-
Melon (Cucumis melo L. ssp. agrestis) inbred line 'Yangjiaomi', which displays high powdery mildew susceptibility[15], was used in this study. The germinated seeds were sown in 72-cell seedling trays with nutrient medium (peat : vermiculite : perlite = 2 : 1 : 1), and placed in a growth chamber that was set as 18-h light period with air temperature of 26 °C, 6-h dark period with air temperature of 20 °C, and relative humidity of 60%. At the two-leaf stage, the melon seedlings were transplanted to plastic pots filled with the nutrient soil and incubated under the abovementioned growth conditions. At the three-leaf stage, three exogenous spraying experiments were performed for P. xanthii-inoculated melon seedlings according to the following designs: (1) KHCO3-7DAI spraying experiment, wherein the seedlings were sprayed with H2O and 2.5 g·L−1 KHCO3 (pH 8.54) at 7 d after inoculation (DAI) respectively, and the physiological parameters [P. xanthii proliferation, mildew spot number, disease index, enzymatic activities, as well as the contents of ROS, malonaldehyde (MDA), and secondary phenolic substances] were determined at 0, 1, 3, and 5 d after spraying (DAS); (2) KHCO3-2DBI spraying experiment, wherein the seedlings were sprayed with H2O and KHCO3 at 2 d before inoculation (DBI) respectively, and the abovementioned parameters were determined at 4 and 8 DAI; (3) multiple potassium salt spraying experiment, wherein the seedlings were sprayed with H2O, KOH (pH 8.54), 1.86 g·L−1 KCl and 2.5 g·L−1 KHCO3 (pH 8.54) at 2 DBI respectively, and the determination of physiological parameters (mildew spot number, disease index, enzymatic activities, as well as the contents of total phenols and flavonoids) was carried out at 8 DAI. All experiments were executed in State Key Laboratory of Crop Biology, Shandong Agriculture University, China, from May of 2021 to June of 2022. Three biological repeats were prepared for each parameter.
Phenotypic investigation
-
The representative leaves of melon seedlings in different treatments were photographed, and the disease incidence was recorded on the basis of whether or not disease spots appeared. Thereafter, powdery spots were counted on each leaf of sprayed plants, and the disease index was calculated according to the previously described formula: Disease index = (Sum of numerical disease ratings) / (Number of plants evaluated × maximum of disease rating scale) × 100[16].
The growth of P. xanthii was molecularly evaluated with the previously described qRT-PCR method[17] with minor modifications. In brief, the genomic DNA mixture was first extracted from the pathogen-colonized melon leaves. Using the extracted DNA mixture as a template, two molecular marker genes, P. xanthii TUB2 (PxTUB2) and melon ACT7 (CmACT7), were quantitatively amplified on a 7900HT Fast Real-Time PCR System (ABI, USA). The fungal content was finally determined by calculating the ratio of PxTUB2 to CmACT7 as described by Vela-Corcίa et al.[18]. All primers used for the PCR-based quantitative assay are provided in Table 1.
Table 1. Primers used in qRT-PCR analysis.
Gene Forward primer (5′→3′) Reverse primer (5′→3′) PxTUB2 TTGTAGGAATCACATCCCTTTCTC TTCTTCCGGTTGCATGGGTGGTTC CmACT7 GGCTGGATTTGCCGGTGATGATGC GGAAGGAGGAAATCAGTGTGAACC Assay for enzymatic activities
-
For evaluation of the antioxidant system, 0.3 g of liquid nitrogen-frozen leaves were ground to a fine powder with a mortar and pestle, and then homogenized with 3 mL extraction buffer (50 mM NaHPO4, 0.2 mM EDTA, pH 7.8). After 20-min centrifugation with 12,000 rpm at 4 °C, the resulting supernatants were kept for the determination of superoxide dismutase (SOD), POD and catalase (CAT) activities. Regarding SOD, a reaction mixture was prepared by adding 50 μL of enzyme extract into 3 mL of NBT (nitro-blue tetrazolium) reaction medium (50 mM K2HPO4, 13 mM methionine, 63 mM NBT, and 1.3 mM riboflavin), and subjected to 5-min light treatment at 25 °C with a parallel reaction mixture under darkness as the blank sample. SOD activity was determined using the spectrophotometer method previously described[19]. POD activity was determined according to the method described by Liu et al.[20] with some modifications. In brief, a POD-mediated reduction was initiated by adding 100 μL of enzyme extract into a 2-mL reaction medium [20 mM H2O2, and 1% (w/v) guaiacol]. The enzymatic activity was calculated by monitoring the absorbance increase at 460 nm. For CAT assay, a 1-mL reaction mixture [25 mM sodium phosphate buffer (pH 7.0), 10 mM H2O2, and 0.1 mL enzyme extract] was prepared, and the enzymatic activity was determined by recording the absorbance variations at 240 nm per min.
