Search
2025 Volume 10
Article Contents
ARTICLE   Open Access    

New additions to the fungal species of Guyana

More Information
  • Received: 06 May 2025
    Revised: 16 July 2025
    Accepted: 05 August 2025
    Published online: 23 September 2025
    Studies in Fungi  10 Article number: e019 (2025)  |  Cite this article
  • DNA barcoding is today a standard method used for species identification, preferably in conjunction with supporting morphological data. Here, we employed DNA barcoding using the highly conserved nuclear ribosomal internal transcribed spacer (ITS) region to identify a large set of dried fungal sporocarp specimens that were collected in Guyana between 1982 and 2005. Nearly half of the 551 specimen collections sampled lacked determination below family level (indets). Our study yielded 103 ITS barcode sequences and resulted in the identification of 11 species and 3 genera previously not recorded in Guyana. Thirty-three of the indets were identified to the species level and another five were identified to the generic level. None of the ITS sequences generated in this study represented potentially undescribed species. Our study highlights the importance of fungarium reference specimens as sources of reliable reference barcode sequences for accurate species identification of unknown source DNA. Future barcoding efforts would benefit greatly from utilizing a multilocus approach and next-generation sequencing platforms.
  • 加载中
  • [1] Hyde KD, Xu J, Rapior S, Jeewon R, Lumyong S, et al. 2019. The amazing potential of fungi: 50 ways we can exploit fungi industrially. Fungal Diversity 97:1−136 doi: 10.1007/s13225-019-00430-9

    CrossRef   Google Scholar

    [2] May GS, Adams TH. 1997. The importance of fungi to man. Genome Research 7:1041−44 doi: 10.1101/gr.7.11.1041

    CrossRef   Google Scholar

    [3] Hawksworth DL. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycological Research 105:1422−32 doi: 10.1017/S0953756201004725

    CrossRef   Google Scholar

    [4] Hawksworth DL, Lücking R. 2017. Fungal diversity revisited: 2.2 to 3.8 million species. In The Fungal Kingdom, eds Heitman J, Howlett BJ, Crous PW, Stukenbrock EH, James TY, et al. US: John Wiley & Sons, Inc. pp. 79−95 doi: 10.1128/9781555819583.ch4
    [5] Xu J. 2016. Fungal DNA barcoding. Genome 59:913−32 doi: 10.1139/gen-2016-0046

    CrossRef   Google Scholar

    [6] Truong C, Mujic AB, Healy R, Kuhar F, Furci G, et al. 2017. How to know the fungi: combining field inventories and DNA-barcoding to document fungal diversity. New Phytologist 214:913−19 doi: 10.1111/nph.14509

    CrossRef   Google Scholar

    [7] Hebert PDN, Cywinska A, Ball SL, deWaard JR. 2003. Biological identifications through DNA barcodes. Proceedings Biological Sciences 270:313−21 doi: 10.1098/rspb.2002.2218

    CrossRef   Google Scholar

    [8] White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A guide to Methods and Applications, eds Innis MA, Gelfand DH, Sninsky JJ, White TJ. New York: Academic Press. pp. 315−22 doi: 10.1016/B978-0-12-372180-8.50042-1
    [9] Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, et al. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109:6241−46 doi: 10.1073/pnas.1117018109

    CrossRef   Google Scholar

    [10] Lücking R, Aime MC, Robbertse B, Miller AN, Ariyawansa HA, et al. 2020. Unambiguous identification of fungi: where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 11:14 doi: 10.1186/s43008-020-00033-z

    CrossRef   Google Scholar

    [11] Paloi S, Luangsa-ard JJ, Mhuantong W, Stadler M, Kobmoo N. 2022. Intragenomic variation in nuclear ribosomal markers and its implication in species delimitation, identification and barcoding in fungi. Fungal Biology Reviews 42:1−33 doi: 10.1016/j.fbr.2022.04.002

    CrossRef   Google Scholar

    [12] Begerow D, Nilsson H, Unterseher M, Maier W. 2010. Current state and perspectives of fungal DNA barcoding and rapid identification procedures. Applied Microbiology and Biotechnology 87:99−108 doi: 10.1007/s00253-010-2585-4

    CrossRef   Google Scholar

    [13] Brock PM, Döring H, Bidartondo MI. 2009. How to know unknown fungi: the role of a herbarium. New Phytologist 181:719−24 doi: 10.1111/j.1469-8137.2008.02703.x

    CrossRef   Google Scholar

    [14] Bruns TD, Fogel R, Taylor JW. 1990. Amplification and sequencing of DNA from fungal herbarium specimens. Mycologia 82:175−84 doi: 10.1080/00275514.1990.12025863

    CrossRef   Google Scholar

    [15] Dentinger BTM, Margaritescu S, Moncalvo JM. 2010. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms. Molecular Ecology Resources 10:628−33 doi: 10.1111/j.1755-0998.2009.02825.x

    CrossRef   Google Scholar

    [16] Telle S, Thines M. 2008. Amplification of cox2 (~620 bp) from 2 mg of up to 129 years old herbarium specimens, comparing 19 extraction methods and 15 polymerases. PLoS One 3:e3584 doi: 10.1371/journal.pone.0003584

    CrossRef   Google Scholar

    [17] Osmundson TW, Robert VA, Schoch CL, Baker LJ, Smith A, et al. 2013. Filling gaps in biodiversity knowledge for macrofungi: contributions and assessment of an herbarium collection DNA barcode sequencing project. PLoS One 8:e62419 doi: 10.1371/journal.pone.0062419

