Search
Submit Manuscript
1.9CiteScore
Advanced Search
MAP  >  Fruit Research
2021 Volume 1
Article Contents
Abstract
Introduction
Materials and methods
Plant materials
Protein extraction
Trypsin digestion
Affinity enrichment of ubiquitinated peptides
Lc-ms/ms and data analysis
Bioinformatics methods
Results
Overview of the ubiquitomic analysis
Properties of ubiquitinated proteins and motifs
A temperature-regulated rice endosperm ubiquitome
Functions for differentially expressed ubiquitinated proteins
Discussion
Ubiquitination of heat shock proteins and transcription factors under high-temperature stress
Sucrose and starch metabolism are modified by ubiquitination under high-temperature stress
Ubiquitination affects sucrose hydrolysis
Ubiquitination of adp-glucose pyrophosphorylase (agpase)
Ubiquitination regulates amylose biosynthesis
Ubiquitination regulates amylopectin biosynthesis
Ubiquitination affects ribosomal systems under high-temperature stress
Author contributions
Data availability
Acknowledgments
Conflict of interest
Rights and permissions
References
About this article
Next Previous
ARTICLE   Open Access    

The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection

  • 1.

    United States Department of Agriculture, Agricultural Research Service, Tree Fruit Research Laboratory, Wenatchee, WA 98801, USA

  • 2.

    Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences, Zhengzhou, Henan 450000, China

More Information
  • Plant resistance responses against invading pathogens require a coordinated set of cellular processes to optimize the effective defense output. Previous transcriptome analyses have identified a multi-phase and multi-layered defense strategy in apple root towards infection from a necrotrophic oomycete pathogen Pythium ultimum. Among the identified apple genes, members of the laccase gene family represent an actively regulated group at both transcriptional and posttranscriptional levels. In this study, several apple laccase genes were selected for further analyses on their sequence features and potential roles during defense activation in apple roots. Their bioinformatic specifics, genotype-specific induction, and lignin deposition patterns during pathogen infection were examined between two apple rootstock genotypes, a resistant O3R5-#161 and a susceptible O3R5-#132. The sequences these laccase genes contain the conserved cu-oxidase domains and the characteristic gene structures with MdLAC7a as an exception. While MdLAC3 and MdLAC5 showed a partial induction to P. ultimum infection, both MdLAC7a and MdLAC7b genes demonstrated consistent and high-level inducibility. Moreover, MdLAC7b exhibited a differential expression pattern, with a higher expression in the resistant O3R5-#161. Lignin deposition appeared to be stronger in the infected root of the resistant genotype compared to that of the susceptible one. The efficient lignin biosynthesis and deposition at the initial stage of infection is crucial for impeding the progression of this fast-growing necrotrophic pathogen. Future study regarding the role of MdLAC7b, including the transgenic manipulation and biochemical analysis, should provide more definitive evidence for its contribution to resistance to P. ultimum infection.

  • Introduction

    Rice (Oryza sativa L.) is a world staple crop that feeds over half of the world's population[1,2]. In recent years, high-temperature events are becoming more frequent and intensive as a result of global warming, which can severely affect rice grain yield and quality[3,4]. During flowering and grain filling stages, high-temperature stress can result in a significant reduction in seed setting rate and influence amylose content, starch fine structure, functional properties and chalkiness degree of rice[5−7]. Transcriptome and proteome analysis in rice endosperm have also been used to demonstrate the differences in high-temperature environments at gene and protein expression levels[8−10]. In addition, as an important post-translational modification, protein phosphorylation has proven to be involved in the regulation of starch metabolism in response to high-temperature stress[11]. However, little is known about whether protein ubiquitination regulates seed development under high-temperature stress.

    Ubiquitination is another form of post-translational modification that plays key roles in diverse cellular processes[12]. Several reports have described the functions of ubiquitination in rice defense responses based on ubiquitome analysis. Liu et al.[13] investigated relationships between ubiquitination and salt-stress responses in rice seedlings using a gel-based shotgun proteomic analysis and revealed the potential important role of protein ubiquitination in salt tolerance in rice. Xie et al.[14] identified 861 peptides with ubiquitinated lysines in 464 proteins in rice leaf cells by combining highly sensitive immune affinity purification and high resolution liquid chromatography-tandem mass spectrometry (LC-MS/MS). These ubiquitinated proteins regulated a wide range of processes, including response to stress stimuli. A later study revealed the relationships between ubiquitination status and activation of rice defense responses, and generated an in-depth quantitative proteomic catalog of ubiquitination in rice seedlings after chitin and flg22 treatments, providing useful information for understanding how the ubiquitination system regulates the defense responses upon pathogen attack[15]. Although many studies have shown that ubiquitination plays improtant roles in the heat response of plant[16,17], there has been little systematic discussion on the ubiquitome of rice endosperm in the context of global climate change.

    In this study, we examine the high-temperature induced ubiquitination change in two rice varieties with different starch qualities, through a label-free quantitative ubiquitome analysis. This study provides a comprehensive view of the function of ubiquitination in high-temperature response of rice developing seed, which will shed new light on the improvement of rice grain quality under heat stress.

    Materials and methods

    Plant materials

    Two indica rice varieties with different starch quality, 9311 and Guangluai4 (GLA4), were used as materials. 9311 is a heat-sensitive variety, which displays low amylose content with good starch quality; while GLA4 is known to be the parental variety of HT54, an indica breeding line with heat tolerance, and thus GLA4 is possibly heat tolerant, which shows high amylose content with poor starch quality[18,19]. Rice growth conditions, sample treatment and collection were conducted as previously described[11].

    Protein extraction

    Husk, pericarp and embryo were detached from immature rice grains on ice[20]. Rice endosperm was then ground with liquid nitrogen, and the cell powder was sonicated 10 rounds of 10 s sonication and 15 s off-sonication on ice in lysis buffer (6 M Guanidine hydrochloride, pH 7.8−8.0, 0.1% Protease Inhibitor Cocktail) using a high intensity ultrasonic processor. Following lysis, the suspension was centrifuged at 14,000 g for 40 min at 4 °C to remove the debris. The supernatant was collected, and the protein concentration was estimated using BCA assay (Pierce BCA Protein assay kit, Thermo Fisher Scientific, Waltham, MA, USA) before further analysis.

