Figures (6)  Tables (1)

    • Figure 1. 

      (a)−(c) Root biomass, (d)−(f) root/shoot ratio, and (g)−(i) seedhead numbers of wild barley at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola, arbuscular mycorrrhizal fungi, and salt concentrations. The unit of biomass is 'g' .

    • Figure 2. 

      (a)−(c) Tiller numbers, (d)−(f) shoot biomass, and (g)−(i) total biomass of wild barley at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola, arbuscular mycorrrhizal fungi, and salt concentrations. The unit of biomass is 'g'.

    • Figure 3. 

      (a), (b) Organic carbon (C) content; (c), (d) total nitrogen (N) content; and (e), (f) total phosphorus (P) content of wild barley (aboveground and belowground) at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola (uninfected: a, c, d; infected: b, d, e), arbuscular mycorrrhizal fungi (GC, GM, GMix, M−), and salt concentrations (S1, S2, S3).

    • Figure 4. 

      (a), (b) Potassium (K+) content; (c), (d) Na+ content; and (e), (f) K+/Na+ ratio of wild barley (aboveground and belowground) at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola (uninfected: a, c, d; infected: b, d, e), arbuscular mycorrrhizal fungi (GC, GM, GMix, M−), and salt concentrations (S1, S2, S3).

    • Figure 5. 

      Effect of arbuscular mycorrrhizal fungi, NaCl and harvest time (H1, H2, H3, H4) on E. bromicola concentration.

    • Figure 6. 

      Effect of E. bromicola, harvest time (H1, H2, H3, H4), and NaCl on (a) GC concentration; (b) GM concentration; (c) GC in Gmix concentration; and (d) GM in Gmix concentration.

    • Primers 5' to 3' Function
      perA.RTF AACATCGAGCACTCTCATTGC E. bromicola peramine alkaloid
      synthesis gene forward primer
      perA.RTR CCGTTTCCGATGGTGCCATTG E. bromicola peramine alkaloid
      synthesis gene reverse primer
      GmPT.RTF ACGTGAAGTCGATGAACCAG G. mosseae specific sequence
      forward primers
      GmPT.RTR CATGACACCGCAGTACCAAC G. mosseae specific sequence
      reverse primers
      LSU.RTF GCGAGTGAAGAGGGAAGAG G. claroideum specific sequence
      forward primers
      LSU.RTR TTGAAAGCGTATCGTAGATGAAC G. claroideum specific sequence
      reverse primers

      Table 1. 

      Sequences and function of specific qPCR primes for E. bromicola, G. mosseae, and G. claroideum