Search
2023 Volume 3
Article Contents
ARTICLE   Open Access    

Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass

More Information
  • As an effective plant growth regulator, chitosan plays a positive role in enhancing heat tolerance in perennial turfgrass. The objective of this study was to elucidate whether chitosan-promoted thermotolerance was associated with the antioxidant defense system under long-term heat stress in creeping bentgrass (Agrostis stolonifera). Plants were treated with or without 100 mg∙L−1 chitosan under either heat stress (38/28 °C, day/night) or non-stressed condition (25/20 °C, day/night) for 42 d in growth chambers. Foliar application of chitosan significantly enhanced heat tolerance as reflected by the increased turf quality through inhibiting over-accumulation of reactive oxygen species, and increasing ascorbic acid content and antioxidant enzymes activities (peroxidase, POD; ascorbate peroxidase, APX; glutathione reductase, GR; dehydroascorbate reductase, DHAR). Chitosan-treated plants also had higher transcript levels of AsCu/ZnSOD, AsCATB, AsPerox4, AsAPX2, AsAPX3, AsAPX4, AsAPX6, AsAPX8, AsGR2, and AsDHAR genes in comparison to the untreated plants. The results suggested that chitosan-promotion in heat tolerance could be associated with non-enzymatic antioxidants, antioxidant enzymes, as well as relative gene expression.
  • 加载中
  • [1]

    Fan J, Zhang W, Amombo E, Hu L, Kjorven JO, et al. 2020. Mechanisms of environmental stress tolerance in turfgrass. Agronomy 10:522

    doi: 10.3390/agronomy10040522

    CrossRef   Google Scholar

    [2]

    Abraham EM, Meyer WA, Bonos SA, Huang B. 2008. Differential responses of hybrid bluegrass and Kentucky bluegrass to drought and heat stress. HortScience 43:2191−95

    doi: 10.21273/HORTSCI.43.7.2191

    CrossRef   Google Scholar

    [3]

    Xu S, Li J, Zhang X, Wei H, Cui L. 2006. Effects of heat acclimation pretreatment on changes of membrane lipid peroxidation, antioxidant metabolites, and ultrastructure of chloroplasts in two cool-season turfgrass species under heat stress. Environmental and Experimental Botany 56:274−85

    doi: 10.1016/j.envexpbot.2005.03.002

    CrossRef   Google Scholar

    [4]

    Li J, Zhao S, Yu X, Du W, Li H, et al. 2021. Role of Xanthoceras sorbifolium MYB44 in tolerance to combined drought and heat stress via modulation of stomatal closure and ROS homeostasis. Plant Physiology and Biochemistry 162:410−20

    doi: 10.1016/j.plaphy.2021.03.007

    CrossRef   Google Scholar

    [5]

    Hasanuzzaman M, Bhuyan MHMB, Zulfiqar F, Raza A, Mohsin SM, et al. 2020. Reactive oxygen species and antioxidant defense in plants under abiotic stress: revisiting the crucial role of a universal defense regulator. Antioxidants 9:681

    doi: 10.3390/antiox9080681

    CrossRef   Google Scholar

    [6]

    Raja V, Majeed U, Kang H, Andrabi KI, John R. 2017. Abiotic stress: interplay between ROS, hormones and MAPKs. Environmental and Experimental Botany 137:142−57

    doi: 10.1016/j.envexpbot.2017.02.010

    CrossRef   Google Scholar

    [7]

    Nadarajah KK. 2020. ROS homeostasis in abiotic stress tolerance in plants. International Journal of Molecular Sciences 21:5208

    doi: 10.3390/ijms21155208

    CrossRef   Google Scholar

    [8]

    Sheikh Mohammadi MH, Etemadi N, Arab MM, Aalifar M, Arab M, et al. 2017. Molecular and physiological responses of Iranian perennial ryegrass as affected by trinexapac ethyl, paclobutrazol and abscisic acid under drought stress. Plant Physiology and Biochemistry 111:129−43

    doi: 10.1016/j.plaphy.2016.11.014

    CrossRef   Google Scholar

    [9]

    Gill SS, Tuteja N. 2010. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry 48:909−30

    doi: 10.1016/j.plaphy.2010.08.016

    CrossRef   Google Scholar

    [10]

    Mittler R, Vanderauwera S, Gollery M, Van Breusegem F. 2004. Reactive oxygen gene network of plants. Trends in Plant Science 9:490−98

    doi: 10.1016/j.tplants.2004.08.009

    CrossRef   Google Scholar

    [11]

    Racchi ML. 2013. Antioxidant defenses in plants with attention to Prunus and Citrus spp. Antioxidants 2:340−69

    doi: 10.3390/antiox2040340

    CrossRef   Google Scholar

    [12]

    Alscher RG, Erturk N, Heath LS. 2002. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. Journal of Experimental Botany 53:1331−41

    doi: 10.1093/jexbot/53.372.1331

    CrossRef   Google Scholar

    [13]

    Mittler R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science 7:405−10

    doi: 10.1016/S1360-1385(02)02312-9

    CrossRef   Google Scholar

    [14]

    Jimenez A, Hernandez JA, del Rio LA, Sevilla F. 1997. Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea leaves. Plant Physiology 114:275−84

    doi: 10.1104/pp.114.1.275

    CrossRef   Google Scholar

    [15]

    Tripathi DK, Mishra RK, Singh S, Singh S, Vishwakarma K, et al. 2017. Nitric oxide ameliorates zinc oxide nanoparticles phytotoxicity in wheat seedlings: implication of the ascorbate-glutathione cycle. Frontiers in Plant Science 8:1

    doi: 10.3389/fpls.2017.00001

    CrossRef   Google Scholar

    [16]