    CrossRef   Google Scholar

    [18] Kelloff CL, Alexander SN, Funk VA, Clarke HD. 2011. Smithsonian plant collections, Guyana: 1995−2004, H. David Clarke. Washington, DC: Smithsonian Institution Scholarly Press. 307 pp doi: 10.5479/si.0081024X.97.1
    [19] Alexander SN, Hoffman B, Kelloff CL, Funk VA. 2014. Smithsonian plant collections, the Guianas 1991−1993 and 1995−2000, Bruce Hoffman. DC: Smith-sonian Institution Scholarly Press. Number 101. viii, 188 pp
    [20] Henkel TW, Kelloff CL, Alexander SN, Funk VA. 2016. Smithsonian plant collections, Guyana: 1992−2014, Terry W. Henkel. Washington, DC: Smithsonian Institution Scholarly Press. iv, 206 pp
    [21] Hollowell T, Gillespie LJ, Funk VA, Kelloff CL. 2003. Smithsonian plant Collections, Guyana: 1989−1991, Lynn J. Gillespie. Washington, DC: Department of Systematic Biology-Botany, National Museum of Natural History. 104 pp
    [22] Hollowell T, McDowell T, Funk VA, Kelloff CL, Gopaul D. 2004. Smithsonian plant collections, Guyana: 1990−1991, Tim McDowell. Contributions from the United States National Herbarium 50:1−150

    Google Scholar

    [23] Kelloff CL, Alexander SN, Funk VA. 2014. 10. Smithsonian plant collections, Guyana: John J. Pipoly, III: an update. Contributions to the Study of Biological Diversity 4 4:85−92

    Google Scholar

    [24] Castellano MA, Henkel TW, Miller SL, Smith ME, Aime MC. 2012. New Elaphomyces species (Elaphomycetaceae, Eurotiales, Ascomycota) from Guyana. Mycologia 104:1244−49 doi: 10.3852/12-061

    CrossRef   Google Scholar

    [25] Fulgenzi TD, Halling RE, Henkel TW. 2010. Fistulinella cinereoalba sp. nov. and new distribution records for Austroboletus from Guyana. Mycologia 102:224−32 doi: 10.3852/09-059

    CrossRef   Google Scholar

    [26] Fulgenzi TD, Mayor JR, Henkel TW, Halling RE. 2008. New species of Boletellus from Guyana. Mycologia 100:490−95 doi: 10.3852/07-170R

    CrossRef   Google Scholar

    [27] Grupe AC II, Baker AD, Uehling JK, Smith ME, Baroni TJ, et al. 2015. Sarcodon in the Neotropics I: new species from Guyana, Puerto Rico and Belize. Mycologia 107:591−606 doi: 10.3852/14-185

    CrossRef   Google Scholar

    [28] Henkel TW, Aime MC, Mehl HK. 2009. Craterellus excelsus sp. nov. from Guyana. Mycotaxon 107:201−8 doi: 10.5248/107.201

    CrossRef   Google Scholar

    [29] Henkel TW, Aime MC, Uehling JK, Smith ME. 2011. New species and distribution records of Clavulina (Cantharellales, Basidiomycota) from the Guiana Shield. Mycologia 103:883−94 doi: 10.3852/10-355

    CrossRef   Google Scholar

    [30] Henkel TW, Obase K, Husbands D, Uehling JK, Bonito G, et al. 2016. New Boletaceae taxa from Guyana: Binderoboletus segoi gen. and sp. nov., Guyanaporus albipodus gen. and sp. nov., Singerocomus rubriflavus gen. and sp. nov., and a new combination for Xerocomus inundabilis. Mycologia 108:157−73 doi: 10.3852/15-075

    CrossRef   Google Scholar

    [31] Henkel TW, Smith ME, Aime MC. 2010. Guyanagaster, a new wood-decaying sequestrate fungal genus related to Armillaria (Physalacriaceae, Agaricales, Basidiomycota). American Journal of Botany 97:1474−84 doi: 10.3732/ajb.1000097

    CrossRef   Google Scholar

    [32] Henkel TW, Wilson AW, Aime MC, Dierks J, Uehling JK, et al. 2014. Cantharellaceae of Guyana II: new species of Craterellus, new South American distribution records for Cantharellus guyanensis and Craterellus excelsus, and a key to the Neotropical taxa. Mycologia 106:307−24 doi: 10.3852/106.2.307

    CrossRef   Google Scholar

    [33] Husbands DR, Henkel TW, Bonito G, Vilgalys R, Smith ME. 2013. New species of Xerocomus (Boletales) from the Guiana Shield, with notes on their mycorrhizal status and fruiting occurrence. Mycologia 105:422−35 doi: 10.3852/12-146

    CrossRef   Google Scholar

    [34] Largent DL, Henkel TW, Aime MC, Baroni TJ. 2008. The Entolomataceae of the Pakaraima Mountains of Guyana I: four new species of Entoloma s. str. Mycologia 100:132−40 doi: 10.1080/15572536.2008.11832505

    CrossRef   Google Scholar

    [35] Magnago AC, Alves-Silva G, Henkel TW, da Silveira RMB. 2022. New genera, species, and combinations of Boletaceae from Brazil and Guyana. Mycologia 114:607−25 doi: 10.1080/00275514.2022.2037307

    CrossRef   Google Scholar

    [36] Nuytinck J, Henkel TW, Delgat L, Milisav K, Noordermeer C, et al. 2023. Russulaceae of the Pakaraima Mountains of Guyana. IV. New species forming a distinct lineage of Lactarius subg. Plinthogalus. Mycologia 115:69−86 doi: 10.1080/00275514.2022.2125712

    CrossRef   Google Scholar

    [37] Uehling JK, Henkel TW, Aime MC, Vilgalys R, Smith ME. 2012. New species of Clavulina (Cantharellales, Basidiomycota) with resupinate and effused basidiomata from the Guiana Shield. Mycologia 104:547−56 doi: 10.3852/11-130

