Search
2022 Volume 2
Article Contents
ARTICLE   Open Access    

Identification of stress-related characteristics of the WRKY gene family: A case study of Dendrobium catenatum

More Information
  • As one of the largest families of transcription factors (TFs) in plants, the WRKY TF family plays a key role in regulating plant responses to various biotic and abiotic stresses. However, there is no confirmed method to quickly identify stress-responsive members from the WRKY gene family. In this study, all reported functional WRKY genes were first analyzed, and the amino acid patterns in response to stress were identified in group II-c (T-R/K-S/T-E/Q/D-V/I/L-E/D-I/V/H/N-L/M-D/E-D-G/E-F/Y-K/R-WRKYG-Q/K-K-A/T-VKN-S/N-P), group II-d (VPA-I/V-S-X-K-M/L/V/I-ADIP-P/A/V-D-D/E-Y/F-S-WRKYGQKPIKGSP-H/Y-PRGYYKCS-S/T-V/M-RGCPARKVER), and group II-e (PSD-S/A/L-WAWRKYGQKPIKGSPYPR-G/S-YYRCSSSKGC). WRKY genes in Dendrobium catenatum were used to validate the accuracy of these patterns. A total of 63 DcaWRKY genes were identified, their gene structures, conserved motifs, and gene expression patterns were analyzed, and a phylogenetic tree was constructed. Gene expression patterns were then analyzed under drought stress, and seven DcaWRKY genes (Dca002550, Dca002715, Dca005648, Dca007842, Dca010430, Dca016437, and Dca006787) were randomly selected to determine their expression levels and verify their expression patterns by quantitative real-time polymerase chain reaction analysis. The identified amino acid patterns were validated by drought-responsive WRKY genes in D. catenatum, confirming the accuracy of these amino acid patterns and providing valuable insights into further research of the WRKY family in D. catenatum.
  • 加载中
  • Supplemental Table. S1 The basic amino acids information of reported functionalWRKY genes.
    Supplemental Table S2 The basic amino acids information of DcaWRKY genes.
    Supplemental Fig. S1 Expression heatmap of DcaWRKY genes in roots and leaves.The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.
  • [1] Hennig L. 2012. Plant gene regulation in response to abiotic stress. Biochimica et Biophysica Acta 1819:85 doi: 10.1016/j.bbagrm.2012.01.005

    CrossRef   Google Scholar

    [2] Jiang J, Ma S, Ye N, Jiang M, Cao J, et al. 2017. WRKY transcription factors in plant responses to stresses. Journal of Integrative Plant Biology 59:86−101 doi: 10.1111/jipb.12513

    CrossRef   Google Scholar

    [3] Ulker B, Somssich IE. 2004. lker B, Somssich IE. WRKY transcription factors: from DNA binding towards biological function. Current Opinion in Plant Biology 7:491−98 doi: 10.1016/j.pbi.2004.07.012

    CrossRef   Google Scholar

    [4] Ross CA, Liu Y, Shen QJ. 2007. The WRKY gene family in rice (Oryza sativa). Journal of Integrative Plant Biology 49:827−42 doi: 10.1111/j.1744-7909.2007.00504.x

    CrossRef   Google Scholar

    [5] Cheng X, Zhao Y, Jiang Q, Yang J, Zhao W, et al. 2019. Structural basis of dimerization and dual W-box DNA recognition by rice WRKY domain. Nucleic Acids Research 47:4308−18 doi: 10.1093/nar/gkz113

    CrossRef   Google Scholar

    [6] Zhang Y, Wang L. 2005. The WRKY transcription factor superfamily: its origin in eukaryotes and expansion in plants. Bmc Evolutionary Biology 5:1 doi: 10.1186/1471-2148-5-1

    CrossRef   Google Scholar

    [7] Satapathy L, Singh D, Ranjan P, Kumar D, Kumar M, et al. 2014. Transcriptome-wide analysis of WRKY transcription factors in wheat and their leaf rust responsive expression profiling. Molecular Genetics & Genomics 289:1289−306 doi: 10.1007/s00438-014-0890-9

    CrossRef   Google Scholar

    [8] Bakshi M, Oelmüller R. 2014. WRKY transcription factors: Jack of many trades in plants. Plant Signaling & Behavior 9:e27700 doi: 10.4161/psb.27700

    CrossRef   Google Scholar

    [9] Zhou Q, Tian A, Zou H, Xie Z, Lei G, et al. 2008. Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnology Journal 6:486−503 doi: 10.1111/j.1467-7652.2008.00336.x

    CrossRef   Google Scholar

    [10] Seo YJ, Park JB, Cho YJ, Jung C, Seo HS, et al. 2010. Overexpression of the ethylene-responsive factor gene BrERF4 from Brassica rapa increases tolerance to salt and drought in Arabidopsis plants. Molecules and Cells 30:271−77 doi: 10.1007/s10059-010-0114-z

    CrossRef   Google Scholar

    [11] Kim KC, Lai Z, Fan B, Chen Z. 2008. Arabidopsis WRKY38 and WRKY62 transcription factors interact with histone deacetylase 19 in basal defense. The Plant Cell 20:2357−71 doi: 10.1105/tpc.107.055566

    CrossRef   Google Scholar

    [12] Peng Y, Bartley LE, Chen X, Dardick C, Chern M, et al. 2008. OsWRKY62 is a negative regulator of basal and Xa21-mediated defense against Xanthomonas oryzae pv. oryzae in rice. Molecular Plant 1:446−58 doi: 10.1093/mp/ssn024

    CrossRef   Google Scholar

    [13] Chen L, Zhang L, Yu D. 2010. Wounding-induced WRKY8 is involved in basal defense in Arabidopsis. Molecular Plant-Microbe Interactions 23:558−65 doi: 10.1094/mpmi-23-5-0558

    CrossRef   Google Scholar

    [14] Dang F, Wang Y, She J, Lei Y, Liu Z, et al. 2014. Overexpression of CaWRKY27, a subgroup IIe WRKY transcription factor of Capsicum annuum, positively regulates tobacco resistance to Ralstonia solanacearum infection. Physiologia Plantarum 150:397−411 doi: 10.1111/ppl.12093

    CrossRef   Google Scholar

    [15] Cai H, Yang S, Yan Y, Xiao Z, Cheng J, et al. 2015. CaWRKY6 transcriptionally activates CaWRKY40, regulates Ralstonia solanacearum resistance, and confers high-temperature and high-humidity tolerance in pepper. Journal of Experimental Botany 66:3163−74 doi: 10.1093/jxb/erv125

    CrossRef   Google Scholar

    [16] Li JB, Luan YS, Liu Z. 2015. Overexpression of SpWRKY1 promotes resistance to Phytophthora nicotianae and tolerance to salt and drought stress in transgenic tobacco. Physiologia Plantarum 155:248−66 doi: 10.1111/ppl.12315

    CrossRef   Google Scholar

    [17] Ifnan Khan M, Zhang Y, Liu Z, Hu J, Liu C, et al. 2018. CaWRKY40b in Pepper Acts as a negative regulator in response to Ralstonia solanacearum by directly modulating defense genes including CaWRKY40. International Journal of Molecular Sciences 19:1403 doi: 10.3390/ijms19051403

    CrossRef   Google Scholar

    [18] Rasmussen MW, Roux M, Petersen M, Mundy J. 2012. MAP Kinase Cascades in Arabidopsis Innate Immunity. Frontiers in Plant Science 3:169 doi: 10.3389/fpls.2012.00169

    CrossRef   Google Scholar

    [19] Zheng Z, Qamar SA, Chen Z, Mengiste T. 2006. Arabidopsis WRKY33 transcription factor is required for resistance to necrotrophic fungal pathogens. The Plant Journal 48:592−605 doi: 10.1111/j.1365-313X.2006.02901.x

    CrossRef   Google Scholar

    [20] Xing DH, Lai ZB, Zheng ZY, Vinod KM, Fan BF, et al. 2008. Stress- and pathogen-induced Arabidopsis WRKY48 is a transcriptional activator that represses plant basal defense. Molecular Plant 1:459−70 doi: 10.1093/mp/ssn020

    CrossRef   Google Scholar

    [21] Wang N, Xia EH, Gao LZ. 2016. Genome-wide analysis of WRKY family of transcription factors in common bean, Phaseolus vulgaris: chromosomal localization, structure, evolution and expression divergence. Plant Gene 5:22−30 doi: 10.1016/j.plgene.2015.11.003

    CrossRef   Google Scholar

    [22] Vo KTX, Kim CY, Hoang TV, Lee SK, Shirsekar G, et al. 2017. OsWRKY67 plays a positive role in basal and XA21-mediated resistance in rice. Frontiers in Plant Science 8:2220 doi: 10.3389/fpls.2017.02220

    CrossRef   Google Scholar

    [23] Yang Y, Zhou Y, Chi Y, Fan B, Chen Z. 2017. Characterization of soybean WRKY gene family and identification of soybean WRKY genes that promote resistance to soybean Cyst nematode. Scientific Reports 7:17804 doi: 10.1038/s41598-017-18235-8

    CrossRef   Google Scholar

    [24] Dang FF, Wang YN, Yu L, Eulgem T, Lai Y, et al. 2013. CaWRKY40, a WRKY protein of pepper, plays an important role in the regulation of tolerance to heat stress and resistance to Ralstonia solanacearum infection. Plant, Cell & Environment 36:757−74 doi: 10.1111/pce.12011

    CrossRef   Google Scholar

    [25] Li S, Fu Q, Chen L, Huang W, Yu D. 2011. Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance. Planta 233:1237−52 doi: 10.1007/s00425-011-1375-2

    CrossRef   Google Scholar

    [26] Ren S, Ma K, Lu Z, Chen G, Cui J, et al. 2019. Transcriptomic and metabolomic analysis of the heat-stress response of Populus tomentosa Carr. Forests 10:383 doi: 10.3390/f10050383