After homogenization of 0.5 g leaf samples in 5 mL boric acid buffer (pH 8.8), the resulting mixture was subjected to 15-min centrifugation with 8,000 rpm at 4 °C, and the supernatant was kept for determining phenylalanine ammonia lyase (PAL) activity. A 4-mL reaction system [1 mL sodium borate buffer with 0.02 M L-phenylalanine (pH 8.8), 1 mL enzyme extract, and 2 mL distilled H2O] was incubated at 30 °C for 1 h, and 0.2 mL of 6 M HCl was added to the mixture to stop the reaction. The PAL activity was determined using the absorbance variation at 290 nm according to the previously described method[21].
For PPO assay, 0.5 g of liquid nitrogen-frozen leaf samples were ground to a fine powder and homogenized in 4 mL of 0.05 M phosphate buffer (pH 7.0). The homogenates were centrifuged at 8,000 rpm for 10 min at 4 °C, and the resulting supernatants were used for determining the PPO activity according to the method of Zhang et al.[22]. In brief, a reaction mixture, which included 3.9 mL of 0.1 M sodium phosphate buffer (pH 6.8), 0.1 mL of enzyme extract and 1 mL of 0.1 M catechol solution, was prepared, and the mixture was then kept at 37 °C for 10 min. After stopping the reaction with 2 mL of 20% (w/v) trichloroacetic acid (TCA), the resulting solution was centrifuged at 9,000 rpm for 10 min at 4 °C, and the enzymatic activity was determined by recording the absorbance values of supernatants at 525 nm.
Determination of ROS and MDA content
-
To visualize the ROS accumulation, a total of nine leaf discs were randomly collected from three sprayed leaves, and then used for either DAB staining detection of H2O2 or NBT staining detection of O2.− according to the protocols described previously[23]. The stained samples were transferred to 90% (v/v) ethanol and kept in a 95 °C water bath for 30 min, and then photographed. The contents of H2O2 and O2.− in the sprayed leaves were further determined with the H2O2 content assay kit (BC3590, Solarbio) and the superoxide anion activity assay kit (BC1295, Solarbio), respectively, by following the manufacturer’s instructions.
For MDA assay, 1 mL of the supernatant, which was the same as that for the determination of antioxidant enzymatic activities, was mixed well with 3 mL of TCA buffer [0.5% (w/v) thiobarbituric acid, and 20% (v/v) TCA]. After 30-min incubation at 95 °C, the reaction was stopped using an ice bath, and the absorbance to resulting solution was measured at 530, 450 and 600 nm, respectively. The MDA content was finally calculated according to the formula described by Wang et al.[24].
Determination of resistance-related metabolite content
-
For tannin assay, 0.2 g of frozen-dried leaves were ground to a fine powder, and transferred to 5 mL of 70% (v/v) methanol for 24-h incubation at room temperature. After 10-min centrifugation at 5,000 rpm at 4 °C, the supernatants were well mixed with 3 mL of 4% (w/v) vanillin, 1.5 mL of 37% (w/v) HCl and 0.5 mL of 70% (v/v) methanol, and the condensed tannin content was determined using the previously described spectrometry method[23].