    CrossRef   Google Scholar

    [38] Wilson AW, Aime MC, Dierks J, Mueller GM, Henkel TW. 2012. Cantharellaceae of Guyana I: new species, combinations and distribution records of Craterellus and a synopsis of known taxa. Mycologia 104:1466−77 doi: 10.3852/11-412

    CrossRef   Google Scholar

    [39] Uehling JK, Henkel TW, Aime MC, Vilgalys R, Smith ME. 2012. New species and distribution records for Clavulina (Cantharellales, Basidiomycota) from the Guiana Shield, with a key to the lowland neotropical taxa. Fungal Biology 116:1263−74 doi: 10.1016/j.funbio.2012.09.004

    CrossRef   Google Scholar

    [40] Kelloff CL, Funk VA, Alexander SN. 2019. Smithsonian plant collections, Guiana Shield : 1985−2014, biological diversity of the Guiana Shield collections. Washington, DC: Smithsonian Institution Scholarly Press. 360 pp
    [41] Kelloff CL, Redden KM, Wurdack KJ, Alexander SN. 2023. Smithsonian plant collections, Guiana Shield. 2002−2012, Karen M. Redden and Kenneth J. Wurdack. Washington, DC: Smithsonian Institution Scholarly Press. 242 pp
    [42] Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson KH. 2008. Intraspecific ITS variability in the Kingdom fungi as expressed in the international sequence databases and its implications for molecular species identification. Evolutionary Bioinformatics 4:193−201 doi: 10.4137/EBO.S653

    CrossRef   Google Scholar

    [43] Corrales A, Koch RA, Vasco-Palacios AM, Smith ME, Ge ZW, et al. 2022. Diversity and distribution of tropical ectomycorrhizal fungi. Mycologia 114:919−33 doi: 10.1080/00275514.2022.2115284

    CrossRef   Google Scholar

    [44] Del Olmo-Ruiz M, García-Sandoval R, Alcántara-Ayala O, Véliz M, Luna-Vega I. 2017. Current knowledge of fungi from Neotropical montane cloud forests: distributional patterns and composition. Biodiversity and Conservation 26:1919−42 doi: 10.1007/s10531-017-1337-5

    CrossRef   Google Scholar

    [45] Phukhamsakda C, Nilsson RH, Bhunjun CS, de Farias ARG, Sun YR, et al. 2022. The numbers of fungi: contributions from traditional taxonomic studies and challenges of metabarcoding. Fungal Diversity 114:327−86 doi: 10.1007/s13225-022-00502-3

    CrossRef   Google Scholar

    [46] von Cräutlein M, Korpelainen H, Pietiläinen M, Rikkinen J. 2011. DNA barcoding: a tool for improved taxon identification and detection of species diversity. Biodiversity and Conservation 20:373−89 doi: 10.1007/s10531-010-9964-0

    CrossRef   Google Scholar

    [47] Sánchez-García M, Matheny PB, Palfner G, Lodge DJ. 2014. Deconstructing the Tricholomataceae (Agaricales) and introduction of the new genera Albomagister, Corneriella, Pogonoloma and Pseudotricholoma. TAXON 63:993−1007 doi: 10.12705/635.635.3

    CrossRef   Google Scholar

    [48] Schoch CL, Robbertse B, Robert V, Vu D, Cardinali G, et al. 2014. Finding needles in haystacks: linking scientific names, reference specimens and molecular data for Fungi. Database 2014:bau061 doi: 10.1093/database/bau061

    CrossRef   Google Scholar

    [49] Guerrero R, Loguercio-Leite C, Góes-Neto A. 2005. DNA extraction from frozen field-collected and dehydrated herbarium fungal basidiomata: Performance of SDS and CTAB-based methods. BIOTEMAS 18:19−32

    Google Scholar

    [50] Blattner FR. 1999. Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. BioTechniques 27:1180−86 doi: 10.2144/99276st04

    CrossRef   Google Scholar

    [51] Verkley GJM, Rossman A, Crouch JA. 2015. The role of herbaria and culture collections. In Systematics and Evolution, eds McLaughlin D, Spatafora J. Berlin, Heidelberg: Springer. pp. 205−25 doi: 10.1007/978-3-662-46011-5_8
    [52] Rogers SO. 1994. Phylogenetic and taxonomic information from herbarium and mummified DNA. In Conservation of plant genes II: utilization of ancient and modern DNA, eds Adams R, Miller JS, Golenberg EM, Adams JE. US: Missouri Botanical Garden Press. Volume 48. pp. 47−67
    [53] Kõljalg U, Abarenkov K, Nilsson RH, Larsson KH, Taylor AFS. 2019. The UNITE database for molecular identification and for communicating fungal species. Biodiversity Information Science and Standards 3:e37402 doi: 10.3897/biss.3.37402

    CrossRef   Google Scholar

    [54] Kõljalg U, Larsson KH, Abarenkov K, Nilsson RH, Alexander IJ, et al. 2005. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi. New Phytologist 166:1063−68 doi: 10.1111/j.1469-8137.2005.01376.x

    CrossRef   Google Scholar

    [55] Záveská Drábková L. 2021. Herbarium specimens: a treasure for DNA extraction, an update. In Molecular Plant Taxonomy, ed. Besse P. New York, NY: Humana. Vol 2222. pp. 69−88 doi: 10.1007/978-1-0716-0997-2_4
    [56] Roy M, Vasco-Palacios A, Geml J, Buyck B, Delgat L, et al. 2017. The (re)discovery of ectomycorrhizal symbioses in Neotropical ecosystems sketched in Florianópolis. New Phytologist 214:920−23 doi: 10.1111/nph.14531

    CrossRef   Google Scholar

    [57] Simon U, Weiss M. 2008. Intragenomic variation of fungal ribosomal genes is higher than previously thought. Molecular Biology and Evolution 25:2251−54 doi: 10.1093/molbev/msn188