    Soliman WS, Fujimori M, Tase K, Sugiyama SI. 2011. Oxidative stress and physiological damage under prolonged heat stress in C3 grass Lolium perenne. Grassland Science 57:101−6

    doi: 10.1111/j.1744-697X.2011.00214.x

    CrossRef   Google Scholar

    [17]

    Soliman WS, Fujimori M, Tase K, Sugiyama SI. 2012. Heat tolerance and suppression of oxidative stress: comparative analysis of 25 cultivars of the C3 grass Lolium perenne. Environmental and Experimental Botany 78:10−17

    doi: 10.1016/j.envexpbot.2011.12.013

    CrossRef   Google Scholar

    [18]

    Xu Y, Xu Q, Huang B. 2015. Ascorbic acid mitigation of water stress-inhibition of root growth in association with oxidative defense in tall fescue (Festuca arundinacea Schreb. ). Frontiers in Plant Science 6:807

    doi: 10.3389/fpls.2015.00807

    CrossRef   Google Scholar

    [19]

    Li Z, Peng Y, Huang B. 2018. Alteration of transcripts of stress-protective genes and transcriptional factors by γ-aminobutyric acid (GABA) associated with improved heat and drought tolerance in creeping bentgrass (Agrostis stolonifera). International Journal of Molecular Sciences 19:1623

    doi: 10.3390/ijms19061623

    CrossRef   Google Scholar

    [20]

    Liu X, Huang B. 2003. Mowing height effects on summer turf growth and physiological activities for two creeping bentgrass cultivars. HortScience 38:444−48

    doi: 10.21273/HORTSCI.38.3.444

    CrossRef   Google Scholar

    [21]

    Liu X, Huang B. 2001. Seasonal changes and cultivar difference in turf quality, photosynthesis, and respiration of creeping bentgrass. HortScience 36:1131−35

    doi: 10.21273/HORTSCI.36.6.1131

    CrossRef   Google Scholar

    [22]

    Rossi S, Chapman C, Huang B. 2020. Suppression of heat-induced leaf senescence by γ-aminobutyric acid, proline, and ammonium nitrate through regulation of chlorophyll degradation in creeping bentgrass. Environmental and Experimental Botany 177:104−16

    doi: 10.1016/j.envexpbot.2020.104116

    CrossRef   Google Scholar

    [23]

    Rossi S, Chapman C, Yuan B, Huang B. 2021. Improved heat tolerance in creeping bentgrass by γ-aminobutyric acid, proline, and inorganic nitrogen associated with differential regulation of amino acid metabolism. Plant Growth Regulation 93:231−42

    doi: 10.1007/s10725-020-00681-6

    CrossRef   Google Scholar

    [24]

    Ali EF, El-Shehawi AM, Ibrahim OHM, Abdul-Hafeez EY, Moussa MM, et al. 2021. A vital role of chitosan nanoparticles in improvisation the drought stress tolerance in Catharanthus roseus (L. ) through biochemical and gene expression modulation. Plant Physiology and Biochemistry 161:166−75

    doi: 10.1016/j.plaphy.2021.02.008

    CrossRef   Google Scholar

    [25]

    Kurita K. 2006. Chitin and chitosan: functional biopolymers from marine crustaceans. Marine Biotechnology 8:203−26

    doi: 10.1007/s10126-005-0097-5

    CrossRef   Google Scholar

    [26]

    Rabêlo VM, Magalhães PC, Bressanin LA, Carvalho DT, Reis COD, et al. 2019. The foliar application of a mixture of semisynthetic chitosan derivatives induces tolerance to water deficit in maize, improving the antioxidant system and increasing photosynthesis and grain yield. Scientific Reports 9:8164

    doi: 10.1038/s41598-019-44649-7

    CrossRef   Google Scholar

    [27]

    Turk H. 2019. Chitosan-induced enhanced expression and activation of alternative oxidase confer tolerance to salt stress in maize seedlings. Plant Physiology and Biochemistry 141:415−22

    doi: 10.1016/j.plaphy.2019.06.025

    CrossRef   Google Scholar

    [28]

    Zhang Y, Li Z, Li Y, Zhang X, Ma X, et al. 2018. Chitosan and spermine enhance drought resistance in white clover, associated with changes in endogenous phytohormones and polyamines, and antioxidant metabolism. Functional Plant Biology 45:1205−22

    doi: 10.1071/FP18012

    CrossRef   Google Scholar

    [29]

    Hao T, Yang Z, Liang J, Yu J, Liu J. 2023. Foliar application of carnosine and chitosan improving drought tolerance in bermudagrass. Agronomy 13:442

    doi: 10.3390/agronomy13020442

    CrossRef   Google Scholar

    [30]

    Liu Z, Liu T, Liang L, Li Z, Hassan MJ, et al. 2020. Enhanced photosynthesis, carbohydrates, and energy metabolism associated with chitosan-induced drought tolerance in creeping bentgrass. Crop Science 60:1064−76

    doi: 10.1002/csc2.20026

    CrossRef   Google Scholar

    [31]

    Seon Sim H, Su Jo J, Jeong Woo U, Jun Jo W, Hyun Moon Y, et al. 2022. Abscisic acid, carbohydrate, and glucosinolate metabolite profiles in kimchi cabbage treated with extremely high temperatures and chitosan foliar application. Scientia Horticulturae 304:111311

    doi: 10.1016/j.scienta.2022.111311

    CrossRef   Google Scholar

    [32]

    Shakoor A, Saleem MF, Sarwar M, Zia Ul Haq M. 2023. Exogenous application of chitosan mediated biochemical, phenological, quality, and yield attributes of heat-stressed cotton (Gossypium hirsutum L.). Gesunde Pflanzen

    doi: 10.1007/s10343-023-00832-5

    CrossRef   Google Scholar

    [33]

