Iron (II)-EDTA alleviate salinity injury through regulating ion balance in halophyte seashore paspalum

Yuying Zheng; Zhihua Li; Zhiqun Tan; Yu Liu; Xiaxiang Zhang; Jun Liu; Jian Hu; Zhimin Yang; Yu Chen; Yuying Zheng; Zhihua Li; Zhiqun Tan; Yu Liu; Xiaxiang Zhang; Jun Liu; Jian Hu; Zhimin Yang; Yu Chen

doi:10.48130/grares-0024-0029

Figures (4) Tables (2)

Figure 1.
Screening of optimum concentration of iron in seashore paspalum. (a)−(g) The phenotype of different concentrations iron in seashore paspalum. (h) Indexes of relative chlorophyll content (SPAD) and photochemical efficiency (Fv/Fm). The mean value and standard error were obtained from three biological replicates of every index.
Figure 2.
The appearance and physiological indexes of seashore paspalum under different treatments. (a)−(d) The control group. (e) The treatment of 20 μM Fe (II) EDTA + 0 mM NaCl (C); (f) The treatment of 20 μM Fe (II) EDTA + 250 mM NaCl (CS); (g) The treatment of 80 μM Fe (II) EDTA + 0 mM NaCl (E); (h) The treatment of 80 μM Fe (II) EDTA + 250 mM NaCl (ES). (i)−(n) Physiological indexes of biomass, electrolyte leakage (EL), root activity, chlorophyll content, net photosynthetic rate (Pn), and leaf photochemical efficiency (Fv/Fm) successively, the mean value and standard error were obtained from 3 biological replicates of every physiological index, and the significance difference level p < 0.05.
Figure 3.
Effects of excess iron on relative expression level of PvSOS1, PvCIPK24, PvCBL4, PvHKT1, PvPHA, and PvVHA in seashore paspalum roots under salt stress. (C), 20 μM Fe (II) EDTA + 0 mM NaCl; (CS), the treatment of 20 μM Fe (II) EDTA + 250 mM NaCl; (E), the treatment of 80 μM Fe (II) EDTA + 0 mM NaCl; (ES), the treatment of 80 μM Fe (II) EDTA + 250 mM NaCl. The mean value and standard error were obtained from five biological replicates, and the significance difference level p < 0.05.
Figure 4.
Abstract figure to illustrate the result of how excess Fe improved salt tolerance under salt stress.

Gene	Primer sequences 5'-3' (RT-F/RT-R)
PvSOS1	GCTTGAAGAGGGACGAATAAA/ACGAAGAAATGCAGCACAGAT
PvCIPK24	GGCTTAATGAGGTGTTGGCTG/TGGTAAACTCCTTTGCTGTGG
PvCBL4	GCGCCGACATCAGACAAGA/CGAGCAATGCCAAGACCAT
PvPHA	CAGGAAGTACCCGAGAAATCA/CGTTAACACCAAGAACAAGAGC
PvVHA	CTCTCCTCCTGGTGGTGGTTT/CCTCACGTGCTTTTGTCCTAATAT
PvHKT1	CCATCATCTACAACATTTGTGC/TCATTTCTGAGCCTTCTCCTC
PvEF1α	GCGGACTGTGCTGTGCTTATC/AGTGGTGGCATCCATCTTGTT

Table 1.

Primers of genes used for qRT-PCR analysis.

