ho observed heterozygosity, He expected heterozygosity, PIC Polymorphic information content, Gst genetic differentiation coefficient, Nm gene flow, F fixation index, Null null allele frequency, HW Hardy-Weinberg equilibrium, NS no significant, * P < 0.05 Deviation from Hardy-Weinberg equilibrium.

      Table 3. 

      Genetic diversity parameters of P. bournei at different loci.

    • Populaton Na Ne I Ho He AR PAR Fis H
      FJSC 13.06 7.48 2.10 0.52 0.83 11.17 1.64 0.38 0.84
      FJYX 10.13 6.68 1.93 0.44 0.81 9.21 0.80 0.46 0.82
      GZTJ 13.06 6.73 2.01 0.41 0.80 11.35 1.29 0.49 0.81
      FJJO 8.81 5.33 1.74 0.44 0.76 8.81 0.90 0.45 0.78
      FJZH 8.56 4.83 1.65 0.52 0.76 7.53 1.10 0.32 0.77
      FJMX 7.00 4.06 1.47 0.47 0.69 6.36 0.48 0.33 0.70
      FJJY 8.06 4.24 1.55 0.64 0.71 7.27 0.74 0.11 0.72
      GDLZ 4.69 3.16 1.21 0.38 0.65 4.43 0.14 0.43 0.66
      JXCY 7.50 3.69 1.33 0.31 0.60 6.60 0.57 0.50 0.61
      Mean 8.99 5.13 1.67 0.46 0.73 8.08 0.85 0.39 0.75
      Ar allele richness, PAr private allele richness, Fis inbreeding coefficient, H Nei's genetic diversity index.

      Table 4. 

      Genetic diversity parameters of different natural populations of P. bournei.

    • Source of variation d.f. Sum of squares Variance components Percentage of variation P FST
      Among populations 8 984.88 1.15 16.20 <0.01 0.1620
      Within populations 911 5425.84 5.96 83.80
      Total 919 6410.72 7.11

      Table 5. 

      Analysis of AMOVA molecular variance of natural populations of P. bournei.