    Trypsin digestion

    The protein mixture was reduced by DTT with the final concentration of 10 mM at 37 °C for 1 h, alkylated by iodoacetamide with a final concentration of 50 mM at room temperature in the dark for 0.5 h, and digested by trypsin (1:50) at 37 °C for 16 h. Then the sample was diluted by adding trifluoroacetic acid (TFA) to the final concentration of 0.1%. The enzymatic peptides were desalted on a Sep-Pak C18 cartridge (Waters, Milford, MA, USA), concentrated by lyophilization and reconstituted in precooled IAP buffer (50 mM MOPS-NaOH PH 7.2, 10 mM Na2HPO4, 50 mM NaCl) for further analysis.

    Affinity enrichment of ubiquitinated peptides

    The peptides solution was incubated with prewashed K-ε-GG antibody beads (PTMScan Ubiquitin Remnant Motif (K-ε-GG) Kit), and gently shaken at 4 °C for 1.5 h. The suspension was centrifuged at 2,000 g for 30 s, and the supernatant was removed. The Anti-K-ε-GG antibody beads were washed with IAP Buffer three times and with ddH2O three times. The peptides were eluted from the beads with 0.15% trifluoroacetic acid (TFA). Finally, the eluted fractions were combined and desalted with C18 Stage Tips.

    LC-MS/MS and data analysis

    LC-MS/MS analysis were performed using the methods of Pang et al.[11]. Raw mass spectrometric data were analyzed with MaxQuant software (version 1.3.0.5) and were compared with the indica rice protein sequence database (Oryza sativa subsp. indica-ASM465v1). Parameters were set according to Pang et al.[11]. All measurements were obtained from three separate biological replicates.

    Bioinformatics methods

    Quantification of the modified peptides was performed using the label-free quantification (LFQ) algorithm[11]. Differentially ubiquitinated sites (proteins) in response to high-temperature were identified by Student's t-test (p < 0.05, log2(fold-change) > 1) with at least two valid values in any condition or the ubiquitination sites that exhibited valid values in one condition (at least two of three replicates) and none in the other.

    Subcellular localization was performed using CELLO database (http://cello.life.nctu.edu.tw). Gene Ontology (GO) annotation proteome was derived from the AgriGO (http://bioinfo.cau.edu.cn/agriGO/). The differential metabolic profiles were visualized with MapMan software (version 3.6.0RC1). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway annotation was performed by using KEGG Automatic Annotation Server (KAAS) software. A p-value of < 0.05 was used as the threshold of significant enrichment. SWISS-MODEL was used to generate the tertiary structure of GBSSI (SWISS-MODEL, http://swissmodel.expasy.org/). The figures were annotated with Adobe Illustrator (Adobe Systems, San Jose, CA, USA).

    Results

    Overview of the ubiquitomic analysis

    To elucidate how high-temperature stress influences rice developing endosperm at the ubiquitination level, a label-free analysis was performed to quantify ubiquitome from two indica rice varieties under normal (9311-C and GLA4-C) and high-temperature conditions (9311-H and GLA4-H). The distribution of mass error of all the identified peptides was near zero and most of them (71.5%) were between -1 and 1 ppm, suggesting that the mass accuracy of the MS data fits the requirement (Fig. 1a). Meanwhile, the length of most peptides distributed between 8 and 42, ensuring that sample preparation reached standard conditions (Fig. 1b).

    Figure 1.  Characteristics of the ubiquitinated proteome of rice endosperm and QC validation of MS data. (a) Mass error distribution of all identified ubiquitinated peptides. (b) Peptide length distribution. (c) Frequency distribution of ubiquitinated proteins according to the number of ubiquitination sites identified.
    DownLoad: Full-Size Img PowerPoint

    In all endosperm samples, a total of 437 ubiquitinated peptides were identified from 246 ubiquitinated proteins, covering 488 quantifiable ubiquitinated sites (Supplemental Table S1). Among the ubiquitinated proteins, 60.6% had only one ubiquitinated lysine site, and 18.7%, 8.1%, 5.3%, or 7.3% had two, three, four, or five and more ubiquitinated sites, respectively. In addition, four proteins (1.6%, BGIOSGA004052, BGIOSGA006533, BGIOSGA006780, BGIOSGA022241) were ubiquitinated at 10 or more lysine sites (Fig. 1c, Supplemental Table S1). The proteins BGIOSGA008317 had the most ubiquitination sites with the number of 16. It was noted that besides ubiquitin, two related ubiquitin-like proteins NEDD8 and ISG15 also contain C-terminal di-Gly motifs generated by trypsin cleavage, and the modifications of these three proteins cannot be distinguished by MS[21]. Here, the di-Gly-modified proteome therefore represents a composite of proteins modified by these three proteins. However, the sites from NEDD8 or ISG15 modifications were limited because they mediate only a few reactions in cells[21].

    Properties of ubiquitinated proteins and motifs

    To better understand the lysine ubiquitome changes in rice endosperm induced by high-temperature, we performed a Gene Ontology (GO) functional annotation analysis on all identified ubiquitinated proteins (Fig. 2a). In the biological process GO category, 'metabolic process' and 'cellular process' were mainly enriched, accounting for 75.1% and 74.1% of ubiquitinated proteins, respectively. In addition, 34.6% proteins were associated with 'response to stimulu', emphasizing the regulatory role of ubiquitination modification in response to high-temperature stress. From the cellular component perspective, ubiquitinated proteins were mainly associated with 'cellular anatomical entity' (99.4%), 'intracellular' (84.4%) and 'protein-containing complex' (29.9%). The molecular function category result suggested that these proteins were largely involved in 'binding' (62.7%), 'catalytic activity' (43.4%) and 'structural molecule activity' (16.5%). Furthermore, subcellular location annotation information indicated that 34.7%−39.4% proteins were located in the cytoplasm, and other were mostly located in the nucleus (23.5%−27.7%), plasma membrane (9.4%−11.4%), and chloroplast (9.6%−12.8%) (Fig. 2b). It is noteworthy that the ubiquitinated proteins located in the cytoplasm were decreased in high-temperature environments in both varieties.