    CrossRef   Google Scholar

    [27] Park CY, Lee JH, Yoo JH, Moon BC, Choi MS, et al. 2005. WRKY group IId transcription factors interact with calmodulin. FEBS Letters 579:1545−50 doi: 10.1016/j.febslet.2005.01.057

    CrossRef   Google Scholar

    [28] Wang L, Ma KB, Lu ZG, Ren SX, Jiang HR, et al. 2020. Differential physiological, transcriptomic and metabolomic responses of Arabidopsis leaves under prolonged warming and heat shock. BMC Plant Biology 20:86 doi: 10.1186/s12870-020-2292-y

    CrossRef   Google Scholar

    [29] Wang M, Vannozzi A, Wang G, Liang YH, Tornielli GB, et al. 2014. Genome and transcriptome analysis of the grapevine (Vitis vinifera L.) WRKY gene family. Horticulture Research 1:14016 doi: 10.1038/hortres.2014.16

    CrossRef   Google Scholar

    [30] Guo M, Yang F, Liu C, Zou J, Qi Z, et al. 2022. A single-nucleotide polymorphism in WRKY33 promoter is associated with the cold sensitivity in cultivated tomato. New Phytologist 236:989−1005 doi: 10.1111/nph.18403

    CrossRef   Google Scholar

    [31] Zou C, Jiang W, Yu D. 2010. Male gametophyte-specific WRKY34 transcription factor mediates cold sensitivity of mature pollen in Arabidopsis. Journal of Experimental Botany 61:3901−14 doi: 10.1093/jxb/erq204

    CrossRef   Google Scholar

    [32] Wang M, Huang Q, Lin P, Zeng Q, Li Y, et al. 2019. The Overexpression of a transcription factor gene VbWRKY32 enhances the cold tolerance in Verbena bonariensis. Frontiers in Plant Science 10:1746 doi: 10.3389/fpls.2019.01746

    CrossRef   Google Scholar

    [33] Shi W, Hao L, Li J, Liu D, Guo X, et al. 2014. The Gossypium hirsutum WRKY gene GhWRKY39-1 promotes pathogen infection defense responses and mediates salt stress tolerance in transgenic Nicotiana benthamiana. Plant Cell Reports 33:483−98 doi: 10.1007/s00299-013-1548-5

    CrossRef   Google Scholar

    [34] Yan H, Jia H, Chen X, Hao L, An H, et al. 2014. The cotton WRKY transcription factor GhWRKY17 functions in drought and salt stress in transgenic Nicotiana benthamiana through ABA signaling and the modulation of reactive oxygen species production. Plant and Cell Physiology 55:2060−76 doi: 10.1093/pcp/pcu133

    CrossRef   Google Scholar

    [35] Luo X, Li C, He X, Zhang X, Zhu L. 2020. ABA signaling is negatively regulated by GbWRKY1 through JAZ1 and ABI1 to affect salt and drought tolerance. Plant Cell Reports 39:181−94 doi: 10.1007/s00299-019-02480-4

    CrossRef   Google Scholar

    [36] Zhu JK. 2002. Salt and drought stress signal transduction in plants. Annual Review of Plant Biology 53:247−73 doi: 10.1146/annurev.arplant.53.091401.143329

    CrossRef   Google Scholar

    [37] Jiang Y, Bao L, Jeong SY, Kim SK, Xu C, et al. 2012. XIAO is involved in the control of organ size by contributing to the regulation of signaling and homeostasis of brassinosteroids and cell cycling in rice. The Plant Journal 70:398−408 doi: 10.1111/j.1365-313X.2011.04877.x

    CrossRef   Google Scholar

    [38] Liu Y, Yang T, Lin Z, Guo B, Xing C, et al. 2019. A WRKY transcription factor PbrWRKY53 from Pyrus betulaefolia is involved in drought tolerance and AsA accumulation. Plant Biotechnology Journal 17:1770−87 doi: 10.1111/pbi.13099

    CrossRef   Google Scholar

    [39] Wei W, Cui MY, Yang H, Gao K, Xie YG, et al. 2018. Ectopic expression of FvWRKY42 , a WRKY transcription factor from the diploid woodland strawberry (Fragaria vesca), enhances resistance to powdery mildew, improves osmotic stress resistance, and increases abscisic acid sensitivity in Arabidopsis. Plant Science 275:60−74 doi: 10.1016/j.plantsci.2018.07.010

    CrossRef   Google Scholar

    [40] Gong X, Zhang J, Hu J, Wang W, Wu H, et al. 2015. FcWRKY 70, a WRKY protein of Fortunella crassifolia, functions in drought tolerance and modulates putrescine synthesis by regulating arginine decarboxylase gene. Plant, Cell & Environment 38:2248−62 doi: 10.1111/pce.12539

    CrossRef   Google Scholar

    [41] Cai Y, Chen X, Xie K, Xing Q, Wu Y, et al. 2014. Dlf1, a WRKY transcription factor, is involved in the control of flowering time and plant height in rice. PloS One 9:e102529 doi: 10.1371/journal.pone.0102529

    CrossRef   Google Scholar

    [42] Chen F, Hu Y, Vannozzi A, Wu K, Cai H, et al. 2017. The WRKY transcription factor family in model plants and crops. Critical Reviews in Plant Sciences 36:311−35 doi: 10.1080/07352689.2018.1441103

    CrossRef   Google Scholar

    [43] Ishiguro S, Nakamura K. 1994. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5' upstream regions of genes coding for sporamin and β-amylase from sweet potato. Molecular and General Genetics 244:563−71 doi: 10.1007/BF00282746

    CrossRef   Google Scholar

    [44] Li W, Wang H, Yu D. 2016. Arabidopsis WRKY Transcription Factors WRKY12 and WRKY13 Oppositely Regulate Flowering under Short-Day Conditions. Molecular Plant 9:1492−503 doi: 10.1016/j.molp.2016.08.003

    CrossRef   Google Scholar

    [45] Rushton PJ, Macdonald H, Huttly AK, Lazarus CM, Hooley R. 1995. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes. Plant Molecular Biology 29:691−702 doi: 10.1007/BF00041160

    CrossRef   Google Scholar

    [46] Miao Y, Zentgraf U. 2010. A HECT E3 ubiquitin ligase negatively regulates Arabidopsis leaf senescence through degradation of the transcription factor WRKY53. The Plant Journal 63:179−88 doi: 10.1111/j.1365-313x.2010.04233.x

    CrossRef   Google Scholar

    [47] Yu Y, Liu Z, Wang L, Kim SG, Seo PJ, et al. 2016. WRKY71 accelerates flowering via the direct activation of FLOWERING LOCUS T and LEAFY in Arabidopsis thaliana. The Plant Journal 85:96−106 doi: 10.1111/tpj.13092

    CrossRef   Google Scholar

    [48] Zhang GQ, Xu Q, Bian C, Tsai WC, Yeh CM, et al. 2016. The Dendrobium catenatum Lindl. genome sequence provides insights into polysaccharide synthase, floral development and adaptive evolution. Scientific Reports 6:19029 doi: 10.1038/srep19029

    CrossRef   Google Scholar

    [49] Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30:772−80 doi: 10.1093/molbev/mst010

    CrossRef   Google Scholar

    [50] Eddy SR. 2011. Accelerated Profile HMM Searches. PLoS Computational Biology 7:e1002195 doi: 10.1371/journal.pcbi.1002195

    CrossRef   Google Scholar

    [51] Letunic I, Doerks T, Bork P. 2012. SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Research 40:D302−D305 doi: 10.1093/nar/gkr931

    CrossRef   Google Scholar

    [52] Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, et al. 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59:307−21 doi: 10.1093/sysbio/syq010

    CrossRef   Google Scholar

    [53] Wang X, Yam TW, Meng Q, Zhu J, Zhang P, et al. 2016. The dual inoculation of endophytic fungi and bacteria promotes seedlings growth in Dendrobium catenatum (Orchidaceae) under in vitro culture conditions. Plant Cell, Tissue and Organ Culture (PCTOC) 126:523−31 doi: 10.1007/s11240-016-1021-6

    CrossRef   Google Scholar

    [54] Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, et al. 2020. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Molecular Plant 13:1194−202 doi: 10.1016/j.molp.2020.06.009

    CrossRef   Google Scholar

    [55] Wang T, Song Z, Wei L, Li L. 2018. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale. Genes & Genomics 40:265−79 doi: 10.1007/s13258-017-0602-z

    CrossRef   Google Scholar

    [56] Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. 2017. Salmon provides fast and bias-aware quantification of transcript expression. Nature Methods 14:417−19 doi: 10.1038/nmeth.4197

    CrossRef   Google Scholar

    [57] Wu X, Shiroto Y, Kishitani S, Ito Y, Toriyama K. 2009. Enhanced heat and drought tolerance in transgenic rice seedlings overexpressing OsWRKY11 under the control of HSP101 promoter. Plant Cell Reports 28:21−30 doi: 10.1007/s00299-008-0614-x

    CrossRef   Google Scholar

    [58] Wang N, Xu S, Sun Y, Liu D, Zhou L, et al. 2019. The cotton WRKY transcription factor (GhWRKY33) reduces transgenic Arabidopsis resistance to drought stress. Scientific Reports 9:724 doi: 10.1038/s41598-018-37035-2

    CrossRef   Google Scholar

    [59] Wei W, Liang DW, Bian XH, Shen M, Xiao JH, et al. 2019. GmWRKY54 improves drought tolerance through activating genes in abscisic acid and Ca2+ signaling pathways in transgenic soybean. The Plant Journal 100:384−98 doi: 10.1111/tpj.14449

    CrossRef   Google Scholar

    [60] Ren X, Chen Z, Liu Y, Zhang H, Zhang M, et al. 2010. ABO3, a WRKY transcription factor, mediates plant responses to abscisic acid and drought tolerance in Arabidopsis. The Plant Journal 63:417−29 doi: 10.1111/j.1365-313x.2010.04248.x

    CrossRef   Google Scholar

    [61] Niu CF, Wei W, Zhou QY, Tian AG, Hao YJ, et al. 2012. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant, Cell & Environment 35:1156−70 doi: 10.1111/j.1365-3040.2012.02480.x