Regarding total phenols and flavonoids, 0.2 g of fresh leaves were well ground on an ice bath and suspended with 10 mL of 1% (v/v) HCl-methanol solution for 20 min extraction at 4 °C under darkness. After being filtered, the resulting solutions were subjected to spectrometric analysis at 280 nm for the determination of total phenol content, and at 320 nm for the determination of flavonoid content as described by Toor & Savage[25].
Lignin content of melon leaves was determined by following the previously described protocol[26] with minor modifications. In brief, after ethanol-mediated homogenization and low-speed centrifugation, the precipitates were dissolved in 0.5 mL of 25% (v/v) Acetyl bromide and incubated at 72 °C for 30 min. The reaction was terminated with 0.9 mL of 2 M NaOH, and then 5 mL of glacial acetic acid and 0.1 mL of 7.5 M hydroxylamine hydrochloride were added. After 5-min centrifugation at 4,500 rpm, 0.1 mL of the resulting supernatant was mixed with 3 mL of glacial acetic acid for the spectrometric analysis at 280 nm and the calculation of lignin content.
Hydroxyproline (HYP) content was measured with the Solarbio HYP assay kit (BC0250, Solarbio), and used as an indicator for the content of endogenous HRGP in the sprayed leaves[27].
Data analysis
-
All data were processed with Microsoft Excel 2013 software, and displayed as mean of three biological repeats ± standard errors (SE). The statistical analysis at a 0.05 significance level was carried out with DPS v9.01 software by following the rules of Duncan's new multiple range test.
-
In this study, we demonstrated that the exogenous spraying of 2.5 g·L−1 KHCO3 apparently alleviated the damage of powdery mildew to melon plants, most likely due to the stimulation of both phenylpropanoid metabolic pathway and the antioxidant system. Further investigation unveiled that
, but not K+ and pH, played crucial roles in KHCO3-mediated protection for melon plants under powdery mildew. Collectively, our observations expanded the physiological understanding of inorganic salt-mediation plant protection and could contribute to high-quality melon production in the future.$ \text{HCO}_3^- $ -
About this article
Cite this article
Wang J, Yu X, Hu J, Wang Q, Zheng J, et al. 2023. Positive involvement of HCO3– in modulation of melon resistance to powdery mildew. Vegetable Research 3:3 doi: 10.48130/VR-2023-0003
Positive involvement of HCO3– in modulation of melon resistance to powdery mildew
- Received: 17 October 2022
- Accepted: 06 December 2022
- Published online: 17 January 2023
Abstract: Inorganic salts such as KHCO3 are considered as potential powerful weapons for protecting plants from disease challenges, while their effects remain largely unknown on melon (Cucumis melo L.) resistance to powdery mildew caused by Podosphaera xanthii. In this study, the alleviatory effects of KHCO3 were physiologically explored on P. xanthii-infected seedlings of 'Yangjiaomi', an agrestis melon cultivar being susceptible to powdery mildew, by exogenous spraying at 7 d after inoculation (DAI) and 2 d before inoculation (DBI), respectively. The significantly improved resistance to P. xanthii was observed in melon seedlings sprayed with 2.5 g·L−1 KHCO3 (pH 8.54). Further investigation showed that the activities of PAL and PPO, as well as the accumulation of resistance-benefiting secondary metabolites, were stimulated by KHCO3 treatments. Meanwhile, the activities of SOD, POD and CAT were significantly increased, and the contents of O2.−, H2O2 and MDA were dramatically lowered in the KHCO3-sprayed seedlings than those in the H2O-sprayed seedlings. Another four treatments [H2O, KOH (pH 8.54), 1.86g·L−1 KCl and 2.5g·L−1 KHCO3 (pH 8.54)] were carried out for melon seedlings at 2 DBI. The significantly decreased disease index and the stimulated ROS and phenylpropanoid metabolic pathways were only observed for the KHCO3-sprayed group, suggesting the crucial roles of HCO3− involved in the protection of melon seedlings from powdery mildew. Collectively, our results provide new physiological insights into inorganic salt-mediated plant protection and could benefit the green production of melon in the future.
-
Key words:
- Cucumis melo L. /
- Podosphaera xanthii /
- HCO3− /
- Phenylpropanoid metabolism /
- Antioxidant capacity