    Huang C, Tian Y, Zhang B, Hassan MJ, Li Z, et al. 2021. Chitosan (CTS) alleviates heat-induced leaf senescence in creeping bentgrass by regulating chlorophyll metabolism, antioxidant defense, and the heat shock pathway. Molecules 26:5337

    doi: 10.3390/molecules26175337

    CrossRef   Google Scholar

    [34]

    Li Q, Li R, He F, Yang Z, Yu J. 2022. Growth and physiological effects of chitosan on heat tolerance in creeping bentgrass (Agrostis stolonifera). Grass Research 2:6

    doi: 10.48130/GR-2022-0006

    CrossRef   Google Scholar

    [35]

    Qian YL, Engelke MC, Foster MJV, Reynolds S. 1998. Trinexapac-ethyl restricts shoot growth and improves quality of `Diamond' zoysiagrass under shade. HortScience 33:1019−22

    doi: 10.21273/HORTSCI.33.6.1019

    CrossRef   Google Scholar

    [36]

    Zhang J, Kirkham MB. 1996. Antioxidant responses to drought in sunflower and sorghum seedlings. New Phytologist 132:361−73

    doi: 10.1111/j.1469-8137.1996.tb01856.x

    CrossRef   Google Scholar

    [37]

    Bian S, Jiang Y. 2009. Reactive oxygen species, antioxidant enzyme activities and gene expression patterns in leaves and roots of Kentucky bluegrass in response to drought stress and recovery. Scientia Horticulturae 120:264−70

    doi: 10.1016/j.scienta.2008.10.014

    CrossRef   Google Scholar

    [38]

    Bradford, MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72:248−54

    doi: 10.1016/0003-2697(76)90527-3

    CrossRef   Google Scholar

    [39]

    Xu Y, Burgess P, Huang B. 2015. Root antioxidant mechanisms in relation to root thermotolerance in perennial grass species contrasting in heat tolerance. PLoS One 10:e138268

    doi: 10.1371/journal.pone.0138268

    CrossRef   Google Scholar

    [40]

    Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3:1101−08

    doi: 10.1038/nprot.2008.73

    CrossRef   Google Scholar

    [41]

    Zhang X, Ervin EH. 2008. Impact of seaweed extract−based cytokinins and zeatin riboside on creeping bentgrass heat tolerance. Crop Science 48:364−70

    doi: 10.2135/cropsci2007.05.0262

    CrossRef   Google Scholar

    [42]

    Larkindale J, Huang B. 2005. Effects of abscisic acid, salicylic acid, ethylene and hydrogen peroxide in thermotolerance and recovery for creeping bentgrass. Plant Growth Regulation 47:17−28

    doi: 10.1007/s10725-005-1536-z

    CrossRef   Google Scholar

    [43]

    Pantoja-Benavides AD, Garces-Varon G, Restrepo-Díaz H. 2021. Foliar growth regulator sprays induced tolerance to combined heat stress by enhancing physiological and biochemical responses in rice. Frontiers in Plant Science 12:702892

    doi: 10.3389/fpls.2021.702892

    CrossRef   Google Scholar

    [44]

    Chalanika De Silva HC, Asaeda T. 2017. Effects of heat stress on growth, photosynthetic pigments, oxidative damage and competitive capacity of three submerged macrophytes. Journal of Plant Interactions 12:228−36

    doi: 10.1080/17429145.2017.1322153

    CrossRef   Google Scholar

    [45]

    Jiang Y, Huang B. 2001. Drought and heat stress injury to two cool-season turfgrasses in relation to antioxidant metabolism and lipid peroxidation. Crop Science 41:436−42

    doi: 10.2135/cropsci2001.412436x

    CrossRef   Google Scholar

    [46]

    Jahan MS, Shu S, Wang Y, Chen Z, He M, et al. 2019. Melatonin alleviates heat-induced damage of tomato seedlings by balancing redox homeostasis and modulating polyamine and nitric oxide biosynthesis. BMC Plant Biology 19:414

    doi: 10.1186/s12870-019-1992-7

    CrossRef   Google Scholar

    [47]

    Katuwal KB, Rowe S, Jespersen D. 2021. The use of 5-aminolevulinic acid to reduce heat-stress-related damages in tall fescue. Crop Science 61:3206−18

    doi: 10.1002/csc2.20294

    CrossRef   Google Scholar

    [48]

    Khanna-Chopra R, Chauhan S. 2015. Wheat cultivars differing in heat tolerance show a differential response to oxidative stress during monocarpic senescence under high temperature stress. Protoplasma 252:1241−51

    doi: 10.1007/s00709-015-0755-z

    CrossRef   Google Scholar

    [49]

    Li C, Ma M, Zhang T, Feng P, Chen X, et al. 2021. Comparison of photosynthetic activity and heat tolerance between near isogenic lines of wheat with different photosynthetic rates. PLoS One 16:e0255896

    doi: 10.1371/journal.pone.0255896

    CrossRef   Google Scholar

    [50]

    Zhang L, Hu T, Amombo E, Wang G, Xie Y, et al. 2017. The alleviation of heat damage to photosystem II and enzymatic antioxidants by exogenous spermidine in tall fescue. Frontiers in Plant Science 8:1747

    doi: 10.3389/fpls.2017.01747

    CrossRef   Google Scholar

    [51]

    Zhang J, Xing J, Lu Q, Yu G, Xu B, et al. 2019. Transcriptional regulation of chlorophyll-catabolic genes associated with exogenous chemical effects and genotypic variations in heat-induced leaf senescence for perennial ryegrass. Environmental and Experimental Botany 167:103858

    doi: 10.1016/j.envexpbot.2019.103858

    CrossRef   Google Scholar

    [52]

