Search
2025 Volume 4
Article Contents
ARTICLE   Open Access    

Identification and adaptive evolution analysis of FAR1/FHY3 in Eleutherococcus senticosus and prediction of target genes regulating saponin synthesis

More Information
  • Light plays a significant role in affecting secondary metabolic processes in the medicinal plant Eleutherococcus senticosus. The FAR1/FHY3 gene family responds to variations in light quality and play diverse roles in plant growth and development. However, few studies have explored and functionally analyzed the EsFAR1/FHY3 gene family. In this study, 21 EsFAR1/FHY3 genes, exhibiting uneven distribution across 14 chromosomes, were identified in E. senticosus using bioinformatic tools. EsFAR1/FHY3 genes were divided into five subfamilies. The gene structure and conserved domains within each subfamily were similar. There were many collinear relationships between FAR1/FHY3 in E. senticosus and FAR1/FHY3 in related species. Evolutionary analysis indicated that EsFAR1/FHY3 underwent predominantly negative selection and was highly conserved. There were 5−15 light response elements in the EsFAR1/FHY3 promoter. The results of RNA sequencing and real-time fluorescence quantitative PCR showed that 15 EsFAR1/FHY3 genes were differentially expressed after irradiation with different light qualities. Molecular docking showed that four EsFAR1/FHY3 genes stably bind to the promoter of the farnesyl diphosphate synthase (FPS) gene involved in saponin synthesis. These findings suggest that EsFAR1/FHY3 responds to changes in light quality and interacts with the promoter of the saponin synthase gene in E. senticosus, offering insights into the molecular mechanism underlying the impact of light quality on the secondary metabolism of E. senticosus.
  • 加载中
  • Supplementary Table S1 Basic information of Eleutherococcus senticosus FAR1/FHY3 transcription factor family members.
    Supplementary Table S2 Analysis of cis-acting elements of EsFAR1/FHY3 promoter.
    Supplementary Table S3 EsFAR1/FHY3 promoter sequence.
    Supplementary Table S4 LRT test results.
    Supplementary Fig. S1 EsFAR1/FHY3 cis-acting element analysis.
  • [1] Yadav A, Singh D, Lingwan M, Yadukrishnan P, Masakapalli SK, et al. 2020. Light signaling and UV-B-mediated plant growth regulation. Journal of Integrative Plant Biology 62(9):1270−92 doi: 10.1111/jipb.12932

    CrossRef   Google Scholar

    [2] Pierik R, Ballaré CL. 2022. Control of Plant Growth and Defense by Photoreceptors: From Mechanisms to Opportunities in Agriculture. Molecular Plant 15(11):1825 doi: 10.1016/j.molp.2022.10.011

    CrossRef   Google Scholar

    [3] Li J, Li G, Gao S, Martinez C, He G, et al. 2010. Arabidopsis transcription factor ELONGATED HYPOCOTYL5 plays a role in the feedback regulation of phytochrome A signaling. The Plant Cell 22(11):3634−49 doi: 10.1105/tpc.110.075788

    CrossRef   Google Scholar

    [4] Wang H, Wang H. 2015. Multifaceted roles of FHY3 and FAR1 in light signaling and beyond. Trends in Plant Science 20(7):453−61 doi: 10.1016/j.tplants.2015.04.003

    CrossRef   Google Scholar

    [5] Dai J, Sun J, Peng W, Liao W, Zhou Y, et al. 2022. FAR1/FHY3 transcription factors positively regulate the salt and temperature stress responses in Eucalyptus grandis. Frontiers in Plant Science 13:883654 doi: 10.3389/fpls.2022.883654

    CrossRef   Google Scholar

    [6] Ma L, Li G. 2018. FAR1-RELATED SEQUENCE (FRS) and FRS-RELATED FACTOR (FRF) family proteins in Arabidopsis growth and development. Frontiers in Plant Science 9:692 doi: 10.3389/fpls.2018.00692

    CrossRef   Google Scholar

    [7] Du J, Zhang L, Ge X, Xiang X, Cao D, et al. 2021. Genome-wide identification and characterization of the FAR1/FHY3 Family in Populus trichocarpa Torr. & Gray and expression analysis in light response. Forests 12(10):1385 doi: 10.3390/f12101385

    CrossRef   Google Scholar

    [8] Lin R, Wang H. 2004. Arabidopsis FHY3/FAR1 gene family and distinct roles of its members in light control of Arabidopsis development. Plant Physiology 136(4):4010−22 doi: 10.1104/pp.104.052191

    CrossRef   Google Scholar

    [9] Xie Y, Zhou Q, Zhao Y, et al. 2020. FHY3 and FAR1 integrate light signals with the miR156-SPL module-mediated aging pathway to regulate Arabidopsis flowering. Molecular Plant 13(3):483−98 doi: 10.1016/j.molp.2020.01.013

    CrossRef   Google Scholar

    [10] Xie Y, Liu Y, Ma M, Zhou Q, Zhao Y, et al. 2020. Arabidopsis FHY3 and FAR1 integrate light and strigolactone signaling to regulate branching. Nature Communications 11(1):1955 doi: 10.1038/s41467-020-15893-7

    CrossRef   Google Scholar

    [11] Zhang K, Lin C, Chen B, Lin Y, Su H, et al. 2024. A light responsive transcription factor CsbHLH89 positively regulates anthocyanidin synthesis in tea (Camellia sinensis). Scientia Horticulturae 327:112784 doi: 10.1016/j.scienta.2023.112784

    CrossRef   Google Scholar

    [12] Li C, Jiao M, Zhao X, Ma J, Cui Y, et al. 2024. bZIP transcription factor responds to changes in light quality and affects saponins synthesis in Eleutherococcus senticosus. International Journal of Biological Macromolecules 279:135273 doi: 10.1016/j.ijbiomac.2024.135273

    CrossRef   Google Scholar

    [13] Shohael AM, Ali MB, Yu KW, Hahn EJ, Islam R, et al. 2006. Effect of light on oxidative stress, secondary metabolites and induction of antioxidant enzymes in Eleutherococcus senticosus somatic embryos in bioreactor. Process Biochemistry 41(5):1179−1185 doi: 10.1016/j.procbio.2005.12.015

    CrossRef   Google Scholar

    [14] Tang H, Jing D, Liu C, Xie X, Zhang L, et al. 2024. Genome-wide identification and expression analyses of the FAR1/FHY3 gene family provide insight into inflorescence development in maize. Current Issues in Molecular Biology 46(1):430−49 doi: 10.3390/cimb46010027

    CrossRef   Google Scholar

    [15] Jiang Y, Zeng Z, He G, Liu M, Liu C, et al. 2024. Genome-wide identification and integrated analysis of the FAR1/FHY3 gene family and genes expression analysis under methyl jasmonate treatment in Panax ginseng C. A. Mey. BMC Plant Biology 24(1):549 doi: 10.1186/s12870-024-05239-6

    CrossRef   Google Scholar

    [16] Zhao X, Zhang J, Dong J, Kou X, Cui Y, et al. 2024. Identification and functional analysis of DNA methylation-related enzyme gene family in Eleutherococcus senticosus. Industrial Crops and Products 213:118412 doi: 10.1016/j.indcrop.2024.118412