    CrossRef   Google Scholar

    [62] Qiu Y, Yu D. 2009. Over-expression of the stress-induced OsWRKY45 enhances disease resistance and drought tolerance in Arabidopsis. Environmental and Experimental Botany 65:35−47 doi: 10.1016/j.envexpbot.2008.07.002

    CrossRef   Google Scholar

    [63] Lu K, Liang S, Wu Z, Bi C, Yu YT, et al. 2016. Overexpression of an Arabidopsis cysteine-rich receptor-like protein kinase, CRK5, enhances abscisic acid sensitivity and confers drought tolerance. Journal of Experimental Botany 67:5009−27 doi: 10.1093/jxb/erw266

    CrossRef   Google Scholar

    [64] Lahiri A, Venkatasubramani PS, Datta A. 2019. Bayesian modeling of plant drought resistance pathway. BMC Plant Biology 19:1−11 doi: 10.1186/s12870-019-1684-3

    CrossRef   Google Scholar

    [65] Qiao Z, Li CL, Zhang W. 2016. WRKY1 regulates stomatal movement in drought-stressed Arabidopsis thaliana. Plant Molecular Biology 91:53−65 doi: 10.1007/s11103-016-0441-3

    CrossRef   Google Scholar

    [66] Shen H, Liu C, Zhang Y, Meng X, Zhou X, et al. 2012. OsWRKY30 is activated by MAP kinases to confer drought tolerance in rice. Plant Molecular Biology 80:241−53 doi: 10.1007/s11103-012-9941-y

    CrossRef   Google Scholar

    [67] Ricachenevsky FK, Sperotto RA, Menguer PK, Fett JP. 2010. Identification of Fe-excess-induced genes in rice shoots reveals a WRKY transcription factor responsive to Fe, drought and senescence. Molecular Biology Reports 37:3735−45 doi: 10.1007/s11033-010-0027-0

    CrossRef   Google Scholar

    [68] Raineri J, Wang S, Peleg Z, Blumwald E, Chan RL. 2015. The rice transcription factor OsWRKY47 is a positive regulator of the response to water deficit stress. Plant Molecular Biology 88:401−13 doi: 10.1007/s11103-015-0329-7

    CrossRef   Google Scholar

    [69] Wang C, Ru J, Liu Y, Li M, Zhao D, et al. 2018. Maize WRKY transcription factor ZmWRKY106 confers drought and heat tolerance in transgenic plants. International Journal of Molecular Sciences 19:3046 doi: 10.3390/ijms19103046

    CrossRef   Google Scholar

    [70] Jaffar MA, Song A, Faheem M, Chen S, Jiang J, et al. 2016. Involvement of CmWRKY10 in drought tolerance of chrysanthemum through the ABA-signaling pathway. International Journal of Molecular Sciences 17:693 doi: 10.3390/ijms17050693

    CrossRef   Google Scholar

    [71] He GH, Xu JY, Wang YX, Liu JM, Li PS, et al. 2016. Drought-responsive WRKY transcription factor genes TaWRKY1 and TaWRKY33 from wheat confer drought and/or heat resistance in Arabidopsis. BMC plant Biology 16:693 doi: 10.1186/s12870-016-0806-4

    CrossRef   Google Scholar

    [72] Zheng L, Liu G, Meng X, Liu Y, Ji X, et al. 2013. A WRKY gene from Tamarix hispida, ThWRKY4, mediates abiotic stress responses by modulating reactive oxygen species and expression of stress-responsive genes. Plant Molecular Biology 82:303−20 doi: 10.1007/s11103-013-0063-y

    CrossRef   Google Scholar

    [73] Kiranmai K, Lokanadha Rao G, Pandurangaiah M, Nareshkumar A, Amaranatha Reddy V, et al. 2018. A novel WRKY transcription factor, MuWRKY3 (Macrotyloma uniflorum Lam. Verdc.) enhances drought stress tolerance in transgenic groundnut (Arachis hypogaea L.) plants. Frontiers in Plant Science 9:346 doi: 10.3389/fpls.2018.00346

    CrossRef   Google Scholar

    [74] Chu X, Wang C, Chen X, Lu W, Li H, et al. 2015. The cotton WRKY gene GhWRKY41 positively regulates salt and drought stress tolerance in transgenic Nicotiana benthamiana. PLoS One 10:e0143022 doi: 10.1371/journal.pone.0143022

    CrossRef   Google Scholar

    [75] Wang X, Zeng J, Li Y, Rong X, Sun J, et al. 2015. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances. Frontiers in Plant Science 6:615 doi: 10.3389/fpls.2015.00615

    CrossRef   Google Scholar

    [76] Shi WY, Du YT, Ma J, Min DH, Jin LG, et al. 2018. The WRKY transcription factor GmWRKY12 confers drought and salt tolerance in soybean. International Journal of Molecular Sciences 19:4087 doi: 10.3390/ijms19124087

    CrossRef   Google Scholar

    [77] Gulzar F, Fu J, Zhu C, Yan J, Li X, et al. 2021. Maize WRKY transcription factor ZmWRKY79 positively regulates drought tolerance through elevating ABA biosynthesis. International Journal of Molecular Sciences 22:10080 doi: 10.3390/ijms221810080

    CrossRef   Google Scholar

    [78] Wang J, Wang L, Yan Y, Zhang S, Li H, et al. 2021. GhWRKY21 regulates ABA-mediated drought tolerance by fine-tuning the expression of GhHAB in cotton. Plant Cell Reports 40:2135−50 doi: 10.1007/s00299-020-02590-4

    CrossRef   Google Scholar

    [79] Ahammed GJ, Li X, Mao Q, Wan H, Zhou G, et al. 2021. The SlWRKY81 transcription factor inhibits stomatal closure by attenuating nitric oxide accumulation in the guard cells of tomato under drought. Physiologia Plantarum 172:885−95 doi: 10.1111/ppl.13243

    CrossRef   Google Scholar

    [80] Lei R, Li X, Ma Z, Lv Y, Hu Y, et al. 2017. Arabidopsis WRKY2 and WRKY34 transcription factors interact with VQ20 protein to modulate pollen development and function. The Plant Journal 91:962−76 doi: 10.1111/tpj.13619

    CrossRef   Google Scholar

    [81] Ha D, Zhang LA, Shen J. 2011. The Role of a transcription factor in regulating rice response to drought stress. Undergraduate Research Opportunities Program (UROP) 5:18

    Google Scholar

    [82] Zhang W, Zhao S, Gu S, Cao X, Zhang Y, et al. 2022. FvWRKY48 binds to the pectate lyase FvPLA promoter to control fruit softening in Fragaria vesca. Plant Physiology 189:1037−49 doi: 10.1093/plphys/kiac091

    CrossRef   Google Scholar

    [83] Qiu D, Xiao J, Ding X, Xiong M, Cai M, et al. 2007. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Molecular Plant-Microbe Interactions 20:492−99 doi: 10.1094/MPMI-20-5-0492

    CrossRef   Google Scholar

    [84] Guo R, Qiao H, Zhao J, Wang X, Tu M, et al. 2018. The Grape VlWRKY3 Gene Promotes Abiotic and Biotic Stress Tolerance in Transgenic Arabidopsis thaliana. Frontiers in Plant Science 9:545 doi: 10.3389/fpls.2018.00545

    CrossRef   Google Scholar

    [85] Jia H, Wang C, Wang F, Liu S, Li G, et al. 2015. GhWRKY68 reduces resistance to salt and drought in transgenic Nicotiana benthamiana. PLoS One 10:e0120646 doi: 10.1371/journal.pone.0120646

    CrossRef   Google Scholar

    [86] Liu X, Song Y, Xing F, Wang N, Wen F, et al. 2016. GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana. Protoplasma 253:1265−81 doi: 10.1007/s00709-015-0885-3

    CrossRef   Google Scholar

    [87] Sun Y, Yu D. 2015. Activated expression of AtWRKY53 negatively regulates drought tolerance by mediating stomatal movement. Plant Cell Reports 34:1295−306 doi: 10.1007/s00299-015-1787-8

    CrossRef   Google Scholar

    [88] Song Y, Chen L, Zhang L, Yu D. 2010. Overexpression of OsWRKY72 gene interferes in the abscisic acid signal and auxin transport pathway of Arabidopsis. Journal of Biosciences 35:459−71 doi: 10.1007/s12038-010-0051-1

    CrossRef   Google Scholar

    [89] Dai X, Wang Y, Zhang W. 2016. OsWRKY74, a WRKY transcription factor, modulates tolerance to phosphate starvation in rice. Journal of Experimental Botany 67:947−60 doi: 10.1093/jxb/erv515

    CrossRef   Google Scholar

    [90] Yokotani N, Sato Y, Tanabe S, Chujo T, Shimizu T, et al. 2013. WRKY76 is a rice transcriptional repressor playing opposite roles in blast disease resistance and cold stress tolerance. Journal of Experimental Botany 64:5085−97 doi: 10.1093/jxb/ert298

    CrossRef   Google Scholar

    [91] Wang H, Hao J, Chen X, Hao Z, Wang X, et al. 2007. Overexpression of rice WRKY89 enhances ultraviolet B tolerance and disease resistance in rice plants. Plant Molecular Biology 65:799−815 doi: 10.1007/s11103-007-9244-x

    CrossRef   Google Scholar

    [92] Wang F, Hou X, Tang J, Wang Z, Wang S, et al. 2012. A novel cold-inducible gene from Pak-choi (Brassica campestris ssp. chinensis), BcWRKY46, enhances the cold, salt and dehydration stress tolerance in transgenic tobacco. Molecular Biology Reports 39:4553−64 doi: 10.1007/s11033-011-1245-9

    CrossRef   Google Scholar

    [93] Wang Z, Zhu Y, Wang L, Liu X, Liu Y, et al. 2009. A WRKY transcription factor participates in dehydration tolerance in Boea hygrometrica by binding to the W-box elements of the galactinol synthase (BhGolS1) promoter. Planta 230:1155−66 doi: 10.1007/s00425-009-1014-3

