Figures (9)  Tables (3)

    • Figure 1. 

      Phylogenetic analysis of WRKY family proteins in Arabidopsis, rice, and other reported species.

    • Figure 2. 

      Multiple sequence alignment of reported WRKY family proteins. (a) Multiple sequence alignment of reported WRKY proteins in group II-c. (b) Multiple sequence alignment of reported WRKY proteins in group II-d. (c) Multiple sequence alignment of reported WRKY proteins in group II-e.

    • Figure 3. 

      Phylogenetic analysis of WRKY family proteins in D. catenatum.

    • Figure 4. 

      Conserved motifs and gene structure of DcaWRKY genes according to phylogenetic relationships.

    • Figure 5. 

      Multiple sequence alignment of identified DcaWRKY proteins.

    • Figure 6. 

      The summarized figure of DcaWRKY genes expression in roots and leaves. '↑' indicates that gene expression increased under drought treatment. '↓' indicates decreased expression under drought treatment. Dca000671, Dca003180, Dca005043, Dca008968, Dca013149, and Dca017113 were differently expressed in leaves under drought treatment; similarly, Dca011499, Dca011914, Dca016988, Dca018137, Dca019840, and Dca027312 were differently expressed in roots. Dca000627, Dca002550, Dca006787, Dca002715, Dca005648, Dca007842, Dca010430, Dca011569, Dca015914, Dca016437, Dca019656, Dca024256, Dca026708, Dca028770, and Dca003067 were expressed both in leaves and roots under drought treatment.

    • Figure 7. 

      Heatmap of differentially expressed DcaWRKY genes under drought stress in roots. The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.

    • Figure 8. 

      Heatmap of differentially expressed DcaWRKY genes under drought stress in leaves. The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.

    • Figure 9. 

      Heatmap of the selected DcaWRKY genes in leaves. The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.