    Figure 2.  Analysis of ubiquitinated proteins and motifs. (a) Gene ontology (GO) functional characterization of ubiquitinated proteins. (b) Subcellular localization of ubiquitinated proteins. From the inside out, the ring represents 9311-C, 9311-H, GLA4-C and GLA4-H, respectively. (c) Motif enrichment analysis of ubiquitinated proteins.
    DownLoad: Full-Size Img PowerPoint

    The following two significantly enriched motifs from all of the identified ubiquitinated sites were identified using MoDL analysis: [A/S]xKub and Kubxx[E/Q/R/V]x[E/G/L/P/Q/R/Y], which covered 84 and 100 sequences, respectively (Fig. 2c). Further analysis showed that the conserved alanine (A) and glutamic acid (E) were included in upstream and downstream of the ubiquitinated lysine sites in rice endosperm. A similar phenomenon also occurred in rice leaf[14], wheat leaf[22], and petunia[23], indicating that alanine (A) and glutamic acid (E) were likely to be the specific amino acids in conserved ubiquitination motifs in plants. Additionally, serine (S) was enriched at the position -2 (upstream) of the ubiquitinated lysine, while various amino acids such as arginine (R), glutamic acid (E), glutamine (Q), valine (V) were found at positions +3 and +5 (downstream).

    A temperature-regulated rice endosperm ubiquitome

    To detect possible changes in rice endosperm ubiquitome attributable to high-temperature stress, we then performed LFQ analysis on all quantifiable ubiquitination sites within our dataset. As shown in Fig. 3a, more ubiquitinated proteins, peptides and sites were detected in the treatment groups (9311-H and GLA4-H), suggesting that exposure to high-temperature stress may increase the ubiquitination events in rice endosperm. Only 282 common ubiquitinated sites in 158 proteins were quantifiable for all sample groups due to reversible ubiquitination induced by high-temperature (Fig. 3b). Principal component analysis (PCA) showed that three repeats of each sample clustered together, and four groups were clearly separated (Fig. 3c). Furthermore, the differentially expression profiles of ubiquitination sites (proteins) in 9311 and GLA4 under high-temperature stress were depicted to further understand the possible changes (Fig. 3d). Where LFQ values were missing, the data were filtered to identify those ubiquitination sites with a consistent presence/absence expression pattern. These analyses yielded 89 ubiquitination sites that were only present in 9311-H and six that were only present in 9311-C (Fig. 3d, Supplemental Table S2). Similarly, 51 differentially expressed ubiquitination sites were present in GLA4-H and 13 ubiquitination sites only occurred in GLA4-C (Fig. 3d & Supplemental Table S3). Beyond that, a total of 113 and 50 significantly changed ubiquitination sites (p < 0.05, log2(fold-change) >1) were screened out in 9311 and GLA4, respectively (Fig. 3d, Supplemental Tables S4 & S5). For subsequent comparative analysis, the ubiquitination expression profiles with consistent presence/absence and ubiquitination sites with significant differences in statistical testing were combined and named as 9311-Up, 9311-Down, GLA4-Up, and GLA4-Down, respectively (Fig. 3d). The number of significantly up-regulated ubiquitination sites was far greater than down-regulated ubiquitination sites in both 9311 and GLA4 varieties. These findings indicated that high temperature not only induced the occurrence of ubiquitination sites, but also significantly upregulated the intensity of ubiquitination. Beyond that, the magnitude of the up-regulation in 9311 was higher than that in GLA4 (Fig. 3b & d), indicating that the ubiquitination modification of heat-sensitive varieties was more active than heat-resistant varieties in response to high-temperature stress.

    Figure 3.  A temperature regulated rice endosperm ubiquitome. (a) The number of ubiquitinated proteins, peptides and sites detected in four group samples. (b) Venn diagram of ubiquitination sites (proteins) detected in four group samples. (c) PCA based on ubiquitination intensity across all four sample groups with three biological repetitions. (d) Differentially expression profiles of ubiquitination sites (proteins) in 9311 and GLA4 under high-temperature stress. The expression profiles of selected ubiquitination sites (p < 0.05, log2(fold-change) >1) were normalized using the Z-score and presented in a heatmap.
    DownLoad: Full-Size Img PowerPoint

    To further investigate the ubiquitination regulatory pattern under high temperature stress in two varieties, four groups with significantly regulated sites were analyzed. There were 37 ubiquitination sites showed the same regulatory trend in 9311 and GLA4, accounting for 17.8% and 32.5% of the total differentially expressed sites in 9311 and GLA4, respectively. Among them, 36 ubiquitination sites were upregulated and one site was downregulated (Fig. 4a). In addition, 159 upregulated ubiquitination sites and three downregulated sites were only present in 9311, while 53 upregulated sites and 15 downregulated sites were only present in GLA4. Moreover, nine ubiquitination sites showed opposite regulatory trends in 9311 and GLA4. A similar regulatory trend of ubiquitination proteins is shown in Fig. 4b. It is noted that some proteins had both upregulated and downregulated ubiquitination sites (Supplemental Tables S6 & S7), indicating that significant differences in ubiquitination were, to some extent, independent of protein abundance.

    Figure 4.  Comparison of differentially ubiquitinated sites and proteins in 9311 and GLA4 under high-temperature stress.
    DownLoad: Full-Size Img PowerPoint

    Functions for differentially expressed ubiquitinated proteins

    To understand the function of ubiquitination in response to the high-temperature stress of rice endosperm, we conducted GO enrichment-based clustering analysis of the differentially ubiquitinated proteins in 9311 and GLA4 at high temperature, respectively (Fig. 5). In the biological process category of 9311, proteins were relatively enriched in the carbohydrate metabolic process, polysaccharide metabolic process, starch biosynthetic process, cellular macromolecule localization, protein localization, intracellular transport, and phosphorylation (Fig. 5). For the molecular function analysis, we found that the proteins related to kinase activity, nucleotidyltransferase activity, phosphotransferase activity, and nutrient reservoir activity were enriched (Fig. 5). The two principal cellular components were intrinsic component of membrane and integral component of membrane (Fig. 5). There was no significantly enriched GO term in the GLA4 group due to the dataset containing relatively few proteins, and thus, further enrichment analysis was conducted on the proteins that were common to both varieties. The results showed that proteins were over-represented in carbon metabolism, including starch biosynthesis and metabolism, glucan biosynthesis and metabolism, and polysaccharide biosynthesis and metabolism (Fig. 5), indicating the importance of carbohydrate synthesis and metabolism in the ubiquitination regulatory network.