    CrossRef   Google Scholar

    [17] Dong J, Zhao X, Song X, Wang S, Zhao X, et al. 2024. Identification of Eleutherococcus senticosus NAC transcription factors and their mechanisms in mediating DNA methylation of EsFPS, EsSS, and EsSE promoters to regulate saponin synthesis. BMC Genomics 2024;25(1):536

    Google Scholar

    [18] Todorova V, Ivanov K, Delattre C, Nalbantova V, Karcheva-Bahchevanska D, et al. 2021. Plant adaptogens-history and future perspectives. Nutrients 13(8):2861 doi: 10.3390/nu13082861

    CrossRef   Google Scholar

    [19] Wang X, Dai Z, Fang JS. 2022. Research progress of Acanthopanax senticosus in prevention and treatment of neurodegenerative diseases. China Journal of Chinese Materia Medica] 47(16):4314−21 doi: 10.19540/j.cnki.cjcmm.20220307.701

    CrossRef   Google Scholar

    [20] Wang Z, Guo H, Zhang Y, Lin L, Cui M, et al. 2019. DNA methylation of farnesyl pyrophosphate synthase, squalene synthase, and squalene epoxidase gene promoters and effect on the saponin content of Eleutherococcus senticosus. Forests 10(12):1053 doi: 10.3390/f10121053

    CrossRef   Google Scholar

    [21] Guo S, Zhang S, Jia L, Xu M, Wang Z. 2020. Root growth of Eleuthero (Eleutherococcus senticosus [Rupr. & Maxim.] Maxim.) seedlings cultured with chitosan oligosaccharide addition under different light spectra. Notulae Botanicae Horti Agrobotanici Cluj-napoca 48:626−35 doi: 10.15835/nbha48211634

    CrossRef   Google Scholar

    [22] Guo S, Wang H, Sui Y, Liu X, Tan L. 2022. Bioactive extracts and association with C and N in Eleutherococcus senticosus subjected to chitosan nanoparticles in contrasting light spectra. PLoS One 17(12):e0277233 doi: 10.1371/journal.pone.0277233

    CrossRef   Google Scholar

    [23] Yang Z, Chen S, Wang S, Hu Y, Zhang G, et al. 2021. Chromosomal-scale genome assembly of Eleutherococcus senticosus provides insights into chromosome evolution in Araliaceae. Molecular Ecology Resources 21(7):2204−20 doi: 10.1111/1755-0998.13403

    CrossRef   Google Scholar

    [24] Jiao MY, Zhang J, Cheng WW, Song X, Long YH, et al. 2023. Identification of the AP2/ERF transcription factor family of Eleutherococcus senticosus and its expression correlation with drought stress. 3 Biotech 13(7):259 doi: 10.1007/s13205-023-03678-w

    CrossRef   Google Scholar

    [25] Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, et al. 2020. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Molecular Plant 13(8):1194−202 doi: 10.1016/j.molp.2020.06.009

    CrossRef   Google Scholar

    [26] Wang Y, Zhang H, Ri HC, An Z, Wang X, et al. 2022. Deletion and tandem duplications of biosynthetic genes drive the diversity of triterpenoids in Aralia elata. Nature Communications 13(1):2224 doi: 10.1038/s41467-022-29908-y

    CrossRef   Google Scholar

    [27] Bos DH, Posada D. 2005. Using models of nucleotide evolution to build phylogenetic trees. Developmental & Comparative Immunology 229(3):211−27 doi: 10.1016/j.dci.2004.07.007

    CrossRef   Google Scholar

    [28] Yang Z. 2007. PAML 4: phylogenetic analysis by maximum likelihood. Molecular Biology and Evolution 24(8):1586−91 doi: 10.1093/molbev/msm088

    CrossRef   Google Scholar

    [29] Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, et al. 2005. GROMACS: fast, flexible, and free. Journal of Computational Chemistry 26(16):1701−18 doi: 10.1002/jcc.20291

    CrossRef   Google Scholar

    [30] Kiss PT, Sega M, Baranyai A. 2014. Efficient handling of gaussian charge distributions: An application to polarizable molecular models. Journal of Chemical Theory and Computation 10(12):5513−9 doi: 10.1021/ct5009069

    CrossRef   Google Scholar

    [31] Aviat F, Levitt A, Stamm B, Maday Y, Ren P, et al. 2017. Truncated conjugate gradient: An optimal strategy for the analytical evaluation of the many-body polarization energy and forces in molecular simulations. Journal of Chemical Theory and Computation 13(1):180−90 doi: 10.1021/acs.jctc.6b00981

    CrossRef   Google Scholar

    [32] He Z, Hu Y, Zhang Y, Xie J, Niu Z, et al. 2024. Asiaticoside exerts neuroprotection through targeting NLRP3 inflammasome activation. Phytomedicine 127:155494 doi: 10.1016/j.phymed.2024.155494

    CrossRef   Google Scholar

    [33] Li X, Li Y, Qiao Y, Lu S, Yao K, et al. 2024. Genome-wide identification and expression analysis of FAR1/FHY3 gene family in Cucumber (Cucumis sativus L. ). Agronomy 14(1):50

    Google Scholar

    [34] Wang H, Deng XW. 2002. Arabidopsis FHY3 defines a key phytochrome A signaling component directly interacting with its homologous partner FAR1. The EMBO Journal 21(6):1339−49 doi: 10.1093/emboj/21.6.1339

    CrossRef   Google Scholar

    [35] Li G, Siddiqui H, Teng Y, Lin R, Wan XY, et al. 2011. Coordinated transcriptional regulation underlying the circadian clock in Arabidopsis. Nature Cell Biology 13(5):616−22 doi: 10.1038/ncb2219

    CrossRef   Google Scholar

    [36] Cimermancic P, Medema MH, Claesen J, Kurita K, Wieland Brown LC, et al. 2014. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. Cell 158(2):412−421 doi: 10.1016/j.cell.2014.06.034

    CrossRef   Google Scholar

    [37] Medema MH, Kottmann R, Yilmaz P, Cummings M, Biggins JB, et al. 2015. Minimum information about a biosynthetic gene cluster. Nature Chemical Biology 11(9):625−631 doi: 10.1038/nchembio.1890

    CrossRef   Google Scholar

    [38] Wisecaver JH, Slot JC, Rokas A. 2014. The evolution of fungal metabolic pathways. PLoS Genetics 10(12):e1004816 doi: 10.1371/journal.pgen.1004816

    CrossRef   Google Scholar

    [39] Shang Y, Ma Y, Zhou Y, Zhang H, Duan L, et al. 2014. Biosynthesis, regulation, and domestication of bitterness in cucumber. Science 346(6213):1084−88 doi: 10.1126/science.1259215

    CrossRef   Google Scholar

    [40] Williams AM, Carter OG, Forsythe ES, Mendoza HK, Sloan DB. 2022. Gene duplication and rate variation in the evolution of plastid ACCase and Clp genes in angiosperms. Molecular Phylogenetics and Evolution 168:107395 doi: 10.1016/j.ympev.2022.107395

    CrossRef   Google Scholar

    [41] Huff JT, Zilberman D, Roy SW. 2016. Mechanism for DNA transposons to generate introns on genomic scales. Nature 538:533−36 doi: 10.1038/nature20110

    CrossRef   Google Scholar

    [42] Liu Z, An C, Zhao Y, Xiao Y, Bao L, et al. 2004. Genome-wide identification and characterization of the CsFHY3/FAR1 gene family and expression analysis under biotic and abiotic stresses in tea plants (Camellia sinensis). Plants 10(3):570 doi: 10.3390/plants10030570