    Su Y, Huang Y, Dong X, Wang R, Tang M, et al. 2021. Exogenous methyl jasmonate improves heat tolerance of perennial ryegrass through alteration of osmotic adjustment, antioxidant defense, and expression of jasmonic acid-responsive genes. Frontiers in Plant Science 12:664519

    doi: 10.3389/fpls.2021.664519

    CrossRef   Google Scholar

    [53]

    Hu L, Bi A, Hu Z, Amombo E, Li H, et al. 2018. Antioxidant metabolism, photosystem II, and fatty acid composition of two tall fescue genotypes with different heat tolerance under high temperature stress. Frontiers in Plant Science 9:1242

    doi: 10.3389/fpls.2018.01242

    CrossRef   Google Scholar

    [54]

    Hasanuzzaman M, Bhuyan MHMB, Anee TI, Parvin K, Nahar K, et al. 2019. Regulation of ascorbate-glutathione pathway in mitigating oxidative damage in plants under abiotic stress. Antioxidants 8:384

    doi: 10.3390/antiox8090384

    CrossRef   Google Scholar

    [55]

    Li C, Han Y, Hao J, Qin X, Liu C, et al. 2020. Effects of exogenous spermidine on antioxidants and glyoxalase system of lettuce seedlings under high temperature. Plant Signaling & Behavior 15:1824697

    doi: 10.1080/15592324.2020.1824697

    CrossRef   Google Scholar

    [56]

    Buttar ZA, Wu S, Arnao MB, Wang C, Ullah I, et al. 2020. Melatonin suppressed the heat stress-induced damage in wheat seedlings by modulating the antioxidant machinery. Plants 9:809

    doi: 10.3390/plants9070809

    CrossRef   Google Scholar

    [57]

    Xu Q, Huang B. 2004. Antioxidant metabolism associated with summer leaf senescence and turf quality decline for creeping bentgrass. Crop Science 44:553−60

    doi: 10.2135/cropsci2004.5530

    CrossRef   Google Scholar

    [58]

    Lin KH, Huang HC, Lin CY. 2010. Cloning, expression and physiological analysis of broccoli catalase gene and Chinese cabbage ascorbate peroxidase gene under heat stress. Plant Cell Reports 29:575−93

    doi: 10.1007/s00299-010-0846-4

    CrossRef   Google Scholar

    [59]

    Du H, Zhou P, Huang B. 2013. Antioxidant enzymatic activities and gene expression associated with heat tolerance in a cool-season perennial grass species. Environmental and Experimental Botany 87:159−66

    doi: 10.1016/j.envexpbot.2012.09.009

    CrossRef   Google Scholar

  • Cite this article

    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007
    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007

Figures(9)  /  Tables(1)

Article Metrics

Article views(3814) PDF downloads(443)

ARTICLE   Open Access    

Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass

Grass Research  3 Article number: 7  (2023)  |  Cite this article

Abstract: As an effective plant growth regulator, chitosan plays a positive role in enhancing heat tolerance in perennial turfgrass. The objective of this study was to elucidate whether chitosan-promoted thermotolerance was associated with the antioxidant defense system under long-term heat stress in creeping bentgrass (Agrostis stolonifera). Plants were treated with or without 100 mg∙L−1 chitosan under either heat stress (38/28 °C, day/night) or non-stressed condition (25/20 °C, day/night) for 42 d in growth chambers. Foliar application of chitosan significantly enhanced heat tolerance as reflected by the increased turf quality through inhibiting over-accumulation of reactive oxygen species, and increasing ascorbic acid content and antioxidant enzymes activities (peroxidase, POD; ascorbate peroxidase, APX; glutathione reductase, GR; dehydroascorbate reductase, DHAR). Chitosan-treated plants also had higher transcript levels of AsCu/ZnSOD, AsCATB, AsPerox4, AsAPX2, AsAPX3, AsAPX4, AsAPX6, AsAPX8, AsGR2, and AsDHAR genes in comparison to the untreated plants. The results suggested that chitosan-promotion in heat tolerance could be associated with non-enzymatic antioxidants, antioxidant enzymes, as well as relative gene expression.

    • Heat stress is one of the crucial environmental stresses limiting plant growth and development, and ultimately influencing productivity and quality of many plants including turfgrass species[1, 2]. Under heat stress, the unfavorable disorders in fundamental metabolic processes often occur in turfgrass species, such as disturbance in homeostasis of reactive oxygen species (ROS)[3, 4]. ROS are the by-products of enzymatic reactions, including superoxide anion (${\text{O}^-_2} $), hydroxyl radical (•OH), and hydrogen peroxide (H2O2)[5]. Numerous evidence revealed that abiotic stress triggered overproduction of ROS, which would lead to oxidative damage on nucleic acids, proteins, lipids, and carbohydrates in various plants[68].

      In order to resist oxidative injuries, plants have evolved a complex antioxidant defense system to scavenge and detoxify the excessive accumulation of ROS to maintain the relative steady balance between generation and elimination of ROS. The defense mechanism is composed of both non-enzymatic and enzymatic systems[9]. Non-enzymatic systems (ascorbic acid, glutathione, and nonprotein amino acids, etc.) are one of an important component of antioxidant defense systems[10]. Acting as electron donors, antioxidants directly or indirectly transform toxic ROS into less harmful oxidized products, and modulate redox homeostasis[11]. Enzymatic system involves several antioxidant enzymes, including superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), glutathione reductase (GR), and ascorbate peroxidase (APX)[9]. The first line of defense in ROS-scavenging enzyme is SOD that catalyzes O2 to H2O2 and molecular oxygen (O2)[11]. Based on different metal co-factors, SOD could be distinguished into three classes including Cu/ZnSOD, MnSOD, and FeSOD, which have various subcellular localization[12]. CAT, POD, and the ascorbate-glutathione cycle further convert H2O2 into H2O and O2[13]. Ascorbate-glutathione cycle including two antioxidants (ascorbic acid and glutathione), as well as four important enzymes (APX, GR, DHAR, and MDHAR), plays a key role in detoxifying the excess H2O2[14, 15]. However, redox homeostasis is still destroyed when plants are exposed to prolonged heat stress[16, 17]. Therefore, maintaining the stability of antioxidant defense system is essential for enhancing heat tolerance in plants, especially in cool-season grass species[18, 19].