    Figure 5.  Enrichment analysis of differentially expressed ubiquitinated proteins based on Gene Ontology (GO) terms.
    DownLoad: Full-Size Img PowerPoint

    To identify pathways which were differentially ubiquitinated under high-temperature stress, the KEGG pathway-based clustering analysis was conducted. The results showed that the differentially ubiquitinated proteins in both 9311 and GLA4 were mostly abundant in the pathways of carbohydrate metabolism, starch and sucrose metabolism, folding, sorting and degradation, translation, ribosome, and protein processing in endoplasmic reticulum (Fig. 6a). In the 9311 group, the pathways of carbohydrate metabolism, starch and sucrose metabolism, glycosyltransferases, glycolysis, and energy metabolism were enriched in the differentially ubiquitinated proteins (Fig. 6b); while there was no significantly enriched KEGG pathway in the GLA4 group. We further found the proteins that were common to both varieties were only significantly enriched in the starch and sucrose metabolism pathways (p = 0.04). The ubiquitination proteins involved in the starch and sucrose metabolism mainly include: sucrose hydrolysis (SUS, FK, UGPase), and starch synthesis (AGPase, GBSSI, BEI, BEIIb, PUL, PHO1), which are discussed below.

    Figure 6.  KEGG classification and enrichment analysis of differentially ubiquitinated proteins. (a) Number of differentially ubiquitinated proteins based on KEGG classification in 9311 and GLA4. (b) KEGG enrichment analysis of differentially ubiquitinated proteins in 9311.
    DownLoad: Full-Size Img PowerPoint

    Discussion

    Although many reports have described specific examples of ubiquitination in rice defense responses[13,15,16], our knowledge on global changes in the developing endosperm ubiquitome under high-temperature stress is still lacking. In this study, a label-free quantitative proteomic analysis of ubiquitination was applied to examine the high-temperature induced ubiquitination change of two indica rice varieties (9311 and GLA4) with distinct starch quality. We identified many new lysine modification sites on proteins involved in various pathways, highlighting the complexity of the ubiquitination-mediated regulatory system in high-temperature stress responses in rice.

    Ubiquitination of heat shock proteins and transcription factors under high-temperature stress

    Heat shock proteins accumulate under various stresses and play important roles in plant defenses against abiotic stresses[24,25]. Research has shown that a number of heat shock proteins were prominent in the rice ubiquitome network, of which OsHSP71.1, and OsHSP82A showed increased ubiquitination levels under chitin and flg22 treatment[15]. Here, seven lysine residues on five heat shock proteins possessed ubiquitination modification in rice endosperm. Three sites (BGIOSGA011420-K78, BGIOSGA026764-K99, BGIOSGA029594-K106) showed significant up-regulation in 9311 under high-temperature stress, while in GLA4, the ubiquitination level of BGIOSGA011420-K78 was down-regulated. This differential ubiquitination of heat-tolerant and heat-sensitive varieties provided a basis for studying the regulation of post-translational modification of heat shock proteins under high-temperature stress, despite the regulatory role of those heat shock proteins being still unclear.

    Transcription factors (TFs) play an essential role in the regulation of gene expression. A total of three transcription factors were identified in the ubiquitination dataset, of which two were NAC family members. As one of the largest plant-specific TF families, NAC is involved in the responses to abiotic and biotic stresses[26]. The ubiquitination modification of K173 in BGIOSGA018048 was specifically expressed in the 9311-H group, which may affect the stress resistance level in high-temperature environments. In addition, two sites K148 and K149 of ERF TF family member BGIOSGA024035 was downregulated in GLA4 under high-temperature stress. This differential ubiquitination was likely to affect the expression of related genes regulated by this transcription factor.

    Sucrose and starch metabolism are modified by ubiquitination under high-temperature stress

    Ubiquitination affects sucrose hydrolysis

    The results of GO and KEGG enrichment analysis of differential ubiquitination proteins indicated that the sucrose and starch metabolic pathway was largely affected by ubiquitination regulation under high-temperature stress (Figs 5 & 6). The ubiquitination sites involved in sucrose and starch metabolism are listed in Table 1. To assess how high-temperature stress affects the crucial pathway, the significantly differential ubiquitination sites in 9311 and GLA4 were displayed in the heatmap of specific proteins (Fig. 7).

    Table 1.  Ubiquitination sites related to sucrose and starch metabolism in rice endosperm.
    Gene nameAnnotationProtein entryModification site(s)
    SUS1Sucrose synthase 1BGIOSGA010570K172, K177
    SUS2Sucrose synthase 2BGIOSGA021739K160, K165, K176, K804
    SUS3Sucrose synthase 3BGIOSGA026140K172, K177, K541, K544, K588
    FKFructokinaseBGIOSGA027875K143
    UGPaseUDP-glucose pyrophosphorylaseBGIOSGA031231K27, K150, K303, K306
    AGPS1ADP-glucose pyrophosphorylase small subunit 1BGIOSGA030039K94, K464, K484
    AGPS2ADP-glucose pyrophosphorylase small subunit 2BGIOSGA027135K106, K132, K385, K403, K406, K476, K496
    AGPL2ADP-glucose pyrophosphorylase large subunit 2BGIOSGA004052K41, K78, K134, K191, K227, K254, K316, K338, K394, K396, K463, K508, K513
    AGPL3ADP-glucose pyrophosphorylase large subunit 3BGIOSGA017490K509
    GBSSIGranule bound starch synthase IBGIOSGA022241K130, K173, K177, K181, K192, K258, K371, K381, K385, K399, K462, K517, K530, K549, K571, K575
    BEIStarch branching enzyme IBGIOSGA020506K103, K108, K122
    BEIIbStarch branching enzyme IIbBGIOSGA006344K134
    PULStarch debranching enzyme:PullulanaseBGIOSGA015875K230, K330, K431, K736, K884
    PHO1Plastidial phosphorylaseBGIOSGA009780K277, K445, K941
     | Show Table
    DownLoad: CSV
    Figure 7.  Sucrose and starch pathway at the ubiquitination levels in rice endosperm under high-temperature stress.
    DownLoad: Full-Size Img PowerPoint