    CrossRef   Google Scholar

    [43] Chen S, Chen Y, Liang M, Qu S, Shen L, et al. 2023. Genome-wide identification and molecular expression profile analysis of FHY3/FAR1 gene family in walnut (Juglans sigillata L.) development. BMC Genomics 24(1):673 doi: 10.1186/s12864-023-09629-2

    CrossRef   Google Scholar

    [44] Cai Z, Du W, Liu L, Pan D, Lu L. 2019. Molecular characteristics of the conserved Aspergillus nidulans transcription factor Mac1 and its functions in response to copper starvation. mSphere 4(1):e00670-18 doi: 10.1128/mSphere.00670-18

    CrossRef   Google Scholar

    [45] Düsterhöft S, Kahveci-Türköz S, Wozniak J, Seifert A, Kasparek P, et al. 2021. The iRhom homology domain is indispensable for ADAM17-mediated TNFα and EGF receptor ligand release. Cellular and Molecular Life Sciences 78(11):5015−40 doi: 10.1007/s00018-021-03845-3

    CrossRef   Google Scholar

    [46] Lu Q, Liu H, Hong Y, Liang X, Li S, et al. 2022. Genome-wide identification and expression of FAR1 gene family provide insight into pod development in Peanut (Arachis hypogaea). Frontiers in Plant Science 13:893278 doi: 10.3389/fpls.2022.893278

    CrossRef   Google Scholar

    [47] Tang H, Bowers JE, Wang X, Ming R, Alam M, et al. 2008. Synteny and collinearity in plant genomes. Science 320(5875):486−88 doi: 10.1126/science.1153917

    CrossRef   Google Scholar

    [48] Chen Q, Yang H, Feng X, Chen Q, Shi S, et al. 2022. Two decades of suspect evidence for adaptive molecular evolution-negative selection confounding positive-selection signals. National Science Review 9(5):nwab217 doi: 10.1093/nsr/nwab217

    CrossRef   Google Scholar

    [49] Baek K, Lee Y, Nam O, Park S, Sim SJ, et al. 2016. Introducing Dunaliella LIP promoter containing light-inducible motifs improves transgenic expression in Chlamydomonas reinhardtii. Biotechnology Journal 11(3):384−392 doi: 10.1002/biot.201500269

    CrossRef   Google Scholar

    [50] Zhang Z, Ren C, Zou L, Wang Y, Li S, et al. 2018. Characterization of the GATA gene family in Vitis vinifera: genome-wide analysis, expression profiles, and involvement in light and phytohormone response. Genome 61(10):713−23 doi: 10.1139/gen-2018-0042

    CrossRef   Google Scholar

    [51] Shomali A, Aliniaeifard S, Kamrani YY, Lotfi M, Aghdam MS, et al. 2024. Interplay among photoreceptors determines the strategy of coping with excess light in tomato. The Plant Journal 118(5):1423−38 doi: 10.1111/tpj.16685

    CrossRef   Google Scholar

    [52] Casal JJ. 2013. Photoreceptor signaling networks in plant responses to shade. Annual Review of Plant Biology 64:403−27 doi: 10.1146/annurev-arplant-050312-120221

    CrossRef   Google Scholar

    [53] Lin R, Ding L, Casola C, Ripoll DR, Feschotte C, et al. 2007. Transposase-derived transcription factors regulate light signaling in Arabidopsis. Science 318:1302−5 doi: 10.1126/science.1146281

    CrossRef   Google Scholar

    [54] Liu Y, Ma M, Li G, Yuan L, Xie Y, et al. 2020. Transcription factors FHY3 and FAR1 regulate light-induced CIRCADIAN CLOCK ASSOCIATED1 gene expression in Arabidopsis. The Plant Cell 32(5):1464−78 doi: 10.1105/tpc.19.00981

    CrossRef   Google Scholar

  • Cite this article

    Li C, Ma J, Wu P, Kou X, Jiao M, et al. 2025. Identification and adaptive evolution analysis of FAR1/FHY3 in Eleutherococcus senticosus and prediction of target genes regulating saponin synthesis. Medicinal Plant Biology 4: e016 doi: 10.48130/mpb-0025-0013
    Li C, Ma J, Wu P, Kou X, Jiao M, et al. 2025. Identification and adaptive evolution analysis of FAR1/FHY3 in Eleutherococcus senticosus and prediction of target genes regulating saponin synthesis. Medicinal Plant Biology 4: e016 doi: 10.48130/mpb-0025-0013

Figures(7)  /  Tables(2)

Article Metrics

Article views(4225) PDF downloads(788)

ARTICLE   Open Access    

Identification and adaptive evolution analysis of FAR1/FHY3 in Eleutherococcus senticosus and prediction of target genes regulating saponin synthesis

Medicinal Plant Biology  4 Article number: e016  (2025)  |  Cite this article

Abstract: Light plays a significant role in affecting secondary metabolic processes in the medicinal plant Eleutherococcus senticosus. The FAR1/FHY3 gene family responds to variations in light quality and play diverse roles in plant growth and development. However, few studies have explored and functionally analyzed the EsFAR1/FHY3 gene family. In this study, 21 EsFAR1/FHY3 genes, exhibiting uneven distribution across 14 chromosomes, were identified in E. senticosus using bioinformatic tools. EsFAR1/FHY3 genes were divided into five subfamilies. The gene structure and conserved domains within each subfamily were similar. There were many collinear relationships between FAR1/FHY3 in E. senticosus and FAR1/FHY3 in related species. Evolutionary analysis indicated that EsFAR1/FHY3 underwent predominantly negative selection and was highly conserved. There were 5−15 light response elements in the EsFAR1/FHY3 promoter. The results of RNA sequencing and real-time fluorescence quantitative PCR showed that 15 EsFAR1/FHY3 genes were differentially expressed after irradiation with different light qualities. Molecular docking showed that four EsFAR1/FHY3 genes stably bind to the promoter of the farnesyl diphosphate synthase (FPS) gene involved in saponin synthesis. These findings suggest that EsFAR1/FHY3 responds to changes in light quality and interacts with the promoter of the saponin synthase gene in E. senticosus, offering insights into the molecular mechanism underlying the impact of light quality on the secondary metabolism of E. senticosus.

    • Light is an important abiotic factor affecting plant growth and development. In addition to providing energy for the plant's photosynthesis, they also provide the plant with valuable environmental information[1]. Plants can perceive and utilize light of varying quality, duration, and wavelength using diverse photoreceptors, such as phytochromes and transcription factors[2]. In Arabidopsis thaliana, genes encoding different phytochromes are named phyA to phyE. These phytochromes can detect red and far-red light, regulate various life activities and processes of plants[3,4].