      As a cool-season turfgrass, creeping bentgrass (Agrostis stolonifera) is widely used in golf greens and other high-quality turfs due to its fine texture and superior tolerance to low mowing height[20]. However, creeping bentgrass is sensitive to heat stress, and likely to be injured by heat stress during the summer season[21, 22]. Thus, it is an urgent need for turf managers to promote heat tolerance in creeping bentgrass. Previous studies have demonstrated that foliar application of plant growth regulators was an effective and convenient strategy to alleviate stress-induced damages[23, 24]. Chitosan is a natural, biocompatible, and biodegradable polysaccharide produced from chitin[25]. Chitosan has nucleophilic behavior, which allows it to form multifunction via structural chemical modifications[26]. Exogenous chitosan with the appropriate concentration and method could greatly mitigate harmful effects of abiotic stresses on plants. Under salt stress, chitosan application led to a significant improvement in salt tolerance through promoting plant growth, and enhancing the expression and activation of alternative oxidase in maize (Zea mays) seedlings[27]. Under drought stress, chitosan effectively alleviated drought stress in association with the altered antioxidant metabolism and various metabolic processes in white clover (Trifolium repens)[28], bermudagrass (Cynodon transvaalensis × C. dactylon)[29], and creeping bentgrass[30]. Under heat stress, foliar application of 200 and 800 mg∙L−1 chitosan had positive effect on mitigating heat damage in kimchi cabbage (Brassica rapa ssp. Pekinensis)[31] and cotton (Gossypium hirsutum)[32], respectively. Exogenous 100 mg∙L−1 chitosan also improved heat tolerance in creeping bentgrass through regulating chlorophyll metabolism, antioxidant defense, and the heat shock pathway[33]. In our previous study, foliar application of chitosan significantly enhanced heat tolerance in creeping bentgrass by inhibiting the decline in photosynthesis and maintaining cell membrane stability[34]. Despite present knowledge, chitosan-induced regulating mechanism on antioxidant defense system has not been well understood in creeping bentgrass under heat stress. Therefore, the objective of this study was to elucidate whether chitosan-promoted thermotolerance associated with the antioxidant defense system under long-term heat stress, including the content of antioxidants, activities of antioxidant enzymes, as well as the expression level of genes encoding antioxidant enzymes. Our findings would be expected to provide a new understanding for chitosan-induced promotion on heat tolerance in perennial turfgrass species.

    • Creeping bentgrass seeds (A. stolonifera cv. 'Penn A-4') were sown in polyvinyl chloride tubes (25-cm height and 10-cm diameter) filled with sand. Plants were grown for 2 months in a greenhouse at 25/20 °C (day/night) and 14 h photoperiod[34]. During establishment, plants were irrigated daily, fertilized once a week with water-soluble fertilizer (Scotts Miracle-Gro Company, USA), and trimmed every 2 d in order to maintain a canopy height of 4−5 cm. Plants were moved to a growth chamber (XBQH-1, Jinan Xubang, Jinan, Shandong Province, China) with temperature of 25/20 °C (day/night), 14 h photoperiod, and 60% relative humidity. Plants were pre-acclimated to the environment of growth chambers for one week before treatments.

    • After acclimation, the two-month-old plants were divided into four groups as four treatments: (1) control + H2O, foliar application with 10 mL deionized water under non-stressed condition (25/20 °C, day/night); (2) control + chitosan, foliar application with 10 mL chitosan under non-stressed condition (25/20 °C, day/night); (3) heat + H2O, foliar application with 10 mL deionized water under heat stress (38/28 °C, day/night); (4) heat + chitosan, foliar application with 10 mL chitosan under heat stress (38/28 °C, day/night). During 42 d of treatments, plants were sprayed with either deionized water or chitosan every 7 d. For chitosan treatment, chitosan concentration was set as 100 mg∙L−1 based on our previous study in creeping bentgrass[34]. This experiment was arranged in a completely randomized design with four biological replicates (four tubes) for each treatment. Each tube was rearranged daily to reduce impacts of the environment.

    • Turf quality is a common parameter of overall turf performance rated on a scale of 1 (lowest) to 9 (best) based on texture, color, uniformity, and density[35]. A rating of 1 represented plants that were completely dead with brown leaves, and a rating of 9 indicated plants that were healthy with green and dense turf canopy. Turf quality at the minimal acceptable level was rated a 6.

      The presence of hydrogen peroxide (H2O2) and superoxide (${\text{O}^-_2} $) at 0, 21, and 42 d of treatments were detected based on the method documented by Xu et al.[18] with some modifications. Histochemical staining for H2O2 was used 1% (w/v) 3,3-diaminobenzidine (DAB) in 50 mM Tris-HCl buffer (pH 7.5). Staining of ${\text{O}^-_2} $ was used 0.5% (w/v) nitro blue tetrazolium (NBT) in 25 mM HEPES buffer (pH 7.6). All leaves were stained for 16 h at room temperature in darkness. Then, the staining solution was discarded, 85% ethanol was added, and incubated at 85 °C until leaf chlorophyll was dissolved completely. The DAB- or NBT-stained leaves were rinsed with deionized water.