    CrossRef   Google Scholar

    [58] Smith ME, Douhan GW, Rizzo DM. 2007. Intra-specific and intra-sporocarp ITS variation of ectomycorrhizal fungi as assessed by rDNA sequencing of sporocarps and pooled ectomycorrhizal roots from a Quercus woodland. Mycorrhiza 18:15−22 doi: 10.1007/s00572-007-0148-z

    CrossRef   Google Scholar

    [59] Stielow JB, Lévesque CA, Seifert KA, Meyer W, Irinyi L, et al. 2015. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia 35:242−63 doi: 10.3767/003158515X689135

    CrossRef   Google Scholar

    [60] Sun YF, Costa-Rezende DH, Xing JH, Zhou JL, Zhang B, et al. 2020. Multi-gene phylogeny and taxonomy of Amauroderma s. lat. (Ganodermataceae). Persoonia 44:206−39 doi: 10.3767/persoonia.2020.44.08

    CrossRef   Google Scholar

    [61] Baldrian P, Větrovský T, Lepinay C, Kohout P. 2022. High-throughput sequencing view on the magnitude of global fungal diversity. Fungal Diversity 114:539−47 doi: 10.1007/s13225-021-00472-y

    CrossRef   Google Scholar

    [62] Tedersoo L, Anslan S. 2019. Towards PacBio-based pan-eukaryote metabarcoding using full-length ITS sequences. Environmental Microbiology Reports 11:659−68 doi: 10.1111/1758-2229.12776

    CrossRef   Google Scholar

    [63] Tedersoo L, Bahram M, Zinger L, Nilsson RH, Kennedy PG, et al. 2022. Best practices in metabarcoding of fungi: from experimental design to results. Molecular Ecology 31:2769−95 doi: 10.1111/mec.16460

    CrossRef   Google Scholar

    [64] Tedersoo L, Liiv I, Kivistik PA, Anslan S, Kõljalg U, et al. 2016. Genomics and metagenomics technologies to recover ribosomal DNA and single-copy genes from old fruit-body and ectomycorrhiza specimens. MycoKeys 13:1−20 doi: 10.3897/mycokeys.13.8140

    CrossRef   Google Scholar

    [65] Tedersoo L, Nilsson RH, Abarenkov K, Jairus T, Sadam A, et al. 2010. 454 Pyrosequencing and Sanger sequencing of tropical mycorrhizal fungi provide similar results but reveal substantial methodological biases. New Phytologist 188:291−301 doi: 10.1111/j.1469-8137.2010.03373.x

    CrossRef   Google Scholar

    [66] Tedersoo L, Tooming-Klunderud A, Anslan S. 2018. PacBio metabarcoding of Fungi and other eukaryotes: errors, biases and perspectives. New Phytologist 217:1370−85 doi: 10.1111/nph.14776

    CrossRef   Google Scholar

    [67] Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Molecular Ecology 2:113−18 doi: 10.1111/j.1365-294X.1993.tb00005.x

    CrossRef   Google Scholar

    [68] Martin KJ, Rygiewicz PT. 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiology 5:28 doi: 10.1186/1471-2180-5-28

    CrossRef   Google Scholar

    [69] Tedersoo L, Jairus T, Horton BM, Abarenkov K, Suvi T, et al. 2008. Strong host preference of ectomycorrhizal fungi in a Tasmanian wet sclerophyll forest as revealed by DNA barcoding and taxon-specific primers. New Phytologist 180:479−90 doi: 10.1111/j.1469-8137.2008.02561.x

    CrossRef   Google Scholar

  • Cite this article

    Jacobsen F, Kelloff C, Castlebury LA. 2025. New additions to the fungal species of Guyana. Studies in Fungi 10: e019 doi: 10.48130/sif-0025-0019
    Jacobsen F, Kelloff C, Castlebury LA. 2025. New additions to the fungal species of Guyana. Studies in Fungi 10: e019 doi: 10.48130/sif-0025-0019

Figures(1)  /  Tables(2)

Article Metrics

Article views(2350) PDF downloads(1092)

Other Articles By Authors

ARTICLE   Open Access    

New additions to the fungal species of Guyana

Studies in Fungi  10 Article number: e019  (2025)  |  Cite this article

Abstract: DNA barcoding is today a standard method used for species identification, preferably in conjunction with supporting morphological data. Here, we employed DNA barcoding using the highly conserved nuclear ribosomal internal transcribed spacer (ITS) region to identify a large set of dried fungal sporocarp specimens that were collected in Guyana between 1982 and 2005. Nearly half of the 551 specimen collections sampled lacked determination below family level (indets). Our study yielded 103 ITS barcode sequences and resulted in the identification of 11 species and 3 genera previously not recorded in Guyana. Thirty-three of the indets were identified to the species level and another five were identified to the generic level. None of the ITS sequences generated in this study represented potentially undescribed species. Our study highlights the importance of fungarium reference specimens as sources of reliable reference barcode sequences for accurate species identification of unknown source DNA. Future barcoding efforts would benefit greatly from utilizing a multilocus approach and next-generation sequencing platforms.

    • Fungi comprise diverse lineages of heterotrophic eukaryote organisms which serve an array of key roles in nutrient cycling, plant and animal health, human well-being, and the food and pharmaceutical industries[1,2]. However, only about 5% of the estimated 2.2−3.8 million extant species of fungi have been described to date[3,4]. Traditionally, species identification was performed by trained mycologists through careful examination of the phenotypic properties. However, retention of shared ancestral character states and convergence of similar character states among unrelated species (i.e., unrecognized cryptic speciation) has led to a severe underestimation of species diversity[5,6].