    CrossRef   Google Scholar

    [94] Li H, Xu Y, Xiao Y, Zhu Z, Xie X, et al. 2010. Expression and functional analysis of two genes encoding transcription factors, VpWRKY1 and VpWRKY2, isolated from Chinese wild Vitis pseudoreticulata. Planta 232:1325−37 doi: 10.1007/s00425-010-1258-y

    CrossRef   Google Scholar

    [95] Zhu Z, Shi J, Cao J, He M, Wang Y. 2012. VpWRKY3, a biotic and abiotic stress-related transcription factor from the Chinese wild Vitis pseudoreticulata. Plant Cell Reports 31:2109−20 doi: 10.1007/s00299-012-1321-1

    CrossRef   Google Scholar

    [96] Wei W, Zhang Y, Han L, Guan Z, Chai T. 2008. A novel WRKY transcriptional factor from Thlaspi caerulescens negatively regulates the osmotic stress tolerance of transgenic tobacco. Plant Cell Reports 27:795−803 doi: 10.1007/s00299-007-0499-0

    CrossRef   Google Scholar

    [97] Skibbe M, Qu N, Galis I, Baldwin IT. 2008. Induced plant defenses in the natural environment: Nicotiana attenuata WRKY3 and WRKY6 coordinate responses to herbivory. The Plant Cell 20:1984−2000 doi: 10.1105/tpc.108.058594

    CrossRef   Google Scholar

    [98] Yang G, Zhang W, Liu Z, Yi-Maer AY, Zhai M, Xu Z. 2017. Both Jr WRKY 2 and Jr WRKY 7 of Juglans regia mediate responses to abiotic stresses and abscisic acid through formation of homodimers and interaction. Plant Biology 19:268−78 doi: 10.1111/plb.12524

    CrossRef   Google Scholar

    [99] Yang Z, Chi X, Guo F, Jin X, Luo H, et al. 2020. SbWRKY30 enhances the drought tolerance of plants and regulates a drought stress-responsive gene, SbRD19, in sorghum. Journal of Plant Physiology 246-247:153142 doi: 10.1016/j.jplph.2020.153142

    CrossRef   Google Scholar

    [100] Song Y, Li J, Sui Y, Han G, Zhang Y, et al. 2020. The sweet sorghum SbWRKY50 is negatively involved in salt response by regulating ion homeostasis. Plant Molecular Biology 102:603−14 doi: 10.1007/s11103-020-00966-4

    CrossRef   Google Scholar

    [101] Dong Q, Zheng W, Duan D, Huang D, Wang Q, et al. 2020. MdWRKY30, a group IIa WRKY gene from apple, confers tolerance to salinity and osmotic stresses in transgenic apple callus and Arabidopsis seedlings. Plant Science 299:110611 doi: 10.1016/j.plantsci.2020.110611

    CrossRef   Google Scholar

    [102] Wang J, Tao F, Tian W, Guo Z, Chen X, et al. 2017. The wheat WRKY transcription factors TaWRKY49 and TaWRKY62 confer differential high-temperature seedling-plant resistance to Puccinia striiformis f. sp. tritici. PLoS One 12:e0181963 doi: 10.1371/journal.pone.0181963

    CrossRef   Google Scholar

    [103] Cai R, Dai W, Zhang C, Wang Y, Wu M, et al. 2017. The maize WRKY transcription factor ZmWRKY17 negatively regulates salt stress tolerance in transgenic Arabidopsis plants. Planta 246:1215−31 doi: 10.1007/s00425-017-2766-9

    CrossRef   Google Scholar

  • Cite this article

    Zhao Y, Zheng Y, Jiang L, Niu Y, Yang Y, et al. 2022. Identification of stress-related characteristics of the WRKY gene family: A case study of Dendrobium catenatum. Ornamental Plant Research 2:21 doi: 10.48130/OPR-2022-0021
    Zhao Y, Zheng Y, Jiang L, Niu Y, Yang Y, et al. 2022. Identification of stress-related characteristics of the WRKY gene family: A case study of Dendrobium catenatum. Ornamental Plant Research 2:21 doi: 10.48130/OPR-2022-0021

Figures(9)  /  Tables(3)

Article Metrics

Article views(12151) PDF downloads(1198)

ARTICLE   Open Access    

Identification of stress-related characteristics of the WRKY gene family: A case study of Dendrobium catenatum

Ornamental Plant Research  2 Article number: 21  (2022)  |  Cite this article

Abstract: As one of the largest families of transcription factors (TFs) in plants, the WRKY TF family plays a key role in regulating plant responses to various biotic and abiotic stresses. However, there is no confirmed method to quickly identify stress-responsive members from the WRKY gene family. In this study, all reported functional WRKY genes were first analyzed, and the amino acid patterns in response to stress were identified in group II-c (T-R/K-S/T-E/Q/D-V/I/L-E/D-I/V/H/N-L/M-D/E-D-G/E-F/Y-K/R-WRKYG-Q/K-K-A/T-VKN-S/N-P), group II-d (VPA-I/V-S-X-K-M/L/V/I-ADIP-P/A/V-D-D/E-Y/F-S-WRKYGQKPIKGSP-H/Y-PRGYYKCS-S/T-V/M-RGCPARKVER), and group II-e (PSD-S/A/L-WAWRKYGQKPIKGSPYPR-G/S-YYRCSSSKGC). WRKY genes in Dendrobium catenatum were used to validate the accuracy of these patterns. A total of 63 DcaWRKY genes were identified, their gene structures, conserved motifs, and gene expression patterns were analyzed, and a phylogenetic tree was constructed. Gene expression patterns were then analyzed under drought stress, and seven DcaWRKY genes (Dca002550, Dca002715, Dca005648, Dca007842, Dca010430, Dca016437, and Dca006787) were randomly selected to determine their expression levels and verify their expression patterns by quantitative real-time polymerase chain reaction analysis. The identified amino acid patterns were validated by drought-responsive WRKY genes in D. catenatum, confirming the accuracy of these amino acid patterns and providing valuable insights into further research of the WRKY family in D. catenatum.

    • Transcription factors (TFs) are essential in domesticating plants and are targets for molecular breeding. They play a key role in binding to cis-acting regulatory elements[1]. More than 1000 TF genes have been predicted in angiosperm genomes, and these TF genes can be classified into 58 families based on their DNA-binding domains. The WRKY gene family is the seventh largest TF family in flowering plants[2], where 74 WRKY genes have been identified in dicotyledonous Arabidopsis[3], while 109 WRKY genes have been identified in monocotyledonous rice[4].

      The WRKY gene family shares a highly conserved WRKY domain at the N-terminus and a metal chelating zinc finger-like motif at the C-terminus[5]. Some variants of the WRKY domain, such as WRKYGEK, WRKYGKK, WSKYEQK, WRKYSEK, WRRYGQK, WSKYGQK, WVKYGQK, WKKYGQK, WRICGQK, WRMCGQK, WIKYGQK, and WKRYGQK, have been found in various plants[6,7]. Two main types of zinc finger-like motifs C2H2 (C-X4-5-C-X22-23-H-X-H) and C2HC (C-X7-C-X23-H-X1-C) have been identified[5]. All WRKY domains and zinc finger-like motifs are for structural stabilization[5]. According to the phylogenetic analysis, WRKY proteins are classified into three major groups—I, II, and III—based on the number of WRKY domains and pattern features of the zinc finger-like motif[8]. Only group I members have two WRKY domains, whereas those with one WRKY domain belong to group II or III[8]. Group II has five subgroups—IIa, IIb, IIc, IId, and IIe[8]. Those with C2HC (C-X7-C-X23-H-X1-C) zinc finger-like motifs belong to group III, whereas the members of groups I and II have C2H2 (C-X4-5-C-X22-23-H-X-H) zinc finger-like motifs[5,8].

      WRKY proteins participate in various plant life activities, including defense against stresses, growth and development, biosynthesis, and regulation of hormone signaling[9,10]. As key regulators in plant immune response to various biotic stresses, WRKYs have been extensively investigated in rice, Arabidopsis, soybean, wheat, pepper, and wild tomato[1123]. In rice, OsWRKY62.1 and OsWRKY67 have been established as important regulators against rice pathogens[12,22]. WRKY8, WRKY29, WRKY38, WRKY48, WRKY62, and WRKY33 are involved in response to pathogens in Arabidopsis[11,13,1820]. Moreover, GmWRKY136, GmWRKY53, GmWRKY86, TaWRKY49, TaWRKY62, CaWRKY27, CaWRKY40, CaWRKY40b, CaWRKY6, and SpWRKY1 are involved in defense responses induced by biotic stress[1417,21,23].

      In addition to the response to these biotic stresses, WRKY genes can function effectively in most abiotic stress responses or tolerances in various plants. For example, WRKY25, WRKY39, and WRKY54 in Arabidopsis, PoWRKY13 in tomato, and CaWRKY40 in pepper respond to heat stress[2428]. In contrast, AtWRKY34, VvWRKY24, SlWRKY33, and VbWRKY32 are associated with cold tolerance[2932]. In addition, GhWRKY39-1, GbWRKY1, GmWRKY13 and GmWRKY17 are identified as key regulators in response to salt stress[9,3335].

      Among the various abiotic stresses that plants are exposed to during growth and development, drought is one of the most detrimental environmental factors limiting growth, development, distribution range, and especially plant yield[36]. WRKY genes can regulate the abscisic acid signaling pathway in response to drought[37]. WRKY can also resist drought stress by enhancing dehydration tolerance, reducing stomatal density, modulating ethylene response factors, and effectively eliminating reactive oxygen species by activating cellular antioxidant systems[2]. Thirty-seven WRKY genes that respond to drought stress have been identified in many plant species, including model and non-model plants. In model plants, WRKY1, WRKY1, WRKY18, WRKY40, WRKY46, WRKY54, WRKY57, WRKY60, WRKY63, and WRKY70 in Arabidopsis, and OsWRKY11, OsWRKY45, OsWRKY30, OsWRKY80, and OsWRKY47 in rice, play positive or negative roles in responding to drought stress. Numerous WRKY genes regulating drought resistance have also been identified in non-model plants, such as PbrWRKY53 in Pyrus betulaefolia[38], FvWRKY42 in the diploid woodland strawberry (Fragaria vesca)[39], and FcWRKY70 in Fortunella crassifolia to name a few[40].