    • GroupGene IDSpeciesFunctionReferences
      IIIGhWRKY33Gossypium hirsutumTolerance to drought[58]
      IIIPbrWRKY53Pyrus betulaefoliaTolerance to drought[38]
      II CGmWRKY54Glycine maxTolerance to drought[59]
      II AGmWRKY27Glycine maxTolerance to drought[58]
      IIIAtWRKY63Arabidopsis thalianaTolerance to drought[60]
      ITaWRKY2 and TaWRKY19Triticum aestivumTolerance to drought[61]
      II COsWRKY11Oryza sativaTolerance to drought[57]
      IIIOsWRKY45Oryza sativaTolerance to drought[62]
      II AWRKY18, WRKY40 and WRKY60Arabidopsis thalianaTolerance to drought[63,64]
      IWRKY1Arabidopsis thalianaTolerance to drought[65]
      IIIWRKY46, WRKY54, and WRKY70Arabidopsis thalianaTolerance to drought[42]
      II CAtWRKY57Arabidopsis thalianaTolerance to drought[37]
      I AOsWRKY30Oryza sativaTolerance to drought[66]
      IIOsWRKY80Oryza sativaTolerance to drought[67]
      IIIOsWRKY47Oryza sativaTolerance to drought[68]
      IFvWRKY42Fragaria vescaTolerance to drought[39]
      II DZmWRKY58Zea maysTolerance to drought[41]
      II EZmWRKY106Zea maysTolerance to drought[69]
      II AZmWRKY40Zea maysTolerance to drought[69]
      II ECmWRKY10Chrysanthemum morifoliumTolerance to drought[70]
      III and ITaWRKY1 and TaWRKY33Triticum aestivumTolerance to drought[71]
      II DThWRKY4Tamarix hispidaTolerance to drought[72]
      IMuWRKY3Macrotyloma uniflorumTolerance to drought[73]
      II DGhWRKY17Gossypium hirsutumTolerance to drought[34]
      IIIGhWRKY41Gossypium hirsutumTolerance to drought[74]
      ITaWRKY44Triticum aestivumTolerance to drought[75]
      IIIFcWRKY70Fortunella crassifoliaTolerance to drought[40]
      II CGmWRKY12Glycine maxTolerance to drought[76]
      IIIZmWRKY79Zea maysTolerance to drought[77]
      II DGhWRKY21Gossypium hirsutumTolerance to drought[78]
      IIISlWRKY81Solanum lycopersicumTolerance to drought[79]
      ISPF1Ipomoea batatasRoot development[43]
      I and II AABF1 and ABF2Avena fatuaSeed germination[45]
      II BWRKY42 and WRKY6Arabidopsis thalianaPlant nutrient[42]
      II CWRKY45 and WRKY75
      III and II EWRKY74 and WRKY80Oryza sativaPlant nutrient[42]
      IIIAtWRKY53Arabidopsis thalianaLeaf senescense[46]
      II COsWRKY11Oryza sativaFloral development[41]
      II CAtWRKY12 and AtWRKY13Arabidopsis thalianaFloral development[44]
      II CAtWRKY71Arabidopsis thalianaFloral development[47]
      IAtWRKY2Arabidopsis thalianaReproductive development[80]
      IOsWRKY70Oryza sativaDefense response[81]
      II CFvWRKY48Fragaria vescaPectin degradation[82]
      II EOsWRKY13Oryza sativaRegulated ABA signaling and tolerance to salt[83]
      II CVlWRKY3Vitis viniferaResponse to Golovinomyces cichoracearum and tolerant to salt[84]
      II CGhWRKY68Gossypium hirsutumReduced salt tolerance and drought resistance[85]
      IGhWRKY25Gossypium hirsutumTolerance to salt[86]
      IVvWRKY24Vitis viniferaTolerance to cold[29]
      IAtWRKY25 and AtWRKY33Arabidopsis thalianaTolerance to heat[25]
      IAtWRKY34Arabidopsis thalianaNegative regulator in cold stress[31]
      IIIAtWRKY53Arabidopsis thalianaReduced drought resistance[87]
      IIIAtWRKY63Arabidopsis thalianaRegulated ABA signaling[60]
      IIIAtWRKY54Arabidopsis thalianaResponse to heat stress[28]
      II COsWRKY72Oryza sativaSensitive to salt, sucrose, and ABA[88]
      IIIOsWRKY74Oryza sativaTolerance to cold and Pi deprivation[89]
      II AOsWRKY76Oryza sativaTolerance to cold[90]
      IIIOsWRKY89Oryza sativaTolerance to UV[91]
      II AGmWRKY17Glycine maxReduced salt tolerance[34]
      IIIBcWRKY46Brassica campestrisTolerance to salt[92]
      IIIBhWRKY1Boea hygrometricaTolerance to salt[93]
      III and IVpWRKY1 and VpWRKY2Vitis pseudoreticulataTolerance to salt and cold[94]
      II AVpWRKY3Vitis pseudoreticulataTolerance to salt[95]
      IIITcWRKY53Thlaspi caerulescensNegative regulator in osmotic stress[96]
      INaWRKY3Nicotiana attenuataSensitive to mechanical damage[97]
      I and II DJrWRKY2 and JrWRKY7Juglans regiaTolerance to drought and cold[98]
      IIISbWRKY30Sorghum bicolorTolerance to salt and drought[99]
      II CSbWRKY50Sorghum bicolorTolerance to salt[100]
      II AMdWRKY30Malus domesticaTolerance to salt and osmotic stress[101]
      II CGbWRKY1Gossypium barbadenseTolerance to salt[35]
      IVbWRKY32Verbena bonariensisTolerance to cold[28]
      II COsWRKY67Oryza sativaNegative regulator of innate defense response[22]
      II AOsWRKY62.1Oryza sativaPositive regulator of PTI and ETI against pathogens[12]
      IIIAtWRKY38 and AtWRKY62Arabidopsis thalianaResponse to bacterial pathogen[11]
      II A,II C, and II BGmWRKY136, GmWRKY53, and GmWRKY86Glycine maxTolerance to SCN[23]
      II C and IIITaWRKY49 and TaWRKY62Triticum aestivumTolerance to stripe rust[102]
      II ACaWRKY40b and CaWRKY40Capsicum annuumNegative regulation of plant immunity[17,24]
      II BCaWRKY6Capsicum annuumTolerance to R. solanacearum[15]
      ISpWRKY1Solanum pimpinellifoliumTolerance to Phytophthora infestans[16]
      II DZmWRKY17Zea maysNegative regulator of salt stress[103]
      II DGhWRKY39-1Gossypium hirsutumTolerance to salt[33]
      II CAtWRKY8Arabidopsis thalianaDefense response[13]
      II ECaWRKY27Capsicum annuumResponse to Ralstonia solanacearum infection[14]
      II CAtWRKY48Arabidopsis thalianaTolerance to P. syringae[20]
      II EAtWRKY29Arabidopsis thalianaResistance to P. syringe[18]
      II CPoWRKY13PopulusResponse to heat stress[26]
      tomentosa
      IIISlWRKY33Solanum lycopersicumTolerance to cold[30]
      II DGmWRKY13Glycine maxResponse to salt and mannitol[9]

      Table 1. 

      Reported functional WRKY genes summarized in this study.