    • Glutathione content and ascorbic acid content in leaves of creeping bentgrass at 0, 21, and 42 d of treatments were determined using kits (Nanjing Yurun Biotechnology Co., Ltd., Jiangsu, China; Suzhou Comin Biotechnology Co., Ltd., Jiangsu, China). Antioxidant enzyme activity in leaves was measured using the previously described method[36, 37] with some modifications. Fresh leaf tissues (0.35 g) at 0, 21, and 42 d of treatments were sampled, then stored at −80 °C to conduct further analysis. Leaves were ground with liquid nitrogen to a fine powder, then extracted with 4 mL of cold extraction buffer (50 mM potassium phosphate, 1 mM ethylenediaminetetraacetic acid, 1% polyvinylpyrrolidone, pH 7.8). The extraction solution was centrifuged at 15,000 g for 30 min at 4 °C and the supernatant was collected for determination of antioxidant enzyme activity. SOD activity was determined based on the rate of NBT reduction in absorbance at 560 nm. CAT, POD, APX, DHAR, MDHAR, and GR activities were assayed following the increase or decrease in absorbance at 240, 470, 290, 265, 340, and 340 nm, respectively. All enzyme activities were determined using a spectrophotometer (Ultrospec 2100 pro, Biochrom Ltd., Cambridge, UK) and expressed on the basis of protein content, which was measured according to Bradford's method[38].

    • The transcription levels of selected gene encoding antioxidant enzyme in leave tissue at 0, 21, and 42 d of treatments were detected by real-time quantitative polymerase chain reaction (qRT-PCR). Total RNA was isolated from leaves with using a FlaPure Plant Total RNA Extraction Kit (Genesand, Beijing, China) according to the manufacturer’s instructions. Determination in RNA concentration was conducted by Tecan Infinite 200 pro (Grödig, Austria). The RNA was reverse-transcribed to cDNA by using MonScript™ RTIII Super Mix with dsDNase (Two-Step) (Monad, Wuhan, China).

      For detecting transcript levels of genes in heat-treated and chitosan-treated conditions, Roche LightCycler480 II machine (Roche Diagnostic, Rotkreuz, Switzerland) and MonAmp™ ChemoHS qPCR Mix (Monad, Wuhan, China) were used for performing qRT-PCR. Primer sequences of SOD (AsFeSOD, AsCu/ZnSOD, AsMnSOD), CAT (AsCATA, AsCATB, AsCATC), POD (AsPerox4), APX (AsAPX1, AsAPX2, AsAPX3, AsAPX4, AsAPX5, AsAPX6, AsAPX8), GR (AsGR1, AsGR2), DHAR (AsDHAR), MDHAR (AsMDHAR) genes, and reference gene (ACT2) are provided in Table 1[39]. The specificity of each primer pair was confirmed by analyzing melting curve in qRT-PCR. PCR condition for all genes was set on the basis of the following parameters: 95 °C at 10 min, 15 s at 95 °C (40 cycles of denaturation), annealing for 15 s at 60 °C, and extending for 20 s at 72 °C. The relative expression level between interest genes and reference gene was to calculate according to 2−ΔΔCᴛ method[40].

      Table 1.  Primer sequences used in the experiment.

      Gene nameForward primer (5’-3’)Reverse primer (5’-3’)
      AsFeSODTGCTCGTCTGTCATCCTTGTGGTTGGGTTTGGCTTGTCTT
      AsCu/ZnSODAATGTGACAGCTGGAGTGGACCCTTGCCAAGATCATCAGC
      AsMnSODAGGAACCAGGTTTGCTCCTTGATGAATGCAGAGGGTGCTG
      AsCATATACTCCGACGACAAGATGCTTTCTTGAATCCGCACTTGGG
      AsCATBAGTGGATTCCAGGGACAGTGGACCATCGATGCAGATCACG
      AsCATCCCTGGCTGCTTGAAGTTGTTACTTCCCGTCCAGGTTTGAT
      AsPerox4GATGTTGCCCATCTTGACCAACTACAGCAACCTCCTGTCC
      AsAPX1CTCCTACGCCGATCTCTACCTGCCGAAGACTTGCCTTAGA
      AsAPX2GGAGAGAGGACAAGCCTGAGAAACCCATCTGAGCGGAGAA
      AsAPX3TACATCGCGGAGATCGAGAGGATCTTGAGCCCTGCATTGG
      AsAPX4CTGCAACTACTCCAGCAAGCCACAAGAACTGGTGGTGCAA
      AsAPX5GCGGCTTAGTCAAGGAGTTGCGACGAGATGGTCTCTGACA
      AsAPX6CAAGTCTCTGCATGGAACGGCCATACTTTGCTGCTGCCAT
      AsAPX8TCCTTGTCATCAAGGCCCATCACAGCTCCTGAGCAATGTC
      AsDHARTGCGTGAACTCTATCGCTCTGAGCGTGCAGCTCCATTATT
      AsGR1TCCTCCGCAGTCCACATATCGTTAGGGTTTGGAGGGTGGT
      AsGR2CACACGGCGAAACACATACTAGAATCACAGCACGTTTCGG
      AsMDHARGCACGTACTGGGTCAAAGACTTCATATGTTGGCGGCGAAG
      ACT2CCTTTTCCAGCCATCTTTCAGAGGTCCTTCCTGATATCCA
    • Data were analyzed using the SPSS statistics software (SPSS 21.0; SPSS Inc., Chicago, IL, USA). The means ± standard error (SE) was calculated for all measured parameters in column charts. ANOVA analysis and Duncan multiple comparison were applied to determine significant differences between mean values for each parameter at the probability level of 0.05.

    • Heat stress led to a significant decrease in turf quality at 21 and 42 d of treatments, and increased accumulation of both H2O2 and ${\text{O}^-_2} $ as reflected by the darker color in leaves of creeping bentgrass at 42 d of treatments compared with non-stressed control regardless of chitosan application (Figs 1 & 2). Chitosan-treated plants kept better shoot phenotype and showed 1.2-fold increase in turf quality than untreated plants at 42 d of heat stress (Fig. 1a, b). Exogenous chitosan played a positive effect on decreasing the accumulation of both H2O2 and ${\text{O}^-_2} $ under 42 d of heat stress (Fig. 2a, b).