      In addition to stress response, WRKY genes play important roles in a range of processes such as root development, senescence regulation, seed germination, and plant nutrient utilization[4147]. For example, WRKY42, WRKY45, WRKY75, and WRKY6 in Arabidopsis, and OsWRKY74 and OsWRKY80 in rice are involved in plant nutrient utilization[42]. AtWRKY6, AtWRKY53, and OsWRKY45 can regulate leaf senescence[46]. Moreover, AtWRKY12, AtWRKY13, AtWRKY71, and OsWRKY11 are associated with floral development in angiosperms[41,44,47].

      Based on these important roles, the identification of WRKY gene family members in plants is the basis for further functional studies. However, identification is difficult because of the large number of WRKY gene family members in most plants. This study examines two pertinent questions to address this difficulty: (1) Is there a sequence pattern for quick identification? and (2) Can this sequence pattern be used for the identification of stress-responsive WRKY genes in Dendrobium catenatum?

      D. catenatum, a perennial herb of Dendrobium in Orchidaceae, has important medicinal properties and high ornamental value. In China, D. catenatum is found in many provinces with wide differences in both temperature and humidity, including Anhui, Zhejiang, Guangxi, Hunan, Yunnan, and Guizhou. The additional stress-related genes in D. catenatum may have contributed to its adaptation to a wide range of environments[48]. Its epiphytic lifestyle and wide distribution range are closely related to its stress tolerance.

      Because there may be a common amino acid pattern of WRKY genes that respond to stress, a confirmatory study was performed using D. catenatum as an example. First, all sequences of reported functional WRKY genes were summarized, and the sequence features of genes belonging to groups II-c, II-d, and II-e that responded to stress were completely analyzed, and the common patterns in each of these three subgroups were determined, which might be markers for identifying stress-resistant WRKY genes. Second, D. catenatum was used to verify the accuracy of these patterns. The WRKY gene family members were identified in D. catenatum and their sequence characteristics were analyzed. The candidate stress-responsive WRKY genes were identified in D. catenatum based on these sequence patterns. The consistency of sequence characteristics between candidate WRKY members in D. catenatum and identified sequence patterns were compared. Finally, the DcaWRKY gene expression pattern was analyzed in different tissues under drought stress, and the expression patterns of seven randomly selected genes were confirmed.

    • All reported functional WRKY sequences were obtained, and their basic information and sequence features were analyzed. The number of amino acids, molecular weight, theoretical isoelectric point (pI), instability index, aliphatic index, and grand average of hydropathicity (GRAVY) of each WRKY protein sequence were calculated by ExPASy protparam (https://web.expasy.org/protparam.html). All amino acid sequences of the WRKY gene family from reported plants were aligned by Multiple Alignment using Fast Fourier Transform (MAFFT) with the E-INS-I strategy[49]. The results of multiple alignments were visualized by GeneDoc software (www.softpedia.com/get/Sc-ience-CAD/GeneDoc.shtml).

    • All Arabidopsis and rice genomic data were downloaded from the Phytozome v12.1.6 database (phytozome.jgi.doe.gov) to create a protein dataset. A hidden Markov model (HMM) search was performed against the protein database using the WRKY domain file (PF03106) that was downloaded from the Pfam database to identify WRKY family members[50]. To verify the preliminary results, each predicted sequence was analyzed using Pfam, simple modular architecture research tool (SMART), and NCBI CD-Search (www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi)[51]. Sequences with obvious errors were excluded.

      All WRKY sequences in Arabidopsis and rice, as well as reported WRKY gene sequences, were used to reconstruct a phylogenetic tree by the maximum likelihood (ML) method using PhyML 3.0 software[52]. Here, 1000 bootstrap replicates were used to test the reliability of the tree. Inspired by a Shimodaira–Hasegawa-like procedure, the approximate likelihood-ratio test branch support was estimated with the Whelan and Goldman model[52].

    • To identify the stress response sequence patterns in groups II-c and II-e, sequences of stress-related genes clustered in the same branch in the subgroups were aligned by MAFFT with the E-INS-I strategy[49]. Stress-responsive amino acid sequence patterns in groups II-c and II-e were identified separately by the results of multiple comparisons by GeneDoc software.

      Similarly, sequences of WRKY members of group II-d clustered in a branch related to abiotic stress were aligned to identify the amino acid sequence patterns in this subgroup.

    • All WRKY protein sequences of D. catenatum in the two genome versions were downloaded for further analysis[48,53]. The file of the WRKY domain (PF03106) was used to search against the D. catenatum genomes by performing hmmsearch using HMMER software[49,50].

      Various physicochemical parameters, including theoretical pI, the number of amino acids, aliphatic index, molecular weight, instability index, and GRAVY for DcaWRKY proteins, were computed by the ExPASy protparam online tool.

      The WRKY family gene structure in D. catenatum was analyzed using the Batch SMART plug-in in TBtools[54]. The exons, introns, and untranslated regions of the DcaWRKY genes were analyzed and visualized by loading the GFF files of D. catenatum to the TBtools software, which was also used for analyzing and searching for conserved motifs.

    • MAFFT was used to align and manually adjust the protein sequences of all WRKY family members in D. catenatum using the E-INS-I strategy[49]. By submitting the multiple sequence results to GeneDoc software, the multiple sequence alignments could be visualized and analyzed.

      To study the phylogenetic relationships of DcaWRKY proteins and orthologs in Arabidopsis and rice, a phylogenetic tree was reconstructed using the ML method approach with 1000 bootstrap replicates and the Whelan and Goldman model by PhyML[52].

    • Transcriptome data used in this study was from Wang et al.[55]. Briefly, healthy individuals (~12 cm tall) of D. catenatum were grown in a greenhouse (12/12 h light/dark, light intensity ~100 μmol·m−2·s−1; 28/22 °C day/night; 60%/70% relative humidity day/night). After first-day irrigation was performed, water was withheld for 10 d to simulate drought stress. The fourth and fifth leaves from the apex and young roots were collected from each plant at 9:00 h when the base material was in a drought and normal growth state. Salmon v0.9.1 was used to estimate gene abundance as reading counts based on alignment patterns[56].

      The DcaWRKY gene expression patterns in each tissue were analyzed, and heatmaps were generated using TBtools software. The Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) values for each gene in all root and leaf samples were log2 transformed[54,56]. Each sample had three biological replicates. Those with more than 2.0-fold change in expression under drought treatment compared with normal treatment were identified as differentially expressed genes.

    • Among all the differentially expressed DcaWRKY genes in both roots and leaves, four genes with decreased expression and three genes with increased expression when responding to drought stress were randomly selected. These seven genes — Dca002550, Dca002715, Dca005648, Dca006787, Dca007842, Dca010430, and Dca016437 — were used for further qRT-PCR analysis. Total RNA was extracted using the cetyltrimethylammonium bromide (CTAB) method. Extracted RNA was reverse-transcribed using the Fast Quant RT Kit with gDNase (Tiangen, Beijing, China).

      The relative transcription levels of the selected WRKY genes during different treatments were analyzed by qRT-PCR. 18S rRNA was used as the internal control. The primer sequences for the selected genes were designed with the Primer3Plus interface (www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/). All qRT-PCR assays were performed on a Roche 480 real-time PCR system (LightCycler® 480; Roche, Basel, Switzerland) with three biological replicates. The reactions were conducted in a reaction volume of 10 μL with three technical replicates for each sample. The PCR program was as follows: 95 °C for 3 min and 45 cycles of 95 °C for 10 s, 65 °C for 20 s, 72 °C for 30 s, 95 °C for 5 s, and 60 °C for 1 min. The 18S gene was used as an internal control to calculate the relative fold expression levels according to the Ct method. Finally, the TBtools software was used to generate a heatmap of DcaWRKY genes in leaves.

    • All reported functional WRKY genes are summarized in Table 1. The majority of genes were from Arabidopsis, rice, and soybean, with 27, 16, and nine, respectively. Seven WRKY genes were identified in wheat and six WRKY genes were identified in land cotton, whereas only one functional WRKY gene was reported in Pyrus, Chrysanthemum, Tamarix, and Macrotyloma. Numerous functional studies of WRKY genes have mostly focused on model plants and crops, whereas reports on ornamentals, especially flowers and medicinal plants, are few.

      Table 1.  Reported functional WRKY genes summarized in this study.