    • Gene IDWRKY domainNo. of
      domains      		No. of
      exons      		No. of
      introns      		Group
      Conserved heptapeptideZinc fingerZinc finger type
      Dca000627WRKYGQK−−132II E
      Dca000637WRKYGQKC2H2CX4CX23HXH121II C
      Dca000671WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca000699WRKYGQKC2H2CX4CX23HXH121II C
      Dca000873WRKYGQKC2H2CX5CX23HXH154II B
      Dca002197WKKYGQKC2H2CX4CX23HXH121I
      Dca002205WRKDGTH/WRKYATNC2H2/C2H2CX4CX23HXH/CX4CX23HXH265I
      Dca002550WRKYGQKC2H2CX5CX23HXH132II E
      Dca002715WRKYGQKC2H2CX4CX23HXH132II C
      Dca003067WRKYGQKC2HCCX7CX23HXC132III
      Dca003180WRKYGQKC2H2CX5CX23HXH132II D
      Dca003732WRKYGQKC2H2CX4CX23HXH121II C
      Dca004998WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca005043WRKYGQKC2HCCX7CX23HXC132III
      Dca005048WRKYGEKC2HCCX7CX23HXC121III
      Dca005648WRKYGQKC2H2CX4CX23HXH132II C
      Dca005780WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca006278WRKYGQKC2H2CX5CX23HXH132II D
      Dca006505WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH265I
      Dca006646WRKYGQKC2HCCX7CX23HXC132III
      Dca006787WRKYGQKC2H2CX5CX23HXH132II E
      Dca007186WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca007842WRKYGQKC2H2CX5CX23HXH154II B
      Dca008357WRKYGQKC2H2CX5CX23HXH143II A
      Dca008967WTKYGQKC2H2CX4CX23HXH132I
      Dca008968WNKYGQKC2H2CX4CX23HXH121I
      Dca008985WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca009368WRKYGQKC2H2CX4CX23HXH132II C
      Dca010430WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca010993WRKYGQKC2H2CX4CX23HXH121II C
      Dca011499WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH232II C
      Dca011569WRKYGQKC2H2CX5CX23HXH154II B
      Dca011912WRKYGQKC2H2CX5CX23HXH132II A
      Dca011914WRKYGQKC2H2CX5CX23HXH143II A
      Dca012410WRKYGQKC2H2CX5CX23HXH132II E
      Dca012846WRKYGQKC2H2CX4CX23HXH132II C
      Dca013146WRKYGQKC2HCCX7CX23HXC132III
      Dca013149WRKYGQKC2HCCX7CX23HXC132III
      Dca013150WRKYGEKC2HCCX7CX23HXC132III
      Dca014563WRKYGQKC2HCCX7CX23HXC121III
      Dca015482WRKYGQKC2H2CX5CX23HXH132II D
      Dca015639WRKYGKKC2H2CX4CX23HXH132II C
      Dca015848WRKYGQKC2H2CX4CX23HXH121II C
      Dca015914WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH232II C
      Dca016437WRKYGQKC2H2CX4CX23HXH121II C
      Dca016988WRKYGQKC2H2CX5CX23HXH121II E
      Dca017113WRKYGQKC2H2CX4CX23HXH132II C
      Dca018137WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca018897WRKYGQKC2H2CX5CX23HXH143II A
      Dca019319WRKYGQKC2HCCX7CX23HXC132III
      Dca019656WRKYGQKC2H2CX5CX23HXH132II E
      Dca019840WRKYGKKC2H2CX4CX23HXH132II C
      Dca020159WRKYGQKC2H2CX4CX23HXH121II C
      Dca020342WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca020473WRKYGQKC2H2CX5CX23HXH132II E
      Dca021638WRKYGEK/WRKYGEK—/C2HC—/CX7CX23HXC254III
      Dca023070WRKYGQKC2H2CX5CX23HXH132II D
      Dca024256WRKYGQKC2H2CX5CX23HXH121II E
      Dca024393WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca026708WRKYGQKC2H2CX4CX23HXH143II A
      Dca027312WRKYGQKC2HCCX7CX23HXC132III
      Dca028175WRKYGQKC2H2CX4CX23HXH132II C
      Dca028770WRKYGKK--110II C

      Table 2. 

      Characteristics of WRKY genes in D. catenatum.

    • Primer nameSequence (5'-3')
      Dca002550-FGTGTTCGAGCTCAACCATCA
      Dca002550-RTGATCGTGATCTCCCATGAA
      Dca005648-FGGCCGATTCACCGAATAATA
      Dca005648-RTTTCAACACGCTTCTTCACG
      Dca006787-FGCGATCTCTTTGCCTCAAAC
      Dca006787-RTTCCTTGCTGAGCATCCTTT
      Dca007842-FGCTCCTCTACCACCCATTCA
      Dca007842-RGTGAGGTCGAGGGTGATTGT
      Dca010430-FAGGAAGTCTGACGACGGCTA
      Dca010430-RCGAGTGGACTGAGGCTTAGG
      Dca016437-FATCGTTGCACCACACAGAAG
      Dca016437-RAAGTCATGGTGGAAGCTTGG

      Table 3. 

      qRT-PCR primers of DcaWRKYs.