      Since Hebert et al.[7] first introduced the concept of DNA barcoding as a molecular tool for species identification, mycologists have explored genes with high primer fidelity and adequate resolution power across taxonomic levels. White et al.[8] were the first to propose the internal transcribed spacer (ITS) region of the nuclear rRNA gene cluster as a suitable marker for phylogenetic research across the fungal kingdom, and the ITS has since been ratified as the universal barcode for fungi[9,10]. However, a few caveats limit the utility of the ITS for species identification: (1) sequences are only available for about half of the 140,000 or so known fungal species[5], (2) the presence of intragenomic variation may affect the accuracy of species identification[11], and (3) there is a shortage of reliable high-quality reference sequences from type specimens[12]. The vast collections of historical type and other voucher fungal specimens preserved in fungaria around the world therefore represent an invaluable source of DNA for barcoding and phylogenetic studies. DNA barcoding becomes an especially important tool in identification of dried voucher specimens for which few or no morphological records exist. Although isolation and amplification of DNA from fungarium specimens is substantially more challenging than working with fresh source material, it is fully possible to successfully amplify barcode sequences from a specimen more than 100 years old[1317].

      The Guyana Shield is a highly biodiverse region of northeastern South America. It is characterized by an ancient geological formation that features several unique table-top mountain plateaus (tepuis) rising above the surrounding tropical savannas, lowland and montane forests, and montane scrub, resulting in high endemism of plants and animals. In 1983, the Smithsonian Institution's National Museum of Natural History (NMNH) initiated the Biological Diversity of the Guyana Shield (BDG) program to study, document, and preserve the biological diversity of this unique biogeographical region of South America. With most of its diverse habitats still intact, the relatively unexplored country of Guyana has attracted special attention. Between 1983 and 2005, the BDG led several expeditions across Guyana to map its flora and mycota[1823]. The many thousands of fungal specimens collected during these expeditions were distributed to herbaria across the world, where they serve as an invaluable source of reference material for future mycology studies[13]. Thus, the exhaustive collection efforts by the BDG program and subsequent follow-up studies in this region of South America have greatly enhanced our knowledge of tropical fungal biodiversity, resulting in the discovery and description of numerous new species[2439].

      A subset of the fungal collections from Guyana (~550 samples of dried fruiting bodies) was distributed to the United States National Fungus Collections (BPI), where they have remained in storage until the present. Roughly half of these collections were indeterminates (indets); i.e., specimens that could not be identified to the species or genus level at the time of collection. Unfortunately, few indets were accompanied by morphological records to aid in later identification efforts. The growing record of fungal discoveries coming out of Guyana since the initiation of the BDG program (see above) demonstrates that much remains to be learned about the mycota of the Guyana Shield. The large number of fungal specimens from Guyana kept in storage at the National Fungal Collections awaiting accessioning into the fungarium therefore holds the potential to harbor several rare and undescribed species from this biodiverse region of South America. The objectives of this study were (1) to examine the collection of dried fruiting bodies with the specific aim of providing determinations of the many indets by means of DNA barcoding and (2) obtaining accession samples for which molecular determinations could be made in the United States National Fungus Collections (BPI).

    • This study included dried fruiting bodies (sporocarps) from 551 unique samples collected at multiple locations and habitats across Guyana and the border region with Brazil over a long time period (1982–2005). The fungal collection effort varied greatly from expedition to expedition, and the number of specimens collected peaked during the time periods 1990–1994 and 1998–2002 (Fig. 1). The details of each expedition, including route maps and descriptions of collecting sites and habitats are freely available in a series of Smithsonian Contributions to Botany publications[1823,40,41].

      Figure 1. 

      Temporal distribution of specimens' sampling and sequencing success.

    • About 10–100 mg of dried sporocarp tissue was taken from each sample and placed in 2-mL tubes containing 500-µm garnet and 6-mm zirconium Satellite beads (Ops Diagnostics, Lebanon, New Jersey) and subsequently ground to a fine powder using a three-dimensional (3D) Precellys Evolution homogenizer (Bertin, Montigny-le-Bretonneux, France). Genomic DNA was subsequently extracted using a Qiagen DNeasy Plant Mini Extraction Kit (Qiagen, Valencia, California), following the manufacturer's protocols.

      The highly variable ITS regions between the 18S, 5.8S, and 28S nuclear ribosomal genes were amplified using a suite of primer combinations, targeting basidiomycetes and ascomycetes (Table 1). Amplification reactions included 12.5 µL of KAPA2G Robust HotStart ready-mix (KAPA Biosystems, Wilmington, Massachusetts), 1.25 µL of each primer (10 µM/L), 1−2 µL of template DNA, and distilled H2O for a total reaction volume of 25 µL. Polymerase chain reactions (PCRs) were performed on a Bio-Rad C1000 Touch Thermal Cycler (Life Science, Hercules, California) under the following conditions: 3 min of initial denaturing at 95 °C, followed by 35 cycles of 30 s of denaturing at 95 °C, 15 s of annealing at 50 °C and 1 min of extension at 72 °C, and a final extension at 72 °C for 5 min. Amplification success was assessed by running 12 µL of the PCR products on an automated capillary QIAxcel Advanced electrophoresis system (Qiagen, Valencia, California). Amplicons were cleaned enzymatically using the following protocol: a mixture of 1 µL of Exonuclease I, 1 µL of shrimp alkaline phosphatase, and 3 µL of the PCR product was placed in a thermocycler and digested at 37 °C for 15 min and 80 °C for 15 min. Cleaned amplicons were sequenced using BigDye v.3.1 chemistry (Applied BioSystems, Foster City, California) with the same primers used for amplification. Sequencing products were purified using ethanol–ethylenediaminetetraacetic acid (EDTA) precipitation and run on a SeqStudio Genetic Analyzer (Applied Biosystems, Foster City, California). Sequence contigs were assembled and edited in Sequencher v. 5.5 (GeneCodes Corp., Ann Arbor, Michigan). Finally, BLASTn searches were conducted in GenBank (https://blast.ncbi.nlm.nih.gov/) to verify or determine species' identification using the traditional 97% ITS sequence identity as a DNA barcoding threshold[42].