      Far-red impaired response 1 (FAR1) and its homologous protein, far-red elongated hypocotyl 3 (FHY3), are homologous proteins derived from transposases[4]. They are key members of the FAR1-related sequence (FRS) family. They function redundantly to regulate phyA signal transduction[5]. FAR1/FHY3s are widely found in angiosperms and are recognized as founding members of the FRS and FRS-related factor gene families. Initially identified in A. thaliana, they are crucial components of the phyA-mediated far-red light-signaling pathway[4]. The FAR1/FHY3 protein contains three domains: C2H2 zinc finger domain, central core transposase, and SWIM zinc finger domain. Among these, the C2H2 zinc finger domain binds to DNA, whereas the core transposase domain and SWIM zinc finger domain are required for homologous or heterologous dimerization and transcriptional activation activity[6,7]. As a transcription factor originating from an ancient mutant-like transposase, FAR1/FHY3 binds to cis-acting elements within the functional gene promoter, either as a homodimer or heterodimer, to modulate the expression of downstream genes[8]. At present, studies have shown that the FAR1/FHY3 gene family plays an important role in response to light changes. The unique role of Arabidopsis FAR1/FHY3 gene family and its members in light control of Arabidopsis development[8]. FAR1/FHY3 regulates flowering time by integrating ambient light signals with the miR156-SPL module-mediated senescence pathway[9]. It can also directly up-regulate the expression of SMXL6 and SMXL7 in response to light changes to promote Arabidopsis branching[10]. Light can significantly affect the secondary metabolism of plants. For example, the light signal transduction factor CsHY5 of tea plant can bind to the promoter of the anthocyanin synthesis-related gene CsbHLH89 of Camellia sinensis and indirectly promote the accumulation of anthocyanin[11]. Different light quality can regulate the accumulation of triterpenoid saponins in E. senticosus by regulating the expression of bZIP transcription factor[12]. The study by Shohael et al. showed that different light conditions could affect the accumulation of biomass and secondary metabolites of E. senticosus[13]. Therefore, we have reason to speculate that the FAR1/FHY3 gene family of E. senticosus can respond to light changes and affect the accumulation of secondary metabolites of E. senticosus. Previous studies have shown that FAR1/FHY3 transcription factors positively regulate salt stress and temperature stress responses in Eucalyptus grandis[5]. Genome-wide identification and expression analysis of Zea mays FAR1/FHY3 gene family provide insights into maize inflorescence development[14]. The whole genome identification, integration analysis, and gene expression analysis under methyl jasmonate treatment of Panax ginseng FAR1/FHY3 gene family provide an experimental reference for the subsequent verification of the function of the family members under methyl jasmonate signal transduction[15]. However, the genome-wide identification of the FAR1/FHY3 gene family in E. senticosus and the internal mechanism of how it responds to light quality changes and regulates the accumulation of secondary metabolites are rarely studied.

      Eleutherococcus senticosus (Rupr. et Maxim) Maxim is an important traditional medicinal plant[16,17]. It has various pharmacological effects, including anti-fatigue and anti-cancer properties, lowering blood sugar levels, and improving myocardial metabolism, making it a highly valuable medicinal plant[18]. E. senticosus contains a variety of active ingredients, for instance, saponins, coumarins, flavonoids, and polysaccharides[19]. Among these, triterpenoid saponins are the main active components[16,17]. The East Asian, European and American markets have seen the commercialization of numerous E. senticosus products as dietary supplements or clinical drugs[16,17,20]. Extensive research has led to a preliminary understanding of the mechanism of triterpenoid saponin synthesis at the genetic and epigenetic levels to enhance the quality of E. senticosus[16,17,20]. Recent studies have shown that, in addition to genetic factors, light quality at different wavelengths significantly influences the growth[21], and secondary metabolism[13,22] of E. senticosus. There is, however, no clear understanding of how light quality impacts E. senticosus's ability to synthesize and accumulate secondary metabolites. Therefore, the analysis of the transcriptional regulation of genes related to secondary metabolism by photoreceptors, such as the light-responsive transcription factors of E. senticosus, has become a crucial research focus.

      In 2021, the sequencing of the E. senticosus genome was finalized[23], creating advantageous circumstances for conducting a comprehensive analysis of the EsFAR1/FHY3 transcription factor family on a genomic scale. In this study, the family members of EsFAR1/FHY3 were systematically screened and identified from the genome sequencing data of E. senticosus. Based on this, a study of the physical and chemical properties of the protein was conducted, as well as a study of the chromosomal distribution and gene expansion of EsFAR1/FHY3. The gene structure and evolutionary characteristics of the EsFAR1/FHY3 family were investigated. Simultaneously, EsFAR1/FHY3 and its regulated target genes in response to light quality changes were screened using transcriptome sequencing data, which provided a reference for the functional identification and utilization of EsFAR1/FHY3 in E. senticosus.

    • The Pfam database was used to obtain the hidden Markov model corresponding to the FAR1/FHY3 protein (PF03101, PF10551, and PF04434). Genome sequencing data of E. senticosus[23] were obtained according to a previously published method[16], and the FAR1/FHY3 protein domain was identified. The above sequences were further confirmed by NCBI CD-Search tools, PFAM, and SMART tools[24] to determine the number and composition of EsFAR1/FHY3 family members.

    • The AtFAR1/FHY3 protein sequence was downloaded from the Arabidopsis TAIR 9.0 genome database. ClustalW was utilized to conduct multiple sequence alignments of the selected EsFAR1/FHY3 and AtFAR1/FHY3 protein sequences. Using MEGA X software and the method from previous literature[14], the phylogenetic tree of EsFAR1/FHY3 and AtFAR1/FHY3 gene families was constructed. Using the ProtParam software on ExPASy, the basic physicochemical properties of EsFAR1/FHY3 were analyzed[16,17].

    • The intraspecific collinearity of the EsFAR1/FHY3 protein sequence was analyzed using MCScanX[16,25]. The AeFAR1/FHY3 gene was screened from the genomic sequencing data of Aralia elata[26], and collinearity between FAR1/FHY3 of E. senticosus and FAR1/FHY3 of A. elata was analyzed[16,17]. EsFAR1/FHY3 was mapped to the chromosome of E. senticosus using MapChart[17].

    • The conserved domain of EsFAR1/FHY3 was analyzed using the Conserved Domain Database tool, and the conserved motif of EsFAR1/FHY3 was predicted using the MEME tool[17]. The promoter sequence was obtained from the 2 Kb region that is upstream of the start codon of the EsFAR1/FHY3 gene. Predictions of the cis-acting elements for EsFAR1/FHY3 were made utilizing the PLANTCARE software[16].

    • The phylogenetic tree was constructed using the method outlined in a previous study[24]. The evolutionary trend and selection pressure of EsFAR1/FHY3 gene were speculated by estimating the ratio (ω) of nonsynonymous substitution rate (dN) to synonymous substitution rate (dS) of nucleotide sequence[24]. When dN < dS, that is, ω < 1, the negative selection pressure is indicated. When dN = dS, that is, ω = 1, the choice is neutral. When dN > dS, that is, ω > 1, there is a positive selection[27]. The site model of Comdelc program[28] was used to analyze the selection pressure of EsFAR1/FHY3 gene during evolution. The site model assumes that the ω values of different sites are different, but the ω values of each branch on the evolutionary tree are the same. In this study, three models were used for the LRT test: M1a (near neutral) to M2a (positive selection), M0 (single ratio) to M3 (discrete), and M7 (beta) to M8 (beta & ω) to verify whether there were differences[27].