      Figure 1. 

      Effects of heat stress and exogenous chitosan on (a) turf quality and (b) shoot phenotype in creeping bentgrass exposed to non-stressed control and heat stress. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Shoot phenotype was taken at 42 d of treatments. Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Figure 2. 

      Effects of heat stress and exogenous chitosan on staining of (a) hydrogen peroxide and (b) superoxide in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night).

    • At 21 and 42 d under heat stress, chitosan-treated plants had 54% and 32% higher ascorbic acid content than untreated plants, respectively (Fig. 3a). Plants with or without chitosan under heat stress exhibited an obviously decrease in glutathione content at 21 and 42 d compared with non-stressed control (Fig. 3b). Chitosan-treated plants had higher glutathione content than untreated plants at 21 d of heat stress, but were not observed the significant difference in glutathione content at 42 d of heat treatment.

      Figure 3. 

      Effects of heat stress and exogenous chitosan on content of (a) ascorbic acid and (b) glutathione in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • At 21 d of non-stressed treatment, exogenous chitosan caused 38% and 48% significant increase in activities of SOD and POD, respectively, compared with untreated plants (Fig. 4a, c). At 21 d of treatments, heat stress significantly decreased POD activity compared with plants under non-stressed condition (Fig. 4c). At 42 d, activities of SOD, CAT, and POD increased significantly in response to heat stress compared with plants under non-stressed condition, but no significant difference in activities of SOD and CAT was found between plants with or without chitosan (Fig. 4ac). Foliar application of chitosan had 30% higher POD activity than untreated plants at 42 d of heat stress.

      Figure 4. 

      Effects of heat stress and exogenous chitosan on activities of (a) SOD, (b) CAT, and (c) POD in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      At 21 d of non-stressed condition, exogenous chitosan significantly increased APX activity compared with plants without chitosan. Chitosan-treated plants had 58% higher increase in APX activity than untreated plants at 42 d of heat stress (Fig. 5a). Heat stress significantly increased activities of both GR and DHAR compared with non-stressed control at 21 and 42 d. Plants applied with chitosan demonstrated significant enhancement in GR and DHAR activities compared with untreated plants at 42 d under heat stress (Fig. 5b, c). Exogenous chitosan significantly increased MDHAR activity by 94% compared with untreated plants at 21 d of heat stress (Fig. 5d), but there was no significant difference in MDHAR activity between chitosan-treated and untreated plants at 42 d of heat stress.

      Figure 5. 

      Effects of heat stress and exogenous chitosan on activities of (a) APX, (b) GR, (c) DHAR, and (d) MDHAR in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/2 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • The expression levels of SOD (AsFeSOD, AsCu/ZnSOD, and AsMnSOD), CAT (AsCATA, AsCATB, and AsCATC), and POD (AsPerox4) genes in leaves were measured in this experiment (Figs 6 & 7). For SOD genes, expression levels of both AsCu/ZnSOD and AsMnSOD were down-regulated and up-regulated significantly compared with non-stressed control at 21 d and 42 d, respectively (Fig. 6b, c). Chitosan-treated plants showed 1.1-fold higher expression level in AsCu/ZnSOD than untreated plants at 42 d of heat stress (Fig. 6b). At 42 d of heat stress, exogenous chitosan significantly up-regulated the expression of AsCATB by 82% compared with untreated plants, but without significant effects on AsCATA and AsCATC genes (Fig. 7ac). Chitosan-treated plants had 1.2-fold higher expression levels of AsPerox4 than that without chitosan at 42 d of heat stress (Fig. 7d).

      Figure 6. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsFeSOD, (b) AsCu/ZnSOD, and (c) AsMnSOD in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Figure 7. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsCATA, (b) AsCATB, (c) AsCATC, and (d) AsPerox4 in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      The transcript levels of APX, GR, DHAR, and MDHAR genes related to ascorbate-glutathione cycle were also quantified (Figs 8 & 9). Under normal condition, exogenous chitosan significantly up-regulated AsAPX1 compared with untreated plants at 21 and 42 d. The expression level of AsAPX1 in chitosan-treated plants also higher than untreated plants at 21 d of heat stress (Fig. 8a). At 42 d of heat stress, expressions of different APX genes were significantly up-regulated to certain extent due to foliar application of chitosan, including AsAPX2, AsAPX3, AsAPX4, AsAPX6, and AsAPX8, which demonstrated 1.4-fold, 1.2-fold, 1.0-fold, 0.8-fold, and 1.1-fold higher than untreated plants, respectively (Fig. 8bd, f, g). At 42 d of treatments, transcript levels of both AsGR1 and AsMDHAR were significantly up-regulated compared with non-stressed control in response to heat stress, however, there was no significant difference in the expression of these genes between chitosan-treated and untreated plants under heat stress (Fig. 9a, d). Chitosan-treated plants showed 2.0-fold and 1.4-fold increase in expression level of both AsGR2 and AsDHAR, respectively, compared with untreated plants at 42 d of heat stress (Fig. 9b, c).

      Figure 8. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsAPX1, (b) AsAPX2, (c) AsAPX3, (d) AsAPX4, (e) AsAPX5, (f) AsAPX6, and (g) AsAPX8 in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Figure 9. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsGR1, (b) AsGR2, (c) AsDHAR, and (d) AsMDHAR in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    • It is generally known that the application of plant growth regulators is an effective method to enhance thermotolerance, which might be associated with changes in various physiological and biochemical processes under heat stress[4143]. In this study, heat stress led to serious damages in creeping bentgrass, but chitosan application induced an improvement in heat tolerance as indicated by the reduction in ROS accumulation, better maintenance in antioxidant defense system, as well as the higher gene expression compared with the untreated plants under heat stress as discussed below.

