Figures (9)  Tables (1)
    • Figure 1. 

      Effects of heat stress and exogenous chitosan on (a) turf quality and (b) shoot phenotype in creeping bentgrass exposed to non-stressed control and heat stress. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Shoot phenotype was taken at 42 d of treatments. Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 2. 

      Effects of heat stress and exogenous chitosan on staining of (a) hydrogen peroxide and (b) superoxide in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night).

    • Figure 3. 

      Effects of heat stress and exogenous chitosan on content of (a) ascorbic acid and (b) glutathione in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 4. 

      Effects of heat stress and exogenous chitosan on activities of (a) SOD, (b) CAT, and (c) POD in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 5. 

      Effects of heat stress and exogenous chitosan on activities of (a) APX, (b) GR, (c) DHAR, and (d) MDHAR in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/2 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 6. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsFeSOD, (b) AsCu/ZnSOD, and (c) AsMnSOD in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 7. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsCATA, (b) AsCATB, (c) AsCATC, and (d) AsPerox4 in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 8. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsAPX1, (b) AsAPX2, (c) AsAPX3, (d) AsAPX4, (e) AsAPX5, (f) AsAPX6, and (g) AsAPX8 in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Figure 9. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsGR1, (b) AsGR2, (c) AsDHAR, and (d) AsMDHAR in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • Gene nameForward primer (5’-3’)Reverse primer (5’-3’)
      AsFeSODTGCTCGTCTGTCATCCTTGTGGTTGGGTTTGGCTTGTCTT
      AsCu/ZnSODAATGTGACAGCTGGAGTGGACCCTTGCCAAGATCATCAGC
      AsMnSODAGGAACCAGGTTTGCTCCTTGATGAATGCAGAGGGTGCTG
      AsCATATACTCCGACGACAAGATGCTTTCTTGAATCCGCACTTGGG
      AsCATBAGTGGATTCCAGGGACAGTGGACCATCGATGCAGATCACG
      AsCATCCCTGGCTGCTTGAAGTTGTTACTTCCCGTCCAGGTTTGAT
      AsPerox4GATGTTGCCCATCTTGACCAACTACAGCAACCTCCTGTCC
      AsAPX1CTCCTACGCCGATCTCTACCTGCCGAAGACTTGCCTTAGA
      AsAPX2GGAGAGAGGACAAGCCTGAGAAACCCATCTGAGCGGAGAA
      AsAPX3TACATCGCGGAGATCGAGAGGATCTTGAGCCCTGCATTGG
      AsAPX4CTGCAACTACTCCAGCAAGCCACAAGAACTGGTGGTGCAA
      AsAPX5GCGGCTTAGTCAAGGAGTTGCGACGAGATGGTCTCTGACA
      AsAPX6CAAGTCTCTGCATGGAACGGCCATACTTTGCTGCTGCCAT
      AsAPX8TCCTTGTCATCAAGGCCCATCACAGCTCCTGAGCAATGTC
      AsDHARTGCGTGAACTCTATCGCTCTGAGCGTGCAGCTCCATTATT
      AsGR1TCCTCCGCAGTCCACATATCGTTAGGGTTTGGAGGGTGGT
      AsGR2CACACGGCGAAACACATACTAGAATCACAGCACGTTTCGG
      AsMDHARGCACGTACTGGGTCAAAGACTTCATATGTTGGCGGCGAAG
      ACT2CCTTTTCCAGCCATCTTTCAGAGGTCCTTCCTGATATCCA

      Table 1. 

      Primer sequences used in the experiment.