    • In this study, two-year-old E. senticosus from the same clone cutting propagation from Yilan County, Heilongjiang Province, China was used as the experimental material. The same growing E. senticosus was divided into four groups, nine plants in each group, and cultivated in a plant culture room with LED control light quality. The leaves of E. senticosus were 30 cm away from the light source, and the light intensity was 37.5 μmol·m−2·s−1. The growth conditions of E. senticosus were as follows: constant temperature 22 °C, light 16 h, dark 8 h. A total of four light qualities, white light (W), blue light (B), red light (R), and green light (G), were used to irradiate E. senticosus plants, of which white light treatment was the control. The wavelength range was 300~800 nm. After 30 d of treatment, mature leaves with similar growth status, no disease, no mechanical damage, and complete morphology were collected as experimental materials for subsequent analysis. Transcriptome, metabolome analysis, and physiological index determination were performed in triplicate.

    • According to the transcriptome sequencing data of E. senticosus under different light-quality conditions (PRJNA1031420), the EsFAR1/FHY3 gene retrieved from the genome was mapped to the transcriptome sequencing data using the BLAST program. Based on the results of transcriptome sequencing, the expression of EsFAR1/FHY3 under different light-quality conditions was analyzed, and a gene expression heat map was drawn using the FPKM value of EsFAR1/FHY3 under different light-quality conditions[16].

    • Leaves of E. senticosus cultured under white, red, blue, and green lights for 20 d were collected. RNA was extracted following the instructions of the RNA Prep Pure Plant Kit and reverse transcribed into complementary DNA. Complementary DNA was used as a qRT-PCR template, and the GAPDH gene of E. senticosus was used as an internal reference gene[16,17,20]. Specific amplification primers required for qRT-PCR were designed for differentially expressed EsFAR1/FHY3 genes (Table 1). The qRT-PCR reaction was repeated three times for each sample. Using a previously described method, the total reaction system and conditions were set[16]. The total reaction system was 10 μl: cDNA 0.5 μl, upstream and downstream primers 0.3 μl, 2× SGExcel FastSYBR Mixture 5 μl, RNase-Free dd H2O 3.9 μl. Reaction conditions: pre-denaturation at 95 °C 3 min, 5 °C 15 s, 60 °C 20 s, 72 °C 25 s, 40 cycles.

      Table 1.  qRT-PCR amplification primers of EsFAR1/FHY3 genes.

      Gene Primer sequences (5'-3') Segment size (bp)
      Cluster-36682.1 CCAAACTCTACCGACAACAT 183
      AACCCACTCTTCTCAACCAG
      Cluster-102049.6 AGCAGACTTGGCGACAGATA 187
      AACCGATAAAGGACTACGAAT
      Cluster-89581.4 TTTTCTATCCGCCGTCATCG 196
      CTCCCAATTCAGTTGTCTTGCTTA
      Cluster-69743.0 CAGTGGCTCCATTCACAGGG 214
      ATACAGTGGCGGGCTTCAGG
      Cluster-102049.5 AGCAGACTTGGCGACAGATA 188
      GAACCGATAAAGGACTACGA
      Cluster-84138.0 ACTATCTTGGTCCACGTTTC 191
      TTCCTGCTTACTGCACTCTG
      Cluster-87448.8 ACTCTTGCGTTTAGTTCCAT 166
      CTCCGTCAGTTCACAGTCTTA
      Cluster-71679.0 TGCTATTGCGGCAGTCTTTC 182
      GCAGTTTCCACCACCTCTTT
      Cluster-89581.3 TTTTCTATCCGCCGTCATCG 196
      CTCCCAATTCAGTTGTCTTGCTTA
      Cluster-89581.5 CCTGGTCATATCCTTCGTCA 207
      CTAAGAATGCCTTCAGTGCC
      Cluster-101653.3 GCACCCAAATTCTCCCGTTCC 152
      TGGCTTAGGGCTATGTCAGG
      Cluster-101653.6 AATGTTACTTCGCCGTCCTC 192
      AATGGGTGGTTGATCGTCTT
      Cluster-96057.0 GTCTAGTAGTCAGCGAGCAG 200
      TAGCCATTTGTCTATCCATC
      Cluster-86052.0 AAAAGTAAGTGTCCCAACCA 157
      GAGTCGCAATGAGAAAGAAG
      Cluster-87127.4 CCAGCCACTTCTCAATCTCA 220
      CTTCATCACCACTACGCATG
    • The online website of the Plant Transcriptional Regulatory Map was used to predict whether the EsFAR1/FHY3 protein could bind to the promoters of farnesyl diphosphate synthase (FPS), squalene synthase (SS), and squalene epoxidase (SE)[17,20], which are key enzyme genes in the triterpenoid saponin biosynthesis pathway of E. senticosus, along with their respective binding sites. The protein sequence was docked with the DNA promoter sequence using HDOCK SERVER[17]. Using GROMACS 2022.2[29], molecular dynamics (MD) simulations were performed. The ligand topology file and protein topology file were generated using SobTop 1.0 software and AMBER99SB-ILDN force field, respectively. In the MD simulation, the minimum distance between the simulation box and the protein in the XYZ direction was 1.0 nm. The steepest descent[30] and conjugate gradient methods[31] were used to minimize energy. Isothermal isovolumetric and isobaric equilibrium simulations were performed for 2 ns. A total of 100 ns MD simulations wereconducted. In the MD simulation, theminimum distance between the simulation box and the protein inthe XYZ direction was 1.0 nm. Although the two descriptions are similar, one is the description of the analysis time, and the other is the description of the spatial distance. The root mean square deviation (RMSD) was calculated to analyze the trajectory of molecular dynamics[32].

    • A total of 21 EsFAR1/FHY3 gene family members were identified from the genome of E. senticosus using the hidden Markov model and BLAST alignment of FAR1/FHY3 (Supplementary Table S1). The protein encoded by EsFAR1/FHY3 ranged from 683 to 2,184. The molecular weight ranged from 78.54 and 246.27 kDa. The theoretical isoelectric points ranged from 6.16 to 8.67, including 12 basic and 10 acidic amino acids. The instability coefficients ranged from 37.9 and 58.23. Proteins with stability coefficients < 40 are known to be stable proteins[33]. In E. senticosus, only Ese01G001009.t1 was a stable protein, whereas the other proteins were unstable. The aliphatic coefficients were < 100, and the average coefficient of hydrophilicity was < 0; therefore, EsFAR1/FHY3 proteins were hydrophilic proteins.

    • To analyze the phylogenetic evolution of EsFAR1/FHY3 family. Two to four FAR1/FHY3 transcription factors were selected from each classification of AtFAR1/FHY3 in A. thaliana as a reference. MEGA X was used to analyze the phylogeny of the 21 EsFAR1/FHY3 proteins. The results showed that the EsFAR1/FHY3 family was divided into five subfamilies, namely, the I–V subfamilies (Fig. 1a). Subtribe I and subtribe II were first clustered together in one branch, whereas subtribe III and subtribe V were first clustered in one branch, indicating that their genetic relationships were closer. Notably, subfamily IV has the most members (8), whereas subfamily V has the fewest members with only two family members.

      Figure 1. 

      Phylogenetic, chromosomal localization, and collinearity analysis of EsFAR1/FHY3 gene family. (a) Phylogenetic tree of EsFAR1/FHY3 gene family. The triangle represents EsFAR1/FHY and the asterisk represents AtFAR1/FHY. (b) Location of EsFAR1/FHY3 on chromosomes. (c) Intraspecific collinearity analysis of the EsFAR1/FHY3. (d) Collinearity analysis of species. Green represents FAR1/FHY3 with collinearity, and gray represents other collinearity genes.