      Table 1.  Fungal ITS (internal transcribed spacer) primers used in this study.

      Primer name Oligo sequence (5'→3') Ref.
      ITS1 TCCGTAGGTGAACCTGCGG [8]
      ITS1F CTTGGTCATTTAGAGGAAGTAA [67]
      ITS4 TCCTCCGCTTATTGATATGC [8]
      ITS4b CAGGAGACTTGTACACGGTCCAG [67]
      ITS5 GGAAGTAAAAGTCGTAACAAGG [8]
      NLB3 GGATTCTCACCCTCTATGA [68]
      NLB4 GGATTCTCACCCTCTATGAC [68]
      NSI1 GATTGAATGGCTTAGTGAGG [68]
      LB-W CTTTTCATCTTTCCCTCACGG [69]
      LA-W CTTTTCATCTTTCGATCACTC [69]
    • One hundred and three (103) high-quality ITS sequences were retrieved from the 551 specimens included in this study. Comparison with other ITS sequences in GenBank identified 76 fungal taxa distributed into 30 families (Table 2). From this, we uncovered 3 genera and 11 species that had never before been recorded in Guyana, according to data in MyCoPortal (www.mycoportal.org), GenBank (www.ncbi.nlm.nih.gov), Global Biodiversity Information Facility (GBIF, www.gbif.org) and iNaturalist (www.inaturalist.org). DNA barcoding provided identifications to the species level for 33 unknown samples (i.e., indets), and 5 specimens to the genus level, and added identifications to the species level for specimens for which only generic determinations and few morphological records existed previously. Another 34 ITS barcode sequences confirmed prior morphological determinations made by the original collectors. Finally, in 10 instances, the ITS barcode sequence conflicted with the previous determination made on the basis of the morphology and/or chemical characteristics. The ITS barcode sequences provided closely matched congeners or closely related genera, warranting close re-examination of the specimens involved. None of the identifications provided by ITS barcoding represent potentially undescribed species. The designation to genus level rather reflected a lack of sequence differentiation among congeners than a lack of close matches in GenBank BLAST searches. The ITS sequences generated by this study have been deposited in GenBank with the accession numbers shown in Table 2.

      Table 2.  Fungal taxa identified by BLASTN queries of ITS sequences in GenBank.

      Family Taxon GenBank
      Agaricaceae Leucoagaricus sp. PP102299
      Amanitaceae Amanita cyanopus C.M. Simmons, T.W. Henkel & Bas PP102312
      Amanita fulvoalba Mighell & T.W. Henkel PP102313
      Auriculariaceae Auricularia delicata
      (Mont. ex Fr.) Henn.
      PP102310
      Auricularia fuscosuccinea1 (Mont.) Henn. PP102308−102309
      Boletaceae Brasilioporus rufonigricans (T.W. Henkel) A.C. Magnago & T.W. Henkel PP102325
      Austroboletus rostrupii
      (Syd. & P. Syd.) E. Horak
      PP830805
      Chalciporus sp. PP830806
      Chalciporus trinitensis, aff. (Heinem.) Singer, I.J.A. Aguiar & M.H. Ivory PP102328
      Singerocomus inundabilis (Singer) T.W. Henkel & Husbands PP102315
      Tylopilus sp. PP102324
      Tylopilus balloui (Peck) Singer PP102323, PP830803
      Tylopilus exiguus T.W. Henkel PP830800−830801
      Tylopilus orsonianus Fulgenzi & T.W. Henkel PP102319−102321, PP830802
      Tylopilus potamogeton var. irengens T.W. Henkel PP102322
      Tylopilus vinaceipallidus (Corner) T.W. Henkel PP102316−102318
      Xerocomus potaroensis T.W. Henkel & Husbands PP102326−102327, PP830804
      Callistosporiaceae Guyanagarika pakaraimensis Sánchez-García,
      T.W. Henkel & Aime
      PP102307
      Cantharellaceae Cantharellus guyanensis
      Mont.
      PP102304
      Clavariaceae Clavaria zollingeri Lév. PP102362
      Clavulinaceae Clavulina sp. PP830810
      Clavulina caespitosa T.W. Henkel, Meszaros & Aime PP102358
      Clavulina connata1, cf.
      (Berk.) Corner
      PP102355
      Clavulina craterelloides Thacker & T.W. Henkel PP102356−102357
      Clavulina dicymbetorum T.W. Henkel, Meszaros & Aime PP102360
      Clavulina kunmudlutsa T.W. Henkel & Aime PP102361
      Clavulina tepurumenga T.W. Henkel & Aime PP102359
      Cordycipitaceae Cordyceps sp. PP102372
      Cordyceps polyarthra1 Möller PP102371
      Cordyceps takaomontana Yakush. & Kumaz. PP102370
      Coriolaceae Agaricus sp. PP102298
      Dacrymycetaceae Dacryopinax spathularia (Schwein.) G.W. Martin PP102354
      Elaphomycetaceae Elaphomyces sp. PP102365
      Pseudotulostoma volvatum O.K. Mill. & T.W. Henkel PP102366−102369
      Entolomataceae Entoloma sp. PP830796
      Nolanea sp. PP830797
      Rhodocybe sp. PP102314
      Incertae sedis Ductifera pululahuana (Pat.) Donk PP102311
      Geastraceae Geastrum sp. PP102376
      Gloeophyllaceae Gloeophyllum sp. PP102330
      Gloeophyllum striatum
      (Fr.) Murrill
      PP102329
      Hygrophoraceae Hygrocybe sp. PP102295−102296
      Hygrocybe conica var. brevipora (Dennis) S.A. Cantrell & Lodge PP830807
      Hymenochaetaceae Fuscoporia gilva (Schwein.)
      T. Wagner & M. Fisch
      PP102353
      Hysterangiaceae Hysterangium sp. PP102293−102294
      Inocybaceae Inocybe lilacinosquamosa Matheny, Aime & T.W. Henkel PP102297
      Meruliaceae Cymatoderma dendriticum (Pers.) D.A. Reid PP102351
      Irpex lacteus (Fr.) Fr. PP102350
      Phlebia1 radiata1Fr. PP102349
      Mycenaceae Panellus stipticus1 (Bull.)
      P. Karst.
      PP102300−102301
      Physalacriaceae Cyptotrama sp. PP102302
      Polyporaceae Favolus brasiliensis (Fr.) Fr. PP102322
      Fomes fasciatus (Sw.) Cooke PP102333−102334
      Hexagonia variegata Berk. PP102331
      Hexagonia hydnoides (Sw.)
      M. Fidalgo
      PP830809
      Lentinus crinitus (L.) Fr. PP102337
      Lentinus scleropus (Pers.) Fr. PP102338
      Lentinus swartzii1 Berk. PP102335−102336, PP830808
      Panus strigellus (Berk.) Chardón & Toro PP102339−102340
      Trametes sp. PP102347−102348
      Trametes sanguinea
      (Klotzsch) Pat.
      PP102341−102345
      Trametes trogii Berk. PP102346
      Stereaceae Stereum sanguinolentum1
      (Alb. & Schwein.) Fr.
      PP102352
      Russulaceae Russula sp. PP830798
      Russula gelatinivelata S.L. Mill., Aime & T.W. Henkel PP102305, PP830799
      Russula puiggarii
      (Speg.) Singer
      PP102306
      Sarcoscyphaceae Cookeina speciosa (Fr.) Dennis PP102364
      Cookeina tricholoma
      (Mont.) Kuntze
      PP102363
      Sclerodermataceae Scleroderma sp. PP102303
      Squamanitaceae Squamanita guyanensis
      T.W. Henkel & I. Saar
      PP102378
      Xylariaceae Daldinia eschscholtzii1 (Ehrenb.) Rehm PP102373
      Xylaria sp. PP102375, PP830811
      Xylaria ophiopoda1 Sacc. PP102374
      Nectriaceae Corallonectria1 jatrophae1 (Möller) C.S. Herrera &
      P. Chaverri
      PP102377
      Neophysopellaceae Neophysopella1 vitis1 (P. Syd.) Jing X. Ji & Kakish. PP830812
      1Taxa new to Guyana.