      The imbalance between the production and scavenging of ROS in heat-stressed plant resulted in oxidative stress, and influenced normal physiological activities in plants[44, 45]. Jahan et al.[46] observed a significantly increased ROS (${\text{O}^-_2} $ and H2O2) content and decreased cellular membrane integrity in tomato (Solanum lycopersicum) seedings subjected to heat stress. Thus, maintaining ROS homeostasis is an important strategy to enhance heat tolerance, which is benefitial to promote plant growth and development[47, 48]. Results in this study also showed that heat stress promoted ROS overaccumulation and decreased turf quality. Chitosan-treated plants had lower accumulation of both H2O2 and ${\text{O}^-_2} $, and superior turf quality in comparison to untreated plants under heat stress (Figs 1 & 2), which was consistent with previous report in creeping bentgrass[33]. Meanwhile, heat-induced adverse effects on cell membrane stability and photosynthesis were significantly alleviated in plants treated with exogenous chitosan according to our previous study[34]. Similar reports about better maintenance in ROS homeostasis in association with the enhancement in heat tolerance were also found in other plants, such as in wheat (Triticum aestivum)[49], tall fescue (Festuca arundinacea)[50], and perennial ryegrass (Lolium perenne)[51]. The result suggested that exogenous chitosan could contribute to the improved heat tolerance through maintaining the equilibrium between the ROS generation and elimination.

      ROS scavenging system plays a key role in mitigating the adverse effects of oxidative stress and conferring heat tolerance in turfgrass species[52, 53]. Various non-enzymatic antioxidants and antioxidant enzymes including SOD, CAT, POD, and ascorbate-glutathione cycle components (ascorbic acid, glutathione, APX, GR, DHAR, and MDHAR) functions in detoxifying the overproduction of ROS[9]. Ascorbate-glutathione cycle is also referred to as the Asada–Halliwell pathway, which is a crucial antioxidant defense pathway to detoxify H2O2 and remain redox homeostasis in plant cells[54]. In lettuce (Lactuca sativa) seedlings, exogenous spermidine positively alleviated oxidative damage via enhancing ascorbate-glutathione cycle under heat stress[55]. Antioxidant enzymes involved in ascorbate-glutathione cycle showed a significant activation due to melatonin application, mitigating heat-induced damage in wheat seedlings[56]. In the present study, heat stress induced a significant increase in multiple antioxidant enzyme activities indicating that antioxidant defense system was triggered in response to heat stress to prevent plants from severe injury. Chitosan application improved heat tolerance mainly associated with positive changes in POD activities and ascorbate-glutathione cycle, as confirmed by significantly increased ascorbic acid content, POD, APX, GR, and DHAR activities compared with untreated plant under heat stress (Figs 3, 4 & 5). Huang et al.[33] previously found that chitosan-pretreated plants had higher heat tolerance through improving activities of four antioxidant enzymes (SOD, CAT, POD, and APX) at 15 d of heat stress. But in our study, no significant difference in activities of SOD and CAT was found between plants with or without chitosan at 42 d of long-term heat stress. Generally, activities of SOD and CAT increased and then declined under heat stress[57]. The different change in activities of SOD and CAT might indicate that both enzymes played an important role in the early duration of treatments. Moreover, heat stress also induced the up-regulation in transcriptional level of antioxidant enzyme genes in order to protect cellular components against oxidative stress[58]. Li et al.[19] revealed that exogenous application of γ-aminobutyric acid up-regulated the transcript of genes encoding antioxidant enzymes (SOD, CAT, POD, APX, MDHAR, DHAR, and GR) under water deficit stress. In this study, exogenous chitosan significantly up-regulated several relative gene expressions compared with untreated plants under heat stress, including SOD (AsCu/ZnSOD), CAT (AsCATB), POD (AsPerox4), APX (AsAPX2, AsAPX3, AsAPX4, AsAPX6, and AsAPX8), GR (AsGR2), and DHAR genes (AsDHAR) (Figs 6, 7, 8&9). Results showed that exogenous chitosan induced a significant increase in POD, APX, GR, and DHAR at both enzymatic and gene expression levels under heat stress. However, antioxidant enzyme activities were regulated by multiple factors, which might lead to variations in the transcript levels of antioxidant enzymes inconsistent with antioxidant enzyme activities[59]. Therefore, in the current study, foliar application of chitosan up-regulated transcript levels of AsCu/ZnSOD and AsCATB, but did not enhance activities of SOD and CAT. Our above results indicated that chitosan-induced promotion in heat tolerance resulted from alterations in antioxidant defense system including non-enzymatic antioxidants, antioxidant enzymes, as well as relative gene expression for ROS scavenging in creeping bentgrass.

      In conclusion, exogenous chitosan significantly enhanced heat tolerance in creeping bentgrass. Chitosan-induced heat tolerance could be attributed to the less oxidative damage and better maintenance of antioxidant defense system detoxifying ROS. Foliar application of chitosan suppressed overproduction of ROS (H2O2 and O2), improved ascorbic acid content and antioxidant enzymes activities (POD, APX, GR, and DHAR), as well as up-regulated transcript levels of AsCu/ZnSOD, AsCATB, AsPerox4, AsAPX2, AsAPX4, AsAPX6, AsAPX8, AsGR2, and AsDHAR compared with untreated control. In the future, further investigating into the molecular mechanisms of chitosan in improving heat tolerance is necessary.

      • This study was supported by the Fundamental Research Funds for the Central Universities (XUEKEN2022020) and the project of the Innovation and Promotion of Forestry Science and Technology of Jiangsu Province (LYKJ[2021]29).

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2023 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (9)  Table (1) References (59)
  • About this article
    Cite this article
    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007
    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return