    • The chromosome localization of EsFAR1/FHY3 gene was analyzed. We found that 21 EsFAR1/FHY3 genes were unevenly distributed across 14 chromosomes of E. senticosus (Fig. 1b). Among them, the highest number of EsFAR1/FHY3 genes was found on chromosome 6 (4), whereas the remaining 13 chromosomes had 1–3 EsFAR1/FHY3 genes each. There was no distribution of EsFAR1/FHY3 on chromosomes 2, 11–14, 16–18, 20, and 24.

      The collinearity within and between species was analyzed. The results of the intra-species collinearity analysis (Fig. 1c) revealed that out of the 21 EsFAR1/FHY3 genes, only one collinear gene pair was identified between Ese04G002049.t1 on chromosome 4 and Ese10G002497.t1 on chromosome 10. To study the evolutionary relationship of the FAR1/FHY3 gene family between E. senticosus and its related species, we selected A. elata and E. senticosus, which have completed genome sequencing, for interspecies collinearity analysis. The results showed that a total of 18 pairs of collinear genes were identified between E. senticosus and A. elata (Fig. 1d). The number of collinear genes on chromosomes 1 and 6 was the highest, with three pairs, and there were two pairs of syntenic genes on chromosomes 19 and 21–23, respectively. There was only one pair of FAR1/FHY3 with collinearity on chromosomes 3, 4, 10, and 15. Moreover, the syntenic genes of A. elata and E. senticosus were mostly distributed at both ends of the chromosome in the form of clusters, indicating that gene duplication and evolution in A. elata and E. senticosus were also similar.

    • The conserved motifs, conserved domains, and gene structure of EsFAR1/FHY3 were analyzed. Ten conserved motifs (named Motif 1 to Motif 10) were identified in the EsFAR1/FHY3 gene family (Fig. 2a). Among them, except Ese10G002497.t1, Ese04G002049.t1, Ese19G001149.t1, and Ese22G000038.t2 only contain Motif 1 to Motif 9, other EsFAR1 / FHY3 contain all 10 conserved motifs. The position of each conserved motif in EsFAR1/FHY3 was consistent and the gene structure was essentially the same, indicating that EsFAR1/FHY3 was highly conserved throughout the evolutionary process. The reliability of the classification results was verified by phylogenetic analysis. The conserved domain types of the EsFAR1/FHY3 gene family mainly belonged to the MULE, FAR1, SWIM, and FAR1 superfamily (Fig. 2b).

      Figure 2. 

      Gene structure and conserved motif analysis of EsFAR1/FHY3. (a) Distribution of the EsFAR1/FHY3 conserved motifs. (b) Conserved domain of EsFAR1/FHY3. (c) Intron structure of EsFAR1/FHY3. The green box represents an exon. The line represents an intron. (d) Seqlogo of core conserved Motif 2 in EsFAR1/FHY3. (e) Seqlogo of core conserved Motif 2 in AtFAR1/FHY3.

      The results of the gene structure analysis of EsFAR1/FHY3 showed that the length of EsFAR1/FHY3 was mostly within 20 kb, with only Ese15G000770.t1 being approximately 80 kb. Among the 21 EsFAR1/FHY3 genes, four contained UTR structures: Ese08G001774.t1, Ese09G000248.t1, Ese23G002115.t1, and Ese22G000038.t2. Among them, Ese08G001774.t1 and Ese23G002115.t1 contained the 5'-UTR, whereas Ese09G000248.t1 and Ese22G000038.t2 contained the 3'-UTR. All EsFAR1/FHY3 genes contained 1–4 intron fragments (Fig. 2c). Motif sequences of FAR1/FHY3 in E. senticosus were compared with those of FAR1/FHY3 in A. thaliana. It was found that the Motif 2 sequences of EsFAR1/FHY3 (Fig. 2d) and AtFAR1/FHY3 (Fig. 2e) were similar, whereas those of other motifs were relatively different. Therefore, we speculated that Motif 2 was the most conserved domain among all EsFAR1/FHY3 and AtFAR1/FHY3 motifs. The gene structure of EsFAR1/FHY3 in each subfamily was approximately the same and the conserved domains and positions were also similar, indicating that EsFAR1/FHY3 is highly evolutionarily conserved.

    • The cis-acting elements of the promoter region of the EsFAR1/FHY3 gene were analyzed. There were a large number of cis-acting elements in the promoter region of EsFAR1/FHY3 (Supplementary Table S2), including light response elements, stress response elements, and plant hormone response elements. The number of light-response elements was the highest (Supplementary Fig. S1, Supplementary Table S3). These light response elements mainly included Box 4, G-box, TCT-motif, GT1-motif, ATCT-motif, and GATA-motif. The number of light-responsive elements per EsFAR1/FHY3 promoter ranged from 5 to 15. The Ese23G002115.t1 promoter contained the most light-responsive elements (15), whereas the Ese06G000968.t1 promoter contained the least light-responsive elements, with only five elements (Fig. 3).

      Figure 3. 

      Analysis of light response elements of EsFAR1/FHY3 promoter.

    • The adaptive evolution of EsFAR1/FHY3 gene was analyzed. Branch and site models were selected to analyze the selection pressure of EsFAR1/FHY3. The results showed that in the branch model, the LRT test result between the single-ratio model M0 and free-ratio model MF was p < 0.001. The LRT test results of the free-ratio and single-ratio models showed that the free-ratio model was superior to the single-ratio model, indicating that the selection pressures on different branches varied (Table 2).

      Table 2.  Adaptive evolutionary analysis of E. senticosus FAR1 / FHY3 gene.

      Model Parameter ΔInL Parameter estimation
      M0 41 −17546.660334 ω = 0.12627
      MF 79 −17466.425540 ωA = 0.326188 ωB = 0.168392
      ωC = 0.6544
      M1a 42 −17471.416569 P0 = 0.91334 ω0 = 0.12650
      P1 = 0.08666 ω1 = 1.00000
      M2a 44 −17471.416569 P0 = 0.91334 ω0 = 0.12650
      P1 = 0.08665 ω1 = 1.00000
      P2 = 0.00001 ω2 = 1.00000
      M3 45 −17218.555062 P0 = 0.12241 ω0 = 0.00701
      P1 = 0.41439 ω1 = 0.07580
      P2 = 0.46321 ω2 = 0.23545
      M7 42 −17216.044985 p = 1.10252 q = 6.38677
      M8 44 −17216.046811 p0 = 0.99999 p = 1.10254
      q = 6.38697 p1 = 0.00001
      ω = 1.00000

      To determine the possibility of multiple selections of specific sites in EsFAR1/FHY3, we selected the site model for the calculation (Supplementary Table S4). The results showed that the LRT test results of single-ratio model M0 and discrete model M3 were p < 0.01. This shows that the alternative hypothesis model M3 was established and there was no positive selection site. The result of the LRT between the M1a and M2a models was p = 1.000, indicating that M2a was invalid. In the comparison between models M7 and M8, the LRT test result was p = 0.998, indicating that model M8 was not established. The calculation results of the site model revealed that there were no positive selection sites in the evolution of EsFAR1/FHY3 and that negative selection prevailed.