      Successful amplification of the ITS region from these 20- to 30-year-old field-collected fruiting bodies proved very challenging. Although the overall success was low, the amplification and sequencing success improved significantly over time when comparing the proportion of ITS barcode sequences obtained relative to the number of samples examined from the early years of the BDG program (1982–1994) with the later years (1996–2005) (Fig. 1, p = 0.03, Mann–Whitney U-test). False positives were rampant due to microbial contamination (e.g., Aspergillus, Malassezia, Metarhizium, Penicillium, and Physisporinus). Typically, repeated rounds of amplifications under varying PCR conditions (i.e., annealing temperature, amount of DNA template, different primer combinations) were necessary before clean amplicons of appropriate length (600−1,100 bps) were acquired. Curiously, tissue samples from certain fungal groups (especially boletes and carbon fungi such as Xylaria) repeatedly produced very dark DNA extracts. These samples consistently failed to amplify the ITS region. Diluting the extracts in double-distilled water did not improve the amplification success of these samples.

    • This study underscores the value of well-curated voucher specimens as essential resources for building reliable DNA reference libraries and linking names to sequences, which, in turn, form the foundation for biodiversity studies, conservation planning, and environmental monitoring. The challenges of extracting high-quality DNA from historical fungaria specimens also reiterates the need for continued collection of fresh specimens from poorly studied regions of the world, as well as targeted collection of fungal groups that are poorly represented in herbaria[4346].

      The specimens examined here were collected over an extended time period and under various storage conditions, two factors which clearly affected the quality of the source material, the degree of DNA degradation, and ultimately the ability to successfully amplify and sequence the > 600-bp ITS region from these old, dried fungal specimens. As expected, the proportion of samples that successfully yielded a high-quality barcode sequence declined significantly over time. Although vouchered type specimens and historical fungarium collections represent invaluable sources of reference material for linking DNA sequences to species names[47,48], efforts to retrieve ITS barcode sequences from historical vouchers can be a challenging and costly exercise[6,15]. As demonstrated here, successful amplification of a 600-bp ITS barcode sequence from older fungarium specimens requires more rigorous DNA extraction procedures and PCR troubleshooting[13,49]. For poorly preserved specimens, a time-consuming and laborious alternative to direct amplification is to amplify the two subunits of the ITS region (ITS-1 and ITS-2) separately and sequence shorter overlapping fragments that are later assembled in silico[50]. In addition to degrading the DNA's quality, the age of fungarium specimens and the method used to preserve them also significantly increases the risk of contamination[13,51]. The specimens examined in this study were all collected, sorted, and dry-preserved in the field during extended expeditions into remote tropical areas of South America, and subsequently stored in boxes on office shelves for nearly two decades until the present day. These are all factors which likely contributed to the pervasive levels of microbial (primarily by molds and yeasts) and biochemical contamination in our DNA samples, which, in many instances, severely hampered our ability to amplify uncontaminated ITS sequences from dried sporocarp tissues. Finally, it has been shown that residual polysaccharides and secondary metabolites such as phenolic compounds can adversely affect the DNA extraction process[52]. Certain fungal groups contain more of these compounds than others and will often yield DNA extracts that appear cloudy or stained from pigmentation[49]. The dark pigmentation observed in several DNA extracts obtained from bolete specimens belonging to the genera Lactarius, Tylopilus, and Xerocomus is suggestive of the presence of such metabolites and could help explain why we repeatedly failed to amplify the ITS barcode region from these specimens. In spite of all of these complicating factors, the seemingly low PCR and sequencing success rate of 18.7% (103/551 samples) achieved in this study is actually in line with success rates reported elsewhere on similarly aged specimens[15].