      GroupGene IDSpeciesFunctionReferences
      IIIGhWRKY33Gossypium hirsutumTolerance to drought[58]
      IIIPbrWRKY53Pyrus betulaefoliaTolerance to drought[38]
      II CGmWRKY54Glycine maxTolerance to drought[59]
      II AGmWRKY27Glycine maxTolerance to drought[58]
      IIIAtWRKY63Arabidopsis thalianaTolerance to drought[60]
      ITaWRKY2 and TaWRKY19Triticum aestivumTolerance to drought[61]
      II COsWRKY11Oryza sativaTolerance to drought[57]
      IIIOsWRKY45Oryza sativaTolerance to drought[62]
      II AWRKY18, WRKY40 and WRKY60Arabidopsis thalianaTolerance to drought[63,64]
      IWRKY1Arabidopsis thalianaTolerance to drought[65]
      IIIWRKY46, WRKY54, and WRKY70Arabidopsis thalianaTolerance to drought[42]
      II CAtWRKY57Arabidopsis thalianaTolerance to drought[37]
      I AOsWRKY30Oryza sativaTolerance to drought[66]
      IIOsWRKY80Oryza sativaTolerance to drought[67]
      IIIOsWRKY47Oryza sativaTolerance to drought[68]
      IFvWRKY42Fragaria vescaTolerance to drought[39]
      II DZmWRKY58Zea maysTolerance to drought[41]
      II EZmWRKY106Zea maysTolerance to drought[69]
      II AZmWRKY40Zea maysTolerance to drought[69]
      II ECmWRKY10Chrysanthemum morifoliumTolerance to drought[70]
      III and ITaWRKY1 and TaWRKY33Triticum aestivumTolerance to drought[71]
      II DThWRKY4Tamarix hispidaTolerance to drought[72]
      IMuWRKY3Macrotyloma uniflorumTolerance to drought[73]
      II DGhWRKY17Gossypium hirsutumTolerance to drought[34]
      IIIGhWRKY41Gossypium hirsutumTolerance to drought[74]
      ITaWRKY44Triticum aestivumTolerance to drought[75]
      IIIFcWRKY70Fortunella crassifoliaTolerance to drought[40]
      II CGmWRKY12Glycine maxTolerance to drought[76]
      IIIZmWRKY79Zea maysTolerance to drought[77]
      II DGhWRKY21Gossypium hirsutumTolerance to drought[78]
      IIISlWRKY81Solanum lycopersicumTolerance to drought[79]
      ISPF1Ipomoea batatasRoot development[43]
      I and II AABF1 and ABF2Avena fatuaSeed germination[45]
      II BWRKY42 and WRKY6Arabidopsis thalianaPlant nutrient[42]
      II CWRKY45 and WRKY75
      III and II EWRKY74 and WRKY80Oryza sativaPlant nutrient[42]
      IIIAtWRKY53Arabidopsis thalianaLeaf senescense[46]
      II COsWRKY11Oryza sativaFloral development[41]
      II CAtWRKY12 and AtWRKY13Arabidopsis thalianaFloral development[44]
      II CAtWRKY71Arabidopsis thalianaFloral development[47]
      IAtWRKY2Arabidopsis thalianaReproductive development[80]
      IOsWRKY70Oryza sativaDefense response[81]
      II CFvWRKY48Fragaria vescaPectin degradation[82]
      II EOsWRKY13Oryza sativaRegulated ABA signaling and tolerance to salt[83]
      II CVlWRKY3Vitis viniferaResponse to Golovinomyces cichoracearum and tolerant to salt[84]
      II CGhWRKY68Gossypium hirsutumReduced salt tolerance and drought resistance[85]
      IGhWRKY25Gossypium hirsutumTolerance to salt[86]
      IVvWRKY24Vitis viniferaTolerance to cold[29]
      IAtWRKY25 and AtWRKY33Arabidopsis thalianaTolerance to heat[25]
      IAtWRKY34Arabidopsis thalianaNegative regulator in cold stress[31]
      IIIAtWRKY53Arabidopsis thalianaReduced drought resistance[87]
      IIIAtWRKY63Arabidopsis thalianaRegulated ABA signaling[60]
      IIIAtWRKY54Arabidopsis thalianaResponse to heat stress[28]
      II COsWRKY72Oryza sativaSensitive to salt, sucrose, and ABA[88]
      IIIOsWRKY74Oryza sativaTolerance to cold and Pi deprivation[89]
      II AOsWRKY76Oryza sativaTolerance to cold[90]
      IIIOsWRKY89Oryza sativaTolerance to UV[91]
      II AGmWRKY17Glycine maxReduced salt tolerance[34]
      IIIBcWRKY46Brassica campestrisTolerance to salt[92]
      IIIBhWRKY1Boea hygrometricaTolerance to salt[93]
      III and IVpWRKY1 and VpWRKY2Vitis pseudoreticulataTolerance to salt and cold[94]
      II AVpWRKY3Vitis pseudoreticulataTolerance to salt[95]
      IIITcWRKY53Thlaspi caerulescensNegative regulator in osmotic stress[96]
      INaWRKY3Nicotiana attenuataSensitive to mechanical damage[97]
      I and II DJrWRKY2 and JrWRKY7Juglans regiaTolerance to drought and cold[98]
      IIISbWRKY30Sorghum bicolorTolerance to salt and drought[99]
      II CSbWRKY50Sorghum bicolorTolerance to salt[100]
      II AMdWRKY30Malus domesticaTolerance to salt and osmotic stress[101]
      II CGbWRKY1Gossypium barbadenseTolerance to salt[35]
      IVbWRKY32Verbena bonariensisTolerance to cold[28]
      II COsWRKY67Oryza sativaNegative regulator of innate defense response[22]
      II AOsWRKY62.1Oryza sativaPositive regulator of PTI and ETI against pathogens[12]
      IIIAtWRKY38 and AtWRKY62Arabidopsis thalianaResponse to bacterial pathogen[11]
      II A,II C, and II BGmWRKY136, GmWRKY53, and GmWRKY86Glycine maxTolerance to SCN[23]
      II C and IIITaWRKY49 and TaWRKY62Triticum aestivumTolerance to stripe rust[102]
      II ACaWRKY40b and CaWRKY40Capsicum annuumNegative regulation of plant immunity[17,24]
      II BCaWRKY6Capsicum annuumTolerance to R. solanacearum[15]
      ISpWRKY1Solanum pimpinellifoliumTolerance to Phytophthora infestans[16]
      II DZmWRKY17Zea maysNegative regulator of salt stress[103]
      II DGhWRKY39-1Gossypium hirsutumTolerance to salt[33]
      II CAtWRKY8Arabidopsis thalianaDefense response[13]
      II ECaWRKY27Capsicum annuumResponse to Ralstonia solanacearum infection[14]
      II CAtWRKY48Arabidopsis thalianaTolerance to P. syringae[20]
      II EAtWRKY29Arabidopsis thalianaResistance to P. syringe[18]
      II CPoWRKY13PopulusResponse to heat stress[26]
      tomentosa
      IIISlWRKY33Solanum lycopersicumTolerance to cold[30]
      II DGmWRKY13Glycine maxResponse to salt and mannitol[9]

      To analyze the branch specificity of the WRKY gene family that responded to stress, a phylogenetic tree was reconstructed from AtWRKY genes, OsWRKY genes, and all reported functional WRKY genes (Fig. 1). All reported functional WRKY proteins were divided into three groups—I, II, and III, with group II being further divided into five subgroups—II-a, II-b, II-c, II-d, and II-e. Most WRKY proteins were widely distributed in all these groups rather than concentrated in the same branch. However, OsWRKY67, SbWRKY50, GmWRKY21, AtWRKY8, and AtWRKY48 play important roles under stress and were clustered in a branch of group II-c. Similarly, as essential stress-related genes, WRKY80 and WRKY13 in rice, WRKY29 in Arabidopsis, CaWRKY27 in pepper, and ZmWRKY106 in maize clustered in one branch of group II-e. In addition, reported genes responding to abiotic stress, including ZmWRKY58, GhWRKY21, GhWRKY17, ThWRKY4, GmWRKY13, GhWRKY39-1, and JrWRKY7, were all located in group II-d.

      Figure 1. 

      Phylogenetic analysis of WRKY family proteins in Arabidopsis, rice, and other reported species.

      Therefore, because of these distribution features of reported functional WRKY genes, the identification of amino acid sequence patterns in response to stress focused on groups II-c, II-d, and II-e.

    • To further characterize the stress-responsive WRKY proteins for identifying the amino acid patterns in different subgroups, the properties of all drought-resistant WRKY proteins (molecular weight, pI, instability index, etc.) were analyzed (Supplemental Table S1). The molecular weight of stress-related WRKY proteins ranged from 16801.82 to 74561.15, PI ranged from 4.86 to 9.96, and the instability index ranged from 37.86 to 88.65, showing a wide range of values.

      From the alignment results, the amino acid patterns responding to stress were found in groups II-c, II-d, and II-e (Fig. 2). In contrast to groups II-d and II-e, where only stress-related WRKY genes were reported, group II-c contained WRKY genes that play important roles in plant growth and development besides stress-response. All stress-related genes clustered in the group II-e branch had the amino acid pattern 'PSD-S/A/L-WAWRKYGQKPIKGSPYPR-G/S-YYRCSSSKGC'. Similarly, the amino acid pattern 'VPA-I/V-S-X-K-M/L/V/I-ADIP-P/A/V-D-D/E-Y/F-S-WRKYGQKPIKGSP-H/Y-PRGYYKCS-S/T-V/M-RGCPARKVER' was found in the sequences of reported genes responding to abiotic stress clustered in the group II-d branch, which might be closely related to stress. In addition, for group II-c, an amino acid sequence pattern 'T-R/K-S/T-E/Q/D-V/I/L-E/D-I/V/H/N-L/M-D/E-D-G/E-F/Y-K/R-WRKYG-Q/K-K-A/T-VKN-S/N-P' in the stress-related genes clustered in one of the branches. From the alignment results, the sequences of WRKY genes involved in plant growth and development belonging to group II-c (FvWRKY48, ATWRKY75, ATWRKY45, ATWRKY12, ATWRKY13, and ATWRKY71) did not match this amino acid sequence pattern, further supporting the accuracy of this amino acid pattern in group II-c (Fig. 2a).

      Figure 2. 

      Multiple sequence alignment of reported WRKY family proteins. (a) Multiple sequence alignment of reported WRKY proteins in group II-c. (b) Multiple sequence alignment of reported WRKY proteins in group II-d. (c) Multiple sequence alignment of reported WRKY proteins in group II-e.

    • To identify DcaWRKY genes, all the potential WRKY genes were extracted from two genome versions of D. catenatum; an old genome version with 63 WRKY genes and an updated genome version with 60 WRKY genes[48,53]. After sequences were aligned by MAFFT, all 60 genes from the updated genome version were present in the old genome version, except for three genes (Dca028175, Dca028770, and Dca027312). After verifying the sequence characteristics, Dca028175 and Dca027312 had the 'WRKYGQK' domain and a zinc finger motif. Dca028770 had the variant WRKY domain 'WRKYGKK' but no zinc finger motif. For all three genes containing the WRKY domain, the WRKY gene family members could be used for further analysis. In total, 63 candidate WRKY gene family members were identified in D. catenatum. To validate them, the amino acid sequences of all members were searched against NCBI, Pfam, and SMART databases for the presence of the WRKY domain. The results showed that all sequences contained the WRKY domain (Table 2).