    In cereal endosperm, sucrose is the substrate for the biosynthesis of starch. The formation of glucose 1-phosphate (G1P, used in starch synthesis, see below) from sucrose requires a series of enzymes[27]. Here, we found that sucrose synthase 1 (SUS1), SUS2, SUS3, fructokinase (FK), and UDP-glucose pyrophosphorylase (UGPase) were ubiquitinated among all sample groups (Table 1, Fig. 7). In the ubiquitome of seedling and leaf in japonica rice, ubiquitination sites have been found in SUS1, SUS2, UGPase, and FK, which were related to sucrose hydrolysis[14,15]. SUS catalyzed the process of cleaving sucrose into UDP-glucose (UDPG) and fructose. Two ubiquitination sites, K172 and K177, were identified in SUS1 in rice endosperm, which were also found in rice leaves[14]. A total of four ubiquitination sites were identified in SUS2, two of which were also reported in rice seedling and leaf, indicating the conservation of the lysine residues in different rice tissues. It was noted that all four ubiquitination sites in SUS2 were upregulated in high-temperature environments, although the regulated sites of 9311 and GLA4 were different. In 9311, the ubiquitination levels of K160, K174, and K804 were increased, while GLA4 was only upregulated in K176. The ubiquitination sites K541, K544, and K588 in SUS3 were screened from developing rice seeds for the first time. In addition, SUS3 had two completely overlapping sites K172 and K177 with SUS1, and it was difficult to determine which enzymes the two sites belonged to. The ubiquitination levels of SUS3-K541 and SUS3-K544 in 9311 significantly increased in high-temperature environments, while there was no significant difference in the ubiquitination level of SUS3 in GLA4. Overall, the ubiquitination sites of SUS in rice endosperm were located in the functional domain except for SUS2-K804, reflecting the importance of ubiquitination regulation in SUS.

    UGPase catalyses the conversion of glucose 1-phosphate and UTP into UDPG[28]. Research has shown that the mutation of UGPase gene lead to chalky endosperm[29]. As shown in Table 1, four ubiquitination sites K27, K150, K303, and K306 were identified in rice endosperm, which were completely inconsistent with the seven ubiquitination sites in rice seedlings and two in leaves[14,15], reflecting the tissue specificity. We speculated that the UGPase with different modification sites may play different regulatory roles in metabolic pathways in different tissues. Under high-temperature stress, the ubiquitination level of UGPase-K27 was 8.1-fold up-regulated. Liao et al.[10] demonstrated that the expression of UDPase was down-regulated in both heat-tolerant and heat-sensitive rice lines under high temperature conditions, which could reasonably explain the significant up-regulation of UGPase-K27 ubiquitination level. The ubiquitination site K143 of FK was also reported in seedling tissues[15].

    Ubiquitination of ADP-glucose pyrophosphorylase (AGPase)

    The AGPase reaction represents the first committed step of starch biosynthesis[27]. A total of 22 lysine ubiquitination sites were identified in four AGPase subunits (AGPL2, AGPL3, AGPS1, AGPS2). AGPL2 had 13 ubiquitination sites, of which six were located in NTP_transferase domain, including K254, K338, K191, K134, K227, and K316. High-temperature stress resulted in an increase in the ubiquitination level of K254 in both 9311 and GLA4, and significant upregulation of K508 and K513 in 9311, as well as K191, K227, and K316 in GLA4. In contrast, AGPL2-K394 were significantly downregulated in GLA4. AGPL3 contained one ubiquitination site K509, and the modification level of AGPL3-K509 was up-regulated in high-temperature environments in 9311. AGPS1 had one specific ubiquitination site K464 and another two sites K94 and K484 that completely overlapped with AGPS2-K106 and AGPS2-K496, respectively. The modification levels of K464 and K484 significantly increased in high-temperature environments in 9311, and K94 was significantly up-regulated in both varieties. There were seven ubiquitination sites in AGPS2 in rice endosperm, which were different with the sites found in rice leaves[14]. In addition to the two sites that overlapped with AGPS1, AGPS2 had another two ubiquitination sites (K406 and K132) that upregulated in high-temperature environments.

    Ubiquitination regulates amylose biosynthesis

    Amylose content is one of the key determinants that strongly influence rice grain quality[30]. The biosynthesis of amylose requires the catalytic effect of granule-bound starch synthase I (GBSSI)[30,31]. Here, a total of 16 ubiquitination sites were identified in GBSSI (Table 1, Fig. 8a). Among these ubiquitination sites, six lysine residues (K130, K173, K177, K181, K192, K258) were located in glycosyltransferase 5 (GT5) domain, and three sites (K399, K462, K517) were located in GT1 domain (Fig. 6), indicating the important role of ubiquitination regulation of GBSSI. Under high-temperature stress, the ubiquitination levels of six sites (K130, K177, K399, K381, K385, K549) increased in two indica rice varieties, while one sites (K258) showed downregulation in 9311 (Fig. 8a). Numerous studies had described that the amylose content was reduced under high-temperature stress in rice[5,7], which might be due to the degradation of GBSSI proteins caused by the increased significantly up-regulated ubiquitination sites. These ubiquitination sites identified in rice GBSSI with significant differences under high-temperature stress were expected to become a new breakthrough point for the improvement of starch quality.