      As so eloquently stated by Begarow et al.[12], "Any species identification effort employing DNA barcoding will be only as good as the available reference sequences permit". This challenge has prompted the development of independent databases such as UNITE (http://unite.ut.ee), with the aim of reliably identifying fungi to the species level using carefully curated high-quality reference sequences[53,54]. The wealth of reference specimens available in herbaria around the world should serve a key role in achieving this goal[17,55]. However, not all fungal lineages are equally represented in fungaria. Most historic collection efforts have focused on sampling fruiting bodies of mushroom-forming macrofungi that are only available temporally and thus are easily overlooked. In order to capture unknown fungal diversity and improve the representation of under-sampled lineages in public DNA repositories, it is therefore necessary to support continued efforts to systematically collect, document, and extract high-quality DNA from fresh specimens in the field, especially from geographical regions where comparatively fewer collections exist, such as South America[56].

      The ITS region displays great variability in DNA sequence divergence across fungal lineages, which complicates its utility as a universal barcode for fungi[42,57,58]. This variability further limits our ability to assign a species identification to environmental samples and unidentified dried specimens with poor morphological descriptions. Since sequence variation in the ITS region is not always sufficient for accurate species identification, it has been argued that a multi-locus phylogenetic approach is needed to accurately resolve species' relationships and assign a taxonomic affiliation to unknown samples[59]. Several additional nuclear loci have demonstrated great promise as complementary secondary barcodes (e.g., nLSU, TEF1, and RPB2) when the ITS alone fails to resolve species-level relationships[5,60]. However, rapid advances in next-generation sequencing technology and drastic cost reductions have made genomic barcoding an increasingly feasible alternative to the traditional reliance on a single universal barcode marker[12,6166].

    • This study demonstrates both the promise and the challenges of using DNA barcoding to inventory and re-evaluate historical fungal collections from biodiverse yet underexplored regions such as the Guyana Shield. By successfully recovering 103 high-quality ITS sequences from 551 fungarium specimens collected in Guyana several decades ago, we were able to document 76 fungal taxa, including 3 genera and 11 species previously unrecorded in that country. DNA barcoding provided new or confirmed identifications for numerous specimens, highlighting the critical role of molecular tools in resolving the substantial fraction of indeterminate collections that remain in fungaria around the world. Despite the significant obstacles posed by degraded DNA, microbial contamination, and the inhibitory secondary metabolites inherent in older specimens, the sequencing success rate achieved here is consistent with comparable studies of historical collections. However, our findings also illustrate the limitations of relying solely on the ITS as a universal barcode. Inconsistent sequence divergence across fungal lineages, coupled with incomplete coverage in public databases, often constrains the resolution of taxonomic identifications. To address this, a multilocus or genomic barcoding approach should be prioritized in future studies to enhance discriminatory power and improve confidence in species-level assignments. Finally, this work reinforces the need for renewed and systematic collection of fresh fungal material, particularly from biodiversity hotspots such as the Guyana Shield, where fungal diversity remains vastly underestimated. Investments in expanding taxonomic expertise, sequencing efforts, and curation of both new and legacy specimens will be essential to close persistent knowledge gaps and better capture the true scope of fungal diversity on Earth.

      • This project was supported by funds appropriated to the United States Department of Agriculture (USDA) (Agricultural Research Service [ARS] National Program 301 project #8042-22000-327-000-D). This project was supported in part by an appointment (research fellowship to Frode Jacobsen) to the ARS Research Participation Program administered by the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the US Department of Energy (DOE) and the USDA. ORISE is managed by Oak Ridge Associated Universities (ORAU) under DOE contract No. DE-SC0014664. All opinions expressed in this paper are the author's and do not necessarily reflect the policies and views of USDA, DOE, or ORAU/ORISE. Special thanks go to the Smithsonian Institution's National Museum of Natural History for providing the specimens included in this study. Catalina Salgado-Salazar and John Hall provided valuable assistance in the laboratory.

      • This research did not involve any studies with human participants, and no ethical approval was required according to the institutional and national regulations.

      • The authors confirm contributions to the paper as follows: study conception and design: Jacobsen F, Castlebury LA; data collection: Jacobsen F, Kelloff C; analysis and interpretation of results: Jacobsen F, Castlebury LA; draft manuscript preparation: Jacobsen F, Kelloff C, Castlebury LA. All authors reviewed the results and approved the final version of the manuscript.

      • The genome sequences of fungi utilized in this research project are available online at the GenBank Nucleotide database of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov). Fungal specimen records are available online at the MyCoPortal (www.mycoportal.org) and GBIF (www.gbif.org) databases.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (1)  Table (2) References (69)
  • About this article
    Cite this article
    Jacobsen F, Kelloff C, Castlebury LA. 2025. New additions to the fungal species of Guyana. Studies in Fungi 10: e019 doi: 10.48130/sif-0025-0019
    Jacobsen F, Kelloff C, Castlebury LA. 2025. New additions to the fungal species of Guyana. Studies in Fungi 10: e019 doi: 10.48130/sif-0025-0019

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return