      Table 2.  Characteristics of WRKY genes in D. catenatum.

      Gene IDWRKY domainNo. of
      domains
      No. of
      exons
      No. of
      introns
      Group
      Conserved heptapeptideZinc fingerZinc finger type
      Dca000627WRKYGQK132II E
      Dca000637WRKYGQKC2H2CX4CX23HXH121II C
      Dca000671WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca000699WRKYGQKC2H2CX4CX23HXH121II C
      Dca000873WRKYGQKC2H2CX5CX23HXH154II B
      Dca002197WKKYGQKC2H2CX4CX23HXH121I
      Dca002205WRKDGTH/WRKYATNC2H2/C2H2CX4CX23HXH/CX4CX23HXH265I
      Dca002550WRKYGQKC2H2CX5CX23HXH132II E
      Dca002715WRKYGQKC2H2CX4CX23HXH132II C
      Dca003067WRKYGQKC2HCCX7CX23HXC132III
      Dca003180WRKYGQKC2H2CX5CX23HXH132II D
      Dca003732WRKYGQKC2H2CX4CX23HXH121II C
      Dca004998WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca005043WRKYGQKC2HCCX7CX23HXC132III
      Dca005048WRKYGEKC2HCCX7CX23HXC121III
      Dca005648WRKYGQKC2H2CX4CX23HXH132II C
      Dca005780WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca006278WRKYGQKC2H2CX5CX23HXH132II D
      Dca006505WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH265I
      Dca006646WRKYGQKC2HCCX7CX23HXC132III
      Dca006787WRKYGQKC2H2CX5CX23HXH132II E
      Dca007186WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca007842WRKYGQKC2H2CX5CX23HXH154II B
      Dca008357WRKYGQKC2H2CX5CX23HXH143II A
      Dca008967WTKYGQKC2H2CX4CX23HXH132I
      Dca008968WNKYGQKC2H2CX4CX23HXH121I
      Dca008985WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca009368WRKYGQKC2H2CX4CX23HXH132II C
      Dca010430WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca010993WRKYGQKC2H2CX4CX23HXH121II C
      Dca011499WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH232II C
      Dca011569WRKYGQKC2H2CX5CX23HXH154II B
      Dca011912WRKYGQKC2H2CX5CX23HXH132II A
      Dca011914WRKYGQKC2H2CX5CX23HXH143II A
      Dca012410WRKYGQKC2H2CX5CX23HXH132II E
      Dca012846WRKYGQKC2H2CX4CX23HXH132II C
      Dca013146WRKYGQKC2HCCX7CX23HXC132III
      Dca013149WRKYGQKC2HCCX7CX23HXC132III
      Dca013150WRKYGEKC2HCCX7CX23HXC132III
      Dca014563WRKYGQKC2HCCX7CX23HXC121III
      Dca015482WRKYGQKC2H2CX5CX23HXH132II D
      Dca015639WRKYGKKC2H2CX4CX23HXH132II C
      Dca015848WRKYGQKC2H2CX4CX23HXH121II C
      Dca015914WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH232II C
      Dca016437WRKYGQKC2H2CX4CX23HXH121II C
      Dca016988WRKYGQKC2H2CX5CX23HXH121II E
      Dca017113WRKYGQKC2H2CX4CX23HXH132II C
      Dca018137WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca018897WRKYGQKC2H2CX5CX23HXH143II A
      Dca019319WRKYGQKC2HCCX7CX23HXC132III
      Dca019656WRKYGQKC2H2CX5CX23HXH132II E
      Dca019840WRKYGKKC2H2CX4CX23HXH132II C
      Dca020159WRKYGQKC2H2CX4CX23HXH121II C
      Dca020342WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH254I
      Dca020473WRKYGQKC2H2CX5CX23HXH132II E
      Dca021638WRKYGEK/WRKYGEK—/C2HC—/CX7CX23HXC254III
      Dca023070WRKYGQKC2H2CX5CX23HXH132II D
      Dca024256WRKYGQKC2H2CX5CX23HXH121II E
      Dca024393WRKYGQK/WRKYGQKC2H2/C2H2CX4CX22HXH/CX4CX23HXH243I
      Dca026708WRKYGQKC2H2CX4CX23HXH143II A
      Dca027312WRKYGQKC2HCCX7CX23HXC132III
      Dca028175WRKYGQKC2H2CX4CX23HXH132II C
      Dca028770WRKYGKK--110II C
    • WRKYs in D. catenatum, Arabidopsis, and rice were subjected to phylogenetic analysis to investigate the phylogenetic relationships and potential functions of these DcaWRKY genes (Fig. 3). The WRKY genes in D. catenatum were divided into the three groups I, II, and III based on amino acid sequence similarity, which is the same as the widely accepted classification system for this gene family in Arabidopsis[6]. Among all WRKY genes in D. catenatum, the number of groups I, II, and III was 14, 38, and 11, respectively. There were five subgroups in group II, which were IIa, IIb, IIc, IId, and IIe, and the number of WRKY genes in these groups was five, three, 18, four, and eight, respectively. The results indicated that more than half of WRKY genes were clustered in group II.

      Figure 3. 

      Phylogenetic analysis of WRKY family proteins in D. catenatum.

      All DcaWRKY proteins were analyzed by ExPASy protparam to calculate the number of amino acids, molecular weight, pI, instability index, aliphatic index, and GRAVY. The molecular weight of DcaWRKY proteins varied from 10,998.29 to 78,355.63, pI ranged from 4.57 to 10.63, and the instability index ranged from 34.57 to 76.36 (Supplemental Table S2). Analysis of DcaWRKY proteins indicated that WRKY family members in D. catenatum did not show specificity in physicochemical properties, which is the same as reported drought-resistance WRKY proteins.

      To further understand the biological functions of DcWRKY genes, WRKY domain types, intron/exon distribution, and conserved motifs were analyzed according to their phylogenetic relationships. Of the 77 WRKY domains, 65 contained perfectly conserved WRKYGQK domains, whereas the other domains differed in one or more amino acids in the conserved WRKY signature. In addition, eight conserved motifs in DcaWRKY proteins were found by TBtools. To better understand the phylogenetic relationships and classification of WRKY members in D. catenatum, the intron/exon distribution was analyzed by TBtools. The number of introns in DcaWRKY genes varied from zero to five. Similarity in gene structure and sequence characteristics of WRKY members in the same branch were used to validate the reliability of the phylogenetic classification (Fig. 4).

      Figure 4. 

      Conserved motifs and gene structure of DcaWRKY genes according to phylogenetic relationships.

      Group I contained two WRKY domains and two C2HC zinc finger motifs, but three DcaWRKY proteins (Dca002197, Dca008967, and Dca008968) contained only one WRKY domain and a C2H2 zinc finger motif. Besides, members of group I had five WRKY domain variant types—WKKYGQK in Dca002197, WTKYGQK in Dca008967, WNKYGQK in Dca008968, and both WRKDGTH and WRKYATN in Dca002205. Notably, the variant types WRKDGTH, WRKYATN, WTKYGQK, and WNKYGQK were first found in D. catenatum (Table 2). The number of introns in group I members widely varied from one to five. For example, Dca002205 and Dca006505 had five introns, whereas Dca002197 and Dca008968 had only one intron. Furthermore, all the DcaWRKY members of group I contained motifs 1 and 2. Interestingly, motif 7 was unique to group I (Fig. 4).

      Group II proteins were close to group I proteins in the phylogenetic tree, but they contained only one WRKY domain, except for Dca011499 and Dca015914, which had two domains and two C2H2 zinc finger motifs. Besides, the only WRKY variant type WRKYGKK in group II was found in group II-c members Dca015639, Dca019840, and Dca028770 (Table 2). Similar to group I, the number of introns in group II varied from one to four except for Dca028770, which lacked introns. However, the number of introns was more focused in each subgroup of group II compared with group I. For example, groups II-a, II-b, and II-d contain three, four, and two introns, respectively. Among the three subgroups, the distribution and quantity of the motifs in all genes of the same subgroup were the same. Motifs 6, 1, and 2 were dispersed in group II-d. All members of group II-b had motifs 5, 1, 4, and 2, whereas DcaWRKY members of group II-a had motifs 5 and 2. Besides, motif 5 was uniquely dispersed in group II (Fig. 4).

      All members of group III had one WRKYGQK domain, except for Dca021638, which had two WRKYGEK domains. Unlike groups I and II, the zinc finger motif of most WRKY proteins in group III was replaced by a C2HC zinc finger motif. For Dca0021638, variants of WRKYGEK/WRKYGEK or loss of a C2HC zinc finger motif might contribute to its classification in group III rather than group I (Table 2). Besides, all group III members had two exons except for Dca005048 (one), Dca014563 (one), and Dca021638 (four). The motif analysis results indicated that all members of group III contained motifs 1, 2, 6, and 8, and motif 8 was only dispersed in group III (Fig. 4).

    • The identified stress-related amino acid pattern 'PSD-S/A/L-WAWRKYGQKPIKGSPYPR-G/S-YYRCSSSKGC' was used to identify WRKY genes of group II-e in D. catenatum. After multiple sequence alignment, Dca006787, Dca002550, Dca012410, and Dca019656 shared amino acid patterns and were identified as potential stress response genes (Fig. 5). Likewise, Dca019840, Dca005648, and Dca028770 of group II-c were also identified using the sequence pattern 'T-R/K-S/T-E/Q/D-V/I/L-E/D-I/V/H/N-L/M-D/E-D-G/E-F/Y-K/R-WRKYG-Q/K-K-A/T-VKN-S/N-P' (Fig. 5). In addition, using the 'VPA-I/V-S-X-K-M/L/V/I-ADIP-P/A/V-D-D/E-Y/F-S-WRKYGQKPIKGSP-H/Y-PRGYYKCS-S/T-V/M-RGCPARKVER' amino acid pattern, one potential gene, Dca023070, of group II-d in D. catenatum was identified as responsive to abiotic stress (Fig. 5).