    Figure 8.  Structure of GBSSI. (a) Domain structure of GBSSI and ubiquitination sites with significant differences in response to high-temperature stress. (b) 3D model of GBSSI and the relationship between ubiquitination sites K462 and ADP, SO4 (salt bridge or hydrogen bond).
    DownLoad: Full-Size Img PowerPoint

    To further determine the regulatory role of the ubiquitination sites in GBSSI, SWISS-MODEL was used to predict 3D structural model. As shown in Fig. 8b, GBSSI had three SO4 (sulfate ions) and one ADP ligand. These ligands interact with GBSSI through hydrogen bonds and salt bridges. Three sites, K447, R458, and K462, were associated with SO4 through salt bridges, while G100, N265, Q412, K462, and Q493 interact with the hydrogen bonds of ADP in GBSSI[32,33]. Based on this finding, it can be reasonably inferred that the K462 site with ubiquitination modification located in the GT1 domain played an important role in the interaction between GBSSI, SO4, and ADP. An in-depth investigation was necessary to gain a more comprehensive understanding of the regulatory function of ubiquitination modification at GBSSI-K462, although there was no significant difference in the ubiquitination level under high-temperature stress.

    Ubiquitination regulates amylopectin biosynthesis

    Amylopectin, the major component of starch, is synthesized by the coordinated action of multiple enzymes including soluble starch synthase (SSs), starch branching enzyme (BEs), starch debranching enzyme (DBEs), and phosphorylases (PHOs or Phos) with ADPG as a substrate. In this study, ubiquitination sites were detected in BEs, DBEs, and Phos.

    BEs, covering two isoforms, BEI and BEII, are responsible for catalyzing the formation of α-1,6-glucosidic linkages of amylopectin[34]. There were three ubiquitination sites (K103, K108, and K122) identified in BEI (Fig. 9a). K122 was the first amino acid in the carbohydrate-binding module 48 (CBM48) domain. Sequence alignment analyses of BEs from eight plants revealed K122 was conserved among all plants' BEI (Fig. 9a), suggesting a high probability of the functional effects of ubiquitination modification at this site. In high-temperature environments, ubiquitination levels of K108 and K122 were significantly up-regulated in 9311, while no significantly regulated ubiquitination sites of BEI were observed in GLA4. Only one ubiquitination site, K134, was found in BEIIb (Fig. 9a). The ubiquitination levels showed a slightly upward trend with no significant differences in high-temperature environments in both varieties. These changes could be one of the reasons for increased gelatinization temperature and relative crystallinity of rice starch in response to high-temperature[5].

    Figure 9.  Domain structure of (a) BEs, (b) PUL and (c) Pho1 as well as their ubiquitination sites with significant differences in response to heat stress. Residues in red indicate the ubiquitination site. Non-ubiquitinated residues are shown in dark grey.
    DownLoad: Full-Size Img PowerPoint

    DBEs consists of isoamylase (ISA) and pullulanase (PUL) with catalytic function for hydrolyzing α-1,6-glucosic linkages[35]. In the present study, we found that only PUL was ubiquitinated in rice endosperm (Fig. 9b). Among five ubiquitination sites (K230, K330, K432, K736, and K884) identified in PUL, K230 was located in the PULN2 domain, while K330 was in the CBM48 domain. Under high-temperature stress, K330 showed completely opposite regulatory trends in two cultivars. In addition, the ubiquitination level of K884, located in the DUF3372 domain, was significantly up-regulated in 9311. Previous study has reported that the expression of PUL was significantly up-regulated in 9311 under high-temperature stress, while GLA4 showed down-regulation in PUL abundance[11]. Consequently, there might be two possible functions of these ubiquitination sites. One possibility is that ubiquitination sites were unrelated to protein degradation; instead, they regulated the biosynthesis of amylopectin by affecting other functions of the protein. Secondly, ubiquitination sites were associated with protein degradation, and the levels of ubiquitination modification were based on protein abundance, resulting in a completely consistent regulation of ubiquitination modification and protein abundance under high-temperature stress.

    PHOs, including two types, Pho1/PHO1 and Pho2/PHO2, are responsible for the transfer of glucosyl units from Glc-1-P to the non-reducing end of a-1,4-linked glucan chains[36]. Pho1 is a temperature-dependent enzyme and considered crucial not only during the maturation of amylopectin but also in the initiation process of starch synthesis[37,38]. The three ubiquitination sites (K277, K445, K941) identified in Pho1 were located in two phosphorylase domains. We found that two sites, Pho1-K277 and Pho1-K445, were only ubiquitinated in high-temperature environments in 9311 and GLA4, respectively. Pang et al.[11] has demonstrated that the protein abundance of Pho1 decreased under high-temperature stress, especially in GLA4. Satoh et al.[38] reported that the functional activity of Pho1 was weakened under conditions of high temperature and its function might be complement by one or more other factors. Hence, these ubiquitination modifications that specifically occurred in high-temperature environments might be related to the degradation of Pho1 proteins.

    Ubiquitination affects ribosomal systems under high-temperature stress

    As a factory for protein synthesis in cells, the ribosome is an extremely crucial structure in the cell[39]. It has been proven that multiple ribosomal subunits were abundantly ubiquitinated in Arabidopsis and wheat[22]. In the present study, 57 ubiquitination sites involving 33 ribosome subunits were identified in 40S and 60S ribosome complexes in rice. Under high-temperature stress, the ubiquitination levels of some sites were significantly upregulated or downregulated, implying that ubiquitination of ribosomal proteins is likely to be an important regulatory mechanism in high-temperature response in rice endosperm. The results of GO and KEGG enrichment analysis indicated that the ribosome system was one of the most active systems for ubiquitination regulation under high-temperature stress. We speculated that the ubiquitin-proteasome system might be involved in the removal of subunits or entire ribosomes that were improperly folded in high-temperature environments. As shown in Fig. 10, the S10e, L18Ae, S27Ae, L9e, S3e, S28e, S20e, and S2e subunits were significantly up-regulated in 9311, while L13e subunits showed a completely opposite regulatory trend at the ubiquitination sites K81 and K88. In GLA4, the ubiquitination levels of S10e, S27Ae, L10Ae, L9e, S3e, S2e, and L4e showed a significant increase, while the ubiquitination level of L17e was significantly down-regulated under high-temperature stress. A total of seven ubiquitination sites involving S10e, S27Ae, L9e, S3e, and S2e subunits were jointly up-regulated in both two varieties. These sites might be related to the degradation of improperly folded ribosome subunits under high-temperature stress, while other ubiquitination sites with variety specificity might be associated with ribosomal function.