    • To study the effect of light quality on the expression of EsFARI/FHY3. EsFARI/FHY3 identified from the genome was compared with the transcriptome sequencing data of E. senticosus under red-, green-, blue-, and white-light quality irradiation using BLAST. Eighteen EsFARI/FHY3 transcripts were also identified. Among them, the expression levels of 15 EsFARI/FHY3 genes were differentially expressed under various light qualities (∣Fold Change∣ ≥ 2). Most of the differentially expressed EsFARI/FHY3 were upregulated under red or blue light. Only four EsFARI/FHY3 genes were significantly upregulated under green light, whereas the other EsFARI/FHY3 were downregulated under green light (Fig. 4a). This shows that EsFARI/FHY3 expression changes in response to different changes in light quality.

      Figure 4. 

      Effect of light quality on EsFAR1/FHY3 expression. (a) Expression of EsFAR1/FHY3 in transcriptome sequencing results. (b) Expression of EsFAR1/FHY3 was verified by qRT-PCR.

      To ensure the reliability of the expression levels of EsFARI/FHY3 observed in the transcriptome sequencing data, we conducted qRT-PCR analysis on 15 genes that were identified as differentially expressed. The findings indicated that the transcriptome sequencing data for EsFARI/FHY3 expression closely aligned with what was obtained through qRT-PCR (Fig. 4b), suggesting that the differentially expressed EsFARI/FHY3 identified using transcriptome sequencing data was reliable.

    • To predict the regulatory effect of EsFAR1/FHY3 on the target gene of E. senticosus saponin synthesis. The 15 differentially expressed EsFARI/FHY3 were predicted to bind to the promoters of EsFPS, EsSS, and EsSE. Only four EsFARI/FHY3 members of subfamily I bound to the 'CTCTCGCGCTCT' site of the EsFPS promoter (Fig. 5a), whereas EsFARI/FHY3 in other subfamilies did not bind to the promoters of these saponin synthase genes. The results of molecular docking showed (Fig. 5b) that six amino acids, ASN (91), SER (92), SER (125), SER (127), ASN (236), and ASN (239), in the Ese09G000343.t1 encoded protein formed hydrogen bonds with the EsFPS promoter. The eight amino acids ASP (41), LYS (74), ARG (77), GLU (84), LYS (89), LYS (117), SER (119), and GLU (138) in the protein encoded by Ese06G000968.t1 formed hydrogen bonds with the EsFPS promoter. The seven amino acids LYS (45), LYS (53), ARG (69), ARG (165), ARG (168), ASN (169), and ASN (174) in the protein encoded by Ese15G000770.t1 formed hydrogen bonds with the EsFPS promoter. The ten amino acids TYR (62), ARG (79), SER (81), ARG (82), ARG (83), LYS (86), SER (87), LYS (89), GLY (158), and CYS (168) in the protein encoded by Ese03G002606.t1 formed hydrogen bonds with the EsFPS promoter.

      Figure 5. 

      Analysis of the binding of EsFAR1/FHY3 to the promoter of E. senticosus saponin synthase gene. (a) Binding site assay. (b) Molecular docking of EsFAR1/FHY3 and EsFPS.

      MD simulations were conducted to demonstrate the stability of the interaction between EsFAR1/FHY3 and specific binding sites of the EsFPS promoter (CTCTCGCGCTCT) (Fig. 6a). RMSD was used to evaluate the structural changes and stability of the complex (Fig. 6b). The RMSD fluctuation ranges of the complexes formed by Ese09G000343.t1, Ese06G000968.t1, Ese15G000770.t1, Ese03G002606.t1, and EsFPS were approximately 2 Å, 10 Å, 11 Å, and 12 Å, respectively. These results indicated that EsFAR1/FHY3 exhibited strong stability after binding to the EsFPS promoter. Furthermore, root mean square fluctuation (RMSF) was used to analyze amino acid movement, revealing RMSF values ranging from 3 to 11 Å for the four complexes (Fig. 6c). Notably, the Ese09G000343.t1-EsFPS complex exhibited the lowest RMSD and RMSF values, indicating fewer fluctuations and higher relative stability. The surface visual conformation of the complex within 100 ns of MD simulation is shown in Fig. 6d. The simulation results showed that Ese09G000343.t1, Ese06G000968.t1, Ese15G000770.t1, and Ese03G0026060.t1 remained tightly bound to the EsFPS promoter-binding site throughout the simulation, indicating a stable interaction of these four EsFAR1/FHY3 with the EsFPS promoter. This stable interaction is crucial for the binding of the EsFPS promoter and expression regulation of the EsFPS gene.

      Figure 6. 

      MD simulation results of EsFAR1/FHY3 binding to EsFPS promoter. (a) Visualization of MD simulation. (b) RMSD of all atoms in the complex. (c) RMSF of all atoms in the complex. (d) Surface conformation of the complex between 0 and 100 ns.

    • The FAR1/FHY3 gene family plays multiple roles in plant physiological development, for instance responding to light signals[4] and stress[34], and regulating the biological clock and flowering time[35]. A total of 59 FAR1/FHY3 genes, distributed across 21 chromosomes, have been identified in Panax ginseng by Jiang et al.[15]. Li et al.[33] identified 20 FAR1/FHY3 genes distributed across six chromosomes in Cucumis sativus. There are 21 EsFAR1/FHY3 genes were identified in the genome of E. senticosus, which were distributed across 14 chromosomes. Studies have shown that genes of enzymes involved in the biosynthetic pathway of secondary metabolites are organized into clusters in the genome[3638]. Anti-nutritive triterpenoids (cucurbitacins) related to bitterness in cucumber are typical examples of natural compound gene clusters[39]. Gene clusters of plant defense compounds were also found in monocots and dicots. For example, the momilactones biosynthetic gene cluster in rice[39]. EsFAR1/FHY3 distribution on only a few chromosomes may be similar to this feature. Analysis of physicochemical properties revealed that most FAR1/FHY3 proteins in E. senticosus were unstable, with the exception of Ese01G001009.t1, which was consistent with the findings in A. thaliana[34]. Based on these above results, we found that as the number of FAR1/FHY3 genes in a specific species increased, the number of chromosomes also increased. Although the number of FAR1/FHY3 genes identified in different species varied, the number of FAR1/FHY3 genes in E. senticosus did not change significantly compared with that in other species[14]. This indicates that the number of FAR1/FHY3 family members is relatively conserved among different species[8,15,33].

      The subfamily classification of FAR1/FHY3 varies among different species. For example, FAR1/FHY3 in C. sativus has been divided into three subfamilies[33], whereas FAR1/FHY3 in Z. mays has been divided into five subfamilies[14]. In our study, EsFAR1/FHY3 genes were divided into five subfamilies. We speculate that this variation is due to the different numbers of FAR1/FHY3 genes in different species and the variability in the evolutionary process[40].