      Figure 5. 

      Multiple sequence alignment of identified DcaWRKY proteins.

    • Different WRKY genes have different tissue-specific expression patterns. To identify the accuracy of these patterns, the expression of all WRKY genes in roots and leaves of D. catenatum was separately analyzed under drought stress (Fig. 6, Supplemental Fig. S1).

      Figure 6. 

      The summarized figure of DcaWRKY genes expression in roots and leaves. '↑' indicates that gene expression increased under drought treatment. '↓' indicates decreased expression under drought treatment. Dca000671, Dca003180, Dca005043, Dca008968, Dca013149, and Dca017113 were differently expressed in leaves under drought treatment; similarly, Dca011499, Dca011914, Dca016988, Dca018137, Dca019840, and Dca027312 were differently expressed in roots. Dca000627, Dca002550, Dca006787, Dca002715, Dca005648, Dca007842, Dca010430, Dca011569, Dca015914, Dca016437, Dca019656, Dca024256, Dca026708, Dca028770, and Dca003067 were expressed both in leaves and roots under drought treatment.

      A total of 29 differentially expressed WRKY genes in roots and leaves of D. catenatum were identified by the data. In roots, the expression of 22 DcaWRKY genes (Dca000627, Dca002550, Dca002715, Dca003067, Dca005648, Dca006787, Dca007842, Dca010430, Dca011499, Dca011569, Dca011914, Dca015914, Dca016437, Dca016988, Dca018137, Dca019840, Dca023070, Dca024256, Dca026708, Dca027312, Dca019656, and Dca028770) showed a change in drought-treated plants compared with untreated plants. Among these, most genes showed a decrease in expression, especially the Dca010430 gene, which induced a > 8.0-fold decrease in response to drought treatment. In contrast, Dca003067 and Dca018137 were upregulated and showed an opposite expression pattern (Fig. 7). In leaves, 22 WRKY members that were differentially expressed when responding to drought were considered drought-responsive genes; these included Dca000627, Dca000671, Dca002550, Dca002715, Dca003067, Dca003180, Dca005043, Dca005648, Dca006787, Dca007842, Dca008968, Dca010430, Dca011569, Dca012410, Dca013149, Dca015914, Dca016437, Dca017113, Dca024256, Dca019656, Dca026708, and Dca028770. All of these showed a decrease in their expression levels, except for Dca002550, Dca005648, and Dca010430, whose expression levels showed 2.0- to 11.0-fold increase in drought-treated plants compared with untreated plants (Fig. 8).

      Figure 7. 

      Heatmap of differentially expressed DcaWRKY genes under drought stress in roots. The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.

      Figure 8. 

      Heatmap of differentially expressed DcaWRKY genes under drought stress in leaves. The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.

      A total of 15 genes in both roots and leaves showed a significant difference in expression levels when responding to drought stress, including Dca000627, Dca002550, Dca006787, Dca002715, Dca005648, Dca007842, Dca010430, Dca011569, Dca015914, Dca016434, Dca024256, Dca019656, Dca026708, Dca028770, and Dca003067. Interestingly, the identified drought-responsive gene Dca003067 showed the opposite expression patterns in the leaves and roots. Drought treatment led to a significant decrease in the expression level in leaves but an increased expression in roots.

      In leaves, seven drought-responsive genes, including three genes whose expression increased and four genes whose expression decreased, were randomly selected for validation by qRT-PCR. These genes were Dca002550, Dca002715, Dca005648, Dca007842, Dca010430, Dca016437, and Dca006787 (Table 3, Fig. 9). All of them were differentially expressed in drought-treated plants compared with untreated plants. Thus, the expression patterns of these seven genes obtained by qRT-PCR were consistent with the transcriptome analysis results, confirming the reliability of the transcriptome data.

      Table 3.  qRT-PCR primers of DcaWRKYs.

      Primer nameSequence (5'-3')
      Dca002550-FGTGTTCGAGCTCAACCATCA
      Dca002550-RTGATCGTGATCTCCCATGAA
      Dca005648-FGGCCGATTCACCGAATAATA
      Dca005648-RTTTCAACACGCTTCTTCACG
      Dca006787-FGCGATCTCTTTGCCTCAAAC
      Dca006787-RTTCCTTGCTGAGCATCCTTT
      Dca007842-FGCTCCTCTACCACCCATTCA
      Dca007842-RGTGAGGTCGAGGGTGATTGT
      Dca010430-FAGGAAGTCTGACGACGGCTA
      Dca010430-RCGAGTGGACTGAGGCTTAGG
      Dca016437-FATCGTTGCACCACACAGAAG
      Dca016437-RAAGTCATGGTGGAAGCTTGG

      Figure 9. 

      Heatmap of the selected DcaWRKY genes in leaves. The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.

    • After a comprehensive analysis of reported functional WRKY gene sequences, gene structure, and phylogenetic analysis, the amino acid patterns 'T-R/K-S/T-E/Q/D-V/I/L-E/D-I/V/H/N-L/M-D/E-D-G/E-F/Y-K/R-WRKYG-Q/K-K-A/T-VKN-S/N-P', 'VPA-I/V-S-X-K-M/L/V/I-ADIP-P/A/V-D-D/E-Y/F-S-WRKYGQKPIKGSP-H/Y-PRGYYKCS-S/T-V/M-RGCPARKVER', and 'PSD-S/A/L-WAWRKYGQKPIKGSPYPR-G/S-YYRCSSSKGC' were found in groups II-c, II-d, and II-e, respectively, which might be valid features of genes responding to stress in these three subgroups. Then, D. catenatum was used to validate these amino acid patterns. Four WRKY genes in group II-e (Dca006787, Dca002550, Dca012410, and Dca019656), three genes in group II-c (Dca019840, Dca005648, and Dca028770), and one gene in group II-d (Dca023070) were identified by homology searches. The expression of the identified DcaWRKY genes in roots and leaves was further analyzed under drought stress using qRT-PCR data. The expression levels of all potential genes identified as responsive to abiotic stress (stress under the drought treatment) were found to significantly change compared with untreated plants, suggesting that these identified amino acid patterns were valid and feasible for identifying abiotic stress in D. catenatum.

      Although further studies are needed, the amino acid patterns identified in response to stress not only provide an ideal method for quickly identifying stress-related genes in D. catenatum but also offer a new perspective for the identification of functional genes in other species.

    • In this study, DcaWRKY gene expression and the phylogeny of WRKY genes were analyzed. Various expression mechanisms of WRKY genes in D. catenatum were found under drought stress.

      All differentially expressed WRKY genes in roots and leaves were comprehensively analyzed. The expression changes in WRKY genes in roots and leaves were analyzed first. Among all 29 differentially expressed WRKY genes, the expression levels of 14 DcaWRKY genes were changed only in roots or leaves when responding to drought stress. Among these 14 WRKY genes, seven were differentially expressed only in roots, including Dca011499, Dca011914, Dca016988, Dca018137, Dca019840, and Dca027312. Similarly, Dca000671, Dca003180, Dca005043, Dca008968, Dca013149, and Dca017113 were differentially expressed only in leaves. Some DcaWRKY genes might be differentially expressed only in specific tissues when responding to drought stress. Among the 14 WRKY genes, the expression levels of Dca002550, Dca005648, and Dca010430 were downregulated in leaves but were upregulated in roots in drought-treated plants compared with untreated plants. In contrast, under drought stress, Dca003067 expression was highly upregulated in leaves and downregulated in roots. Except for these three genes, all 11 genes among the 14 WRKY genes showed the same trend of expression in roots and leaves when responding to drought stress. Of the 11 DcaWRKY genes, only the expression of Dca003067, clustered in group III, was upregulated in drought-treated plants, whereas other genes were clustered in group II, and their expression levels were downregulated compared with the control. Genes with expression patterns consistent with phylogenetic branching correlations were clustered in group II; thus, we presume that the downregulation of expression levels is associated with the characteristics of group II. The molecular mechanisms of drought responses in different tissues of D. catenatum might be different.

      WRKY phylogeny was systematically analyzed in Arabidopsis, rice, and D. catenatum. According to the phylogenetic tree, the members that belong to the same branch might possess a conserved function because of their common evolutionary processes. A close relationship was found between Dca016437 and Dca002715 and OsWRKY11, which was identified as an anti-drought gene in rice by the phylogenetic tree. These two genes might have the same response mechanism as OsWRKY11, whose ectopic expression resulted in constitutive expression of defense-associated genes to enhance tolerance to drought stress in rice[57].

      • This work was supported by the Young Talent Project of Hebei Agricultural University Foundation (YJ201848), and the Youth Fund of Hebei Province Natural Science Foundation (C2019204295). We would like to thank TopEdit (www.topeditsci.com) for linguistic assistance during the preparation of this manuscript.

      • The authors declare that they have no conflict of interest.

      • Supplemental Table. S1 The basic amino acids information of reported functionalWRKY genes.
      • Supplemental Table S2 The basic amino acids information of DcaWRKY genes.
      • Supplemental Fig. S1 Expression heatmap of DcaWRKY genes in roots and leaves.The color scale shows increasing expression levels from green to red, which represents log2-transformed FPKM.
      • Copyright: © 2022 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (9)  Table (3) References (103)
  • About this article
    Cite this article
    Zhao Y, Zheng Y, Jiang L, Niu Y, Yang Y, et al. 2022. Identification of stress-related characteristics of the WRKY gene family: A case study of Dendrobium catenatum. Ornamental Plant Research 2:21 doi: 10.48130/OPR-2022-0021
    Zhao Y, Zheng Y, Jiang L, Niu Y, Yang Y, et al. 2022. Identification of stress-related characteristics of the WRKY gene family: A case study of Dendrobium catenatum. Ornamental Plant Research 2:21 doi: 10.48130/OPR-2022-0021

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return