    Figure 10.  Ribosome system at the ubiquitination levels in rice endosperm under high-temperature stress. Grey shadings represent ubiquitinated proteins with no significant differences under heat stress. Red and blue shadings indicate up-regulated and down-regulated ubiquitinated proteins, respectively. Orange shading displays a combination of up- and down-regulated ubiquitinated sites in the same ubiquitinated protein.
    DownLoad: Full-Size Img PowerPoint

    In conclusion, this study provides the first comprehensive view of the ubiquitome in rice developing endosperm, and demonstrated that ubiquitination has diverse functions in the high-temperature response of rice endosperm by modulating various cellular processes, especially the sucrose and starch metabolism. Comparative analysis of the temperature-induced ubiquitination status revealed some similarities and more interesting differences between 9311 and GLA4. These differences might be the reason for the different qualities formation of the two indica rice varieties, which could provide potential genetic resources for the improvement of the heat resistance in rice. Considering the diversity of ubiquitination modification, it is worthwhile to further validate and explore the function and regulatory mechanism of the key targets and key pathways. The findings provide valuable insights into the role of ubiquitination in response to high-temperature stress and lay a foundation for further functional analysis of lysine ubiquitination in rice.

    Author contributions

    The authors confirm contribution to the paper as follows: study conception and design: Bao J, Pang Y; data collection: Pang Y; analysis and interpretation of results: Pang Y; draft manuscript preparation: Ying Y; Revised manuscript preparation: Ying Y, Pang Y, Bao J. All authors reviewed the results and approved the final version of the manuscript.

    Data availability

    The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

    Acknowledgments

    This work was financially supported by the AgroST Project (NK2022050102) and Zhejiang Provincial Natural Science Foundation (LZ21C130003).

  • The authors declare that they have no conflict of interest.

  • [1] Boyd LA, Ridout C, O'Sullivan DM, Leach JE, Leung H. 2013. Plant-pathogen interactions: disease resistance in modern agriculture. Trends in Genetics 29:233−40 doi: 10.1016/j.tig.2012.10.011

    CrossRef   Google Scholar

    [2] Bigeard J, Colcombet J, Hirt H. 2015. Signaling mechanisms in pattern-triggered immunity (PTI). Molecular Plant 8:521−39 doi: 10.1016/j.molp.2014.12.022

    CrossRef   Google Scholar

    [3] Lorang J. 2018. Necrotrophic exploitation and subversion of plant defense: a lifestyle or just a phase, and implications in breeding resistance. Phytopathology 109:332−46 doi: 10.1094/PHYTO-09-18-0334-IA

    CrossRef   Google Scholar

    [4] Mengiste T. 2012. Plant immunity to necrotrophs. Annual Review of Phytopathology 50:267−94 doi: 10.1146/annurev-phyto-081211-172955

    CrossRef   Google Scholar

    [5] Shin S, Zheng P, Fazio G, Mazzola M, Main D, et al. 2016. Transcriptome changes specifically associated with apple (Malus domestica) root defense response during Pythium ultimum infection. Physiological and Molecular Plant Pathology 94:16−26 doi: 10.1016/j.pmpp.2016.03.003

    CrossRef   Google Scholar

    [6] Zhu Y, Shao J, Zhou Z, Davis RE. 2017. Comparative transcriptome analysis reveals a preformed defense system in apple root of a resistant genotype of G. 935 in the absence of pathogen. International Journal of Plant Genomics 2017:8950746 doi: 10.1155/2017/8950746

    CrossRef   Google Scholar

    [7] Zhu Y, Shao J, Zhou Z, Davis RE. 2019. Genotype-specific suppression of multiple defense pathways in apple root during infection by Pythium ultimum. Horticulture Research 6:10 doi: 10.1038/s41438-018-0087-1

    CrossRef   Google Scholar

    [8] Zhu Y, Li G, Singh J, Khan A, Fazio G, et al. 2021. Laccase directed lignification is one of the major processes associated with the defense response against Pythium ultimum infection in apple roots. Frontiers in Plant Science 12:629776 doi: 10.3389/fpls.2021.629776

    CrossRef   Google Scholar

    [9] Nicholson RL, Hammerschmidt R. 1992. Phenolic compounds and their role in disease resistance. Annual Review of Phytopathology 30:369−89 doi: 10.1146/annurev.py.30.090192.002101

    CrossRef   Google Scholar

    [10] Vance CP, Kirk TK, Sherwood RT. 1980. Lignification as a mechanism of disease resistance. Annual Review of Phytopathology 18:259−88 doi: 10.1146/annurev.py.18.090180.001355

    CrossRef   Google Scholar

    [11] Miedes E, Vanholme R, Boerjan W, Molina A. 2014. The role of the secondary cell wall in plant resistance to pathogens. Frontiers in Plant Science 5:358 doi: 10.3389/fpls.2014.00358

    CrossRef   Google Scholar

    [12] Balasubramanian VK, Rai KM, Thu SW, Hii MM, Mendu V. 2016. Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development. Scientific Reports 6:34309 doi: 10.1038/srep34309

    CrossRef   Google Scholar

    [13] Yang C, Liang Y, Qiu D, Zeng H, Yuan J, et al. 2018. Lignin metabolism involves Botrytis cinerea BcGs1-induced defense response in tomato. BMC Plant Biology 18:103 doi: 10.1186/s12870-018-1319-0

    CrossRef   Google Scholar

    [14] Arcuri MLC, Fialho LC, Vasconcellos Nunes-Laitz A, Fuchs-Ferraz MCP, Wolf IR, et al. 2020. Genome-wide identification of multifunctional laccase gene family in Eucalyptus grandis: potential targets for lignin engineering and stress tolerance. Trees 34:745−58 doi: 10.1007/s00468-020-01954-3

    CrossRef   Google Scholar

    [15] Lee MH, Jeon HS, Kim SH, Chung JH, Roppolo D, et al. 2019. Lignin-based barrier restricts pathogens to the infection site and confers resistance in plants. The EMBO journal 38:e101948 doi: 10.15252/embj.2019101948

    CrossRef   Google Scholar

    [16] Boudet AM, Lapierre C, Grima-Pettenati J. 1995. Tansley review No. 80. Biochemistry and molecular biology of lignification. New Phytologist 129:203−36 doi: 10.1111/j.1469-8137.1995.tb04292.x