Treatment days		0 day				10 day
Treatment days		C	CS	E	ES	C	CS	E	ES
Roots	Na/K	0.502^a	0.557^a	0.565^a	0.583^a	0.519^c	6.344^a	0.612^c	4.232^b
	K	4.634^a ± 0.079	4.524^a ± 0.121	4.341^a ± 0.097	4.569^a ± 0.174	4.236^b ± 0.160	4.040^b ± 0.079	4.677^a ± 0.126	4.631^a ± 0.079
	Na	2.324^a ± 0.092	2.517^a ± 0.050	2.450^a ± 0.099	2.648^a ± 0.101	2.198^c ± 0.100	25.622^a ± 0.327	2.856^c ± 0.391	19.561^b ± 0.816
	P	11.320^a ± 0.059	10.860^a ± 0.064	11.460^a ± 0.818	11.830^a ± 0.468	11.850^a ± 0.092	8.180^c ± 0.718	10.420^ab ± 0.501	9.140^bc ± 0.409
	Ca	7.020^a ± 0.449	7.575^a ± 0.195	7.726^a ± 0.184	7.152^a ± 0.015	7.578^b ± 0.283	7.752^b ± 0.116	7.802^b ± 0.339	9.388^a ± 0.379
	Mg	2.236^a ± 0.187	1.943^a ± 0.030	2.339^a ± 0.l82	2.169^a ± 0.099	2.129^b ± 0.040	2.041^b ± 0.003	2.355^a ± 0.054	2.448^a ± 0.068
	Mn	3.762^a ± 0.104	3.788^a ± 0.127	3.684^a ± 0.177	3.804^a ± 0.067	3.630^b ± 0.061	1.006^d ± 0.062	4.002^a ± 0.159	1.725^c ± 0.085
	Zn	0.501^a ± 0.028	0.484^a ± 0.009	0.508^a ± 0.028	0.459^a ± 0.029	0.514^a ± 0.010	0.403^bc ± 0.045	0.464^ab ± 0.018	0.368^c ± 0.011
	Fe	0.0252^a ± 0.0016	0.0247^a ± 0.0018	0.0247^a ± 0.0017	0.0272^a ± 0.0015	0.0240^bc ± 0.0034	0.0174^c ± 0.0040	0.0738^a ± 0.0017	0.0307^b ± 0.0008
	Cu	0.0109^a ± 0.0011	0.0102^a ± 0.0002	0.0091^a ± 0.0007	0.0112^a ± 0.0002	0.0100^b ± 0.0004	0.0103^b ± 0.0001	0.0193^a ± 0.0024	0.0116^b ± 0.0008
Shoots	Na/K	0.011^a	0.010^a	0.009^a	0.009^a	0.007^b	0.436^a	0.007^b	0.415^a
	K	23.100^a ± 0.514	22.360^a ± 0.890	22.530^a ± 0.334	23.740^a ± 1.302	24.810a^±1.096	19.380^b ± 0.693	25.820^a ± 0.055	21.730^b ± 0.869
	Na	0.265^a ± 0.054	0.231^a ± 0.015	0.205^a ± 0.010	0.217^a ± 0.022	0.176^c ± 0.022	8.453^b ± 0.310	0.169^c ± 0.040	9.007^a ± 0.474
	P	8.676^a ± 0.511	8.587^a ± 0.395	8.782^a ± 0.279	8.386^a ± 0.389	8.313^a ± 0.785	7.683^a ± 0.186	8.190^a ± 0.496	8.440^a ± 0.154
	Ca	3.357^a ± 0.024	3.505^a ± 0.086	3.320^a ± 0.053	3.544^a ± 0.091	3.458^a ± 0.071	3.472^a ± 0.167	3.721^a ± 0.154	3.370^a ± 0.130
	Mg	1.440^a ± 0.051	1.513^a ± 0.020	1.461^a ± 0.036	1.507^a ± 0.020	1.476^a ± 0.080	1.437^a ± 0.117	1.583^a ± 0.026	1.482^a ± 0.086
	Mn	0.419^a ± 0.037	0.394^a ± 0.023	0.405^a ± 0.022	0.411^a ± 0.023	0.386^c ± 0.008	0.451^ab ± 0.030	0.467^ab ± 0.042	0.476^a ± 0.011
	Zn	0.277^a ± 0.021	0.286^a ± 0.015	0.254^a ± 0.014	0.276^a ± 0.018	0.265^a ± 0.154	0.262^a ± 0.013	0.238^a ± 0.015	0.243^a ± 0.017
	Fe	0.0040^a ± 0.0010	0.0034^a ± 0.0004	0.0039^a ± 0.0003	0.0031^a ± 0.0008	0.0032^a ± 0.0009	0.0027^a ± 0.0008	0.0044^a ± 0.0003	0.0033^a ± 0.0007
	Cu	0.0049^a ± 5.805E^-05	0.0047^a ± 0.0001	0.0049^a ± 9.293E^-05	0.0047^a ± 0.0001	0.0045^b ± 0.0002	0.0043^b ± 0.0002	0.0053^a ± 0.0003	0.0048^ab ± 0.0002
(C), 20 μM Fe (II) EDTA + 0 mM NaCl; (CS), the treatment of 20 μM Fe (II) EDTA + 250 mM NaCl; (E), the treatment of 80 μM Fe (II) EDTA + 0 mM NaCl; (ES), the treatment of 80 μM Fe (II) EDTA + 250 mM NaCl. Different lowercase letters represents the significance difference level p < 0.05 between C, CS, E and ES treatment.

Table 2.

The ion content in seashore paspalum before and after 10 d under different treatments (mg/g DW).