-
Figure 1.
(a)−(c) Root biomass, (d)−(f) root/shoot ratio, and (g)−(i) seedhead numbers of wild barley at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola, arbuscular mycorrrhizal fungi, and salt concentrations. The unit of biomass is 'g' .
-
Figure 2.
(a)−(c) Tiller numbers, (d)−(f) shoot biomass, and (g)−(i) total biomass of wild barley at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola, arbuscular mycorrrhizal fungi, and salt concentrations. The unit of biomass is 'g'.
-
Figure 3.
(a), (b) Organic carbon (C) content; (c), (d) total nitrogen (N) content; and (e), (f) total phosphorus (P) content of wild barley (aboveground and belowground) at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola (uninfected: a, c, d; infected: b, d, e), arbuscular mycorrrhizal fungi (GC, GM, GMix, M−), and salt concentrations (S1, S2, S3).
-
Figure 4.
(a), (b) Potassium (K+) content; (c), (d) Na+ content; and (e), (f) K+/Na+ ratio of wild barley (aboveground and belowground) at four harvest times (H1, H2, H3, H4) under different treatments of E. bromicola (uninfected: a, c, d; infected: b, d, e), arbuscular mycorrrhizal fungi (GC, GM, GMix, M−), and salt concentrations (S1, S2, S3).
-
Figure 5.
Effect of arbuscular mycorrrhizal fungi, NaCl and harvest time (H1, H2, H3, H4) on E. bromicola concentration.
-
Figure 6.
Effect of E. bromicola, harvest time (H1, H2, H3, H4), and NaCl on (a) GC concentration; (b) GM concentration; (c) GC in Gmix concentration; and (d) GM in Gmix concentration.
-
Primers 5' to 3' Function perA.RTF AACATCGAGCACTCTCATTGC E. bromicola peramine alkaloid
synthesis gene forward primerperA.RTR CCGTTTCCGATGGTGCCATTG E. bromicola peramine alkaloid
synthesis gene reverse primerGmPT.RTF ACGTGAAGTCGATGAACCAG G. mosseae specific sequence
forward primersGmPT.RTR CATGACACCGCAGTACCAAC G. mosseae specific sequence
reverse primersLSU.RTF GCGAGTGAAGAGGGAAGAG G. claroideum specific sequence
forward primersLSU.RTR TTGAAAGCGTATCGTAGATGAAC G. claroideum specific sequence
reverse primersTable 1.
Sequences and function of specific qPCR primes for E. bromicola, G. mosseae, and G. claroideum
Figures
(6)
Tables
(1)