      In E. senticosus, EsFAR1/FHY3 is mostly located within 20 kb and each subfamily contains a varying number of intron sequences. This variation in gene structure indicates that introns may have been constantly acquired or lost during the evolution of EsFAR1/FHY3 family members[41]. The 5'-UTR plays an important role in gene regulation, whereas the 3ʹ-UTR serves as the binding site for the messenger RNA degradation complex, which is associated with messenger RNA stability[42]. In E. senticosus, except for subfamilies I and II, EsFAR1/FHY3 of subfamilies III, IV, and V contained a UTR structure similar to that in Camellia sinensis[42]. In this study, we identified the first ten conserved motifs of EsFAR1/FHY3. Except for Ese10G002497.t1, Ese04G002049.t1, Ese19G001149.t1, and Ese22G000038.t2 only contained Motif 1 to Motif 9, whereas the remaining EsFAR1/FHY3 genes contained all 10 conserved motifs. This reflects the highly conserved structural characteristics of EsFAR1/FHY3. This was also observed in Juglans sigillata[43] and Z. mays[14]. The combination of these motifs gives rise to the MULE, SWIM, and FAR1 protein domains found within EsFAR1/FHY3. These domains serve as the fundamental architectural framework underlying the various biological functions associated with EsFAR1/FHY3 transcription factors[4]. The 'Cu fist' domain and the Cys-rich motifs at the N and C termini of Mac1 are common features of Cu starvation responsive transcription factors. Studies have shown that the 'Cu fist' domain is essential for Mac1-mediated Cu uptake in Aspergillus nidulans[44]. Mutations in highly conserved motifs in the conserved iRhom homeodomain eliminate ADAM17 maturation and activity[45].

      The analysis of interspecies collinearity between E. senticosus and A. elata revealed a significant level of collinearity between FAR1/FHY3. This phenomenon also occurs in species, such as Zea mays[14] and Arachis hypogaea[46]. Studies have shown that in the past 200 million years, the entire genome has been repeated, accompanied by large-scale gene loss, resulting in the breakage of ancestral gene linkages on multiple chromosomes[47]. However, the analysis of gene collinearity in E.senticosus species found that only one pair of EsFAR1FHY3 genes had a collinearity relationship. This seems to indicate that the FAR1/FHY3 gene family is relatively conserved during evolution. Further analysis of the adaptive evolution of EsFAR1/FHY3 showed the absence of any positive selection sites within this gene. Instead, negative selection predominantly influenced the evolution of the EsFAR1/FHY3 gene family. This indicates that EsFAR1/FHY3 underwent strong negative selection during evolution. In the evolutionary process, the structure and function of EsFAR1/FHY3 are likely to have been fixed in the early stages, and its adaptive evolution may have stabilized early, making it difficult to detect sites of positive selection[48]. This further illustrates the highly conserved evolutionary characteristics of the EsFAR1/FHY3 gene family, and the conserved structure of the EsFAR1/FHY3 gene is an important part of the light response. Therefore, we preliminarily speculate that the EsFAR1/FHY3 gene can affect the secondary metabolism of E. senticosus through its conserved light response components.

      A significant number of light-responsive cis-acting elements, such as Box 4, G-box, TCT-motif, GT1-motif, ATCT-motif, and GATA-motif, were identified in the promoter region of EsFAR1/FHY3, which indicates that EsFAR1/FHY3 may play a role in the response of E. senticosus to light changes[49,50]. Studies have shown that light quality can regulate secondary metabolic processes in most plants, including E. senticosus[13,22]. Plants have evolved various photoreceptors to adapt to varying light conditions[51]. After sensing light signals, these photoreceptors trigger complex signaling cascades, prompting plants to adapt to specific light conditions and generate adaptive responses at the gene expression level through specific transcription factors and their complexes[52]. For instance, FAR1/FHY3 in A. thaliana can regulate plant growth, development, and metabolic processes by regulating phyA signaling[53].

      Liu et al.[54] showed that FAR1/FHY3 protein can bind to DNA and affect plant growth and development. However, it is unclear whether EsFAR1/FHY3 directly regulates the expression of secondary-metabolism-related genes in E. senticosus. In this study, we found that the promoter of EsFPS, a key enzyme gene for triterpenoid saponin biosynthesis in E. senticosus, binds to EsFAR1/FHY3 proteins of subfamily I. This may be related to ACGT-containing elements (ACEs) in EsFAR1/FHY3[3]. Some other subfamilies may have lost this structure during evolution and therefore could not bind to the promoter of EsFPS. Further MD analysis revealed that EsFAR1/FHY3 proteins from the four I subfamilies of E. senticosus formed stable complexes with the EsFPS promoter region. Therefore, we speculated that the EsFAR1/FHY3 protein directly binds to the EsFPS promoter and regulates the expression of this gene, thereby influencing the accumulation of triterpenoid saponins in E. senticosus. This is consistent with the results obtained for A. thaliana[10,54]. In addition, it should be noted that the saponin synthesis pathway in E. senticosus is catalyzed by at least ten enzymes[23], and this study only analyzed the promoters of three key enzyme genes. Therefore, although the remaining 11 EsFAR1/FHY3 did not exhibit the ability to bind to the promoters of the three enzyme genes specifically discussed, it is plausible that these genes could interact with the promoters of other enzyme genes that play a role in the synthesis of saponins. This interaction could potentially regulate the overall production of saponins in E. senticosus.

    • Using the hidden Markov model, 21 EsFAR1/FHY3 proteins, distributed across 14 chromosomes, were identified in the E. senticosus genome. EsFAR1/FHY3 was divided into five subgroups, and the conserved motifs, domains, and gene structures within each subgroup were similar. EsFAR1/FHY3 has mainly been affected by negative selection during evolution, and its promoters contain a lot of light-responsive cis-acting elements. Under irradiation with red, green, blue, and white light, 15 EsFAR1/FHY3 showed differential expression, of which only four EsFAR1/FHY3 classified as subgroup I was bound to the promoter of the E. senticosus saponin synthesis key enzyme gene EsFPS through varying numbers of hydrogen bonds. Therefore, we speculated that EsFAR1/FHY3, which can bind to the EsFPS promoter, was specifically expressed under irradiation with specific wavelengths of light. After binding to the EsFPS promoter, they regulate the expression of EsFPS, thereby affecting the synthesis of triterpene saponins in E. senticosus (Fig. 7).

      Figure 7. 

      Schematic diagram of EsFAR1/FHY3 regulating the synthesis of E. senticosus saponins in response to light changes.

      • This work was supported by the National Natural Science Foundation of China (32470398), Central Guidance for Local Science and Technology Development Fund Projects (236Z2501G), Natural Science Foundation of Hebei Province (H2020209302), and the Graduate Student Innovation Fund of North China University of Science and Technology (2024S25).

      • The authors confirm contribution to the paper as follows: study conception and design: Xing Z, Long Y; figure and table production: Jiao M, Wu P; sample collection: Zhao X; draft manuscript preparation: Xing Z; manuscript revision: Ma J, Cui Y, and Kou X; research: Li C. All authors reviewed the results and approved the final version of the manuscript.

      • The sequence data from RNA-Seq experiments reported in this study have been deposited in the NCBI with Accession No. PRJNA1031420.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (7)  Table (2) References (54)
  • About this article
    Cite this article
    Li C, Ma J, Wu P, Kou X, Jiao M, et al. 2025. Identification and adaptive evolution analysis of FAR1/FHY3 in Eleutherococcus senticosus and prediction of target genes regulating saponin synthesis. Medicinal Plant Biology 4: e016 doi: 10.48130/mpb-0025-0013
    Li C, Ma J, Wu P, Kou X, Jiao M, et al. 2025. Identification and adaptive evolution analysis of FAR1/FHY3 in Eleutherococcus senticosus and prediction of target genes regulating saponin synthesis. Medicinal Plant Biology 4: e016 doi: 10.48130/mpb-0025-0013

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return