    CrossRef   Google Scholar

    [17] Boerjan W, Ralph J, Baucher M. 2003. Lignin biosynthesis. Annual Review of Plant Biology 54:519−46 doi: 10.1146/annurev.arplant.54.031902.134938

    CrossRef   Google Scholar

    [18] Zhao Q, Dixon RA. 2011. Transcriptional networks for lignin biosynthesis: more complex than we thought? Trends in Plant Science 16:227−33 doi: 10.1016/j.tplants.2010.12.005

    CrossRef   Google Scholar

    [19] Chaurasia PK, Yadav RSS, Yadava S. 2013. A review on mechanism of laccase action. Research & Reviews in BioSciences 7:66−71

    Google Scholar

    [20] Voxeur A, Wang Y, Sibout R. 2015. Lignification: different mechanisms for a versatile polymer. Current Opinion in Plant Biology 23:83−90 doi: 10.1016/j.pbi.2014.11.006

    CrossRef   Google Scholar

    [21] Vanholme R, Demedts B, Morreel K, Ralph J, Boerjan W. 2010. Lignin biosynthesis and structure. Plant Physiology 153:895−905 doi: 10.1104/pp.110.155119

    CrossRef   Google Scholar

    [22] Bhuiyan NH, Selvaraj G, Wei Y, King J. 2009. Role of lignification in plant defense. Plant signaling & behavior 4:158−59 doi: 10.4161/psb.4.2.7688

    CrossRef   Google Scholar

    [23] Xu L, Zhu L, Tu L, Liu L, Yuan D, et al. 2011. Lignin metabolism has a central role in the resistance of cotton to the wilt fungus Verticillium dahliae as revealed by RNA-Seq-dependent transcriptional analysis and histochemistry. Journal of Experimental Botany 62:5607−21 doi: 10.1093/jxb/err245

    CrossRef   Google Scholar

    [24] Giardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, et al. 2010. Laccases: a never-ending story. Cellular and Molecular Life Sciences 67:369−85 doi: 10.1007/s00018-009-0169-1

    CrossRef   Google Scholar

    [25] Mayer AM, Staples RC. 2002. Laccase: new functions for an old enzyme. Phytochemistry 60:551−65 doi: 10.1016/S0031-9422(02)00171-1

    CrossRef   Google Scholar

    [26] Pilon M. 2017. The copper microRNAs. New Phytologist 213:1030−35 doi: 10.1111/nph.14244

    CrossRef   Google Scholar

    [27] Janusz G, Pawlik A, Świderska-Burek U, Polak J, Sulej J, et al. 2020. Laccase properties, physiological functions, and evolution. International Journal of Molecular Sciences 21:966 doi: 10.3390/ijms21030966

    CrossRef   Google Scholar

    [28] Turlapati PV, Kim K-W, Davin LB, Lewis NG. 2011. The laccase multigene family in Arabidopsis thaliana: towards addressing the mystery of their gene function (s). Planta 233:439−70 doi: 10.1007/s00425-010-1298-3

    CrossRef   Google Scholar

    [29] Wang J, Feng J, Jia W, Chang S, Li S, et al. 2015. Lignin engineering through laccase modification: a promising field for energy plant improvement. Biotechnology for Biofuels 8:145 doi: 10.1186/s13068-015-0331-y

    CrossRef   Google Scholar

    [30] Ducros V, Brzozowski AM, Wilson KS, Brown SH, Østergaard P, et al. 1998. Crystal structure of the type-2 Cu depleted laccase from Coprinus cinereus at 2.2 Å resolution. Nature Structural Biology 5:310−16 doi: 10.1038/nsb0498-310

    CrossRef   Google Scholar

    [31] Zhu Y, Shin S, Mazzola M. 2016. Genotype responses of two apple rootstocks to infection by Pythium ultimum causing apple replant disease. Canadian Journal of Plant Pathology 38:483−91 doi: 10.1080/07060661.2016.1260640

    CrossRef   Google Scholar

    [32] Zhu Y, Zhao J, Zhou Z. 2018. Identifying an elite panel of apple rootstock germplasm with contrasting root resistance to Pythium ultimum. Journal of Plant Pathology & Microbiology 9:11 doi: 10.4172/2157-7471.1000461

    CrossRef   Google Scholar

    [33] Dodds PN, Rathjen JP. 2010. Plant immunity: towards an integrated view of plant-pathogen interactions. Nature Reviews Genetics 11:539−48 doi: 10.1038/nrg2812

    CrossRef   Google Scholar

    [34] Moore JW, Loake GJ, Spoel SH. 2011. Transcription dynamics in plant immunity. The Plant Cell 23:2809−20 doi: 10.1105/tpc.111.087346

    CrossRef   Google Scholar

    [35] Tsuda K, Somssich IE. 2015. Transcriptional networks in plant immunity. New Phytologist 206:932−47 doi: 10.1111/nph.13286

    CrossRef   Google Scholar

    [36] Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, et al. 2010. The genome of the domesticated apple (Malus× domestica Borkh.). Nature Genetics 42:833−39 doi: 10.1038/ng.654

    CrossRef   Google Scholar

    [37] Daccord N, Celton JM, Linsmith G, Becker C, Choisne N, et al. 2017. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nature Genetics 49:1099−106 doi: 10.1038/ng.3886

    CrossRef   Google Scholar

    [38] Zhu Y, Fazio G, Mazzola M. 2014. Elucidating the molecular responses of apple rootstock resistant to ARD pathogens: challenges and opportunities for development of genomics-assisted breeding tools. Horticulture Research 1:14043 doi: 10.1038/hortres.2014.43

    CrossRef   Google Scholar

    [39] Zhu Y, Zheng P, Varanasi V, Shin S, Main D, et al. 2012. Multiple plant hormones and cell wall metabolism regulate apple fruit maturation patterns and texture attributes. Tree Genetics & Genomes 8:1389−406 doi: 10.1007/s11295-012-0526-3

    CrossRef   Google Scholar

    [40] Ma QH, Zhu HH, Qiao MY. 2018. Contribution of both lignin content and sinapyl monomer to disease resistance in tobacco. Plant Pathology 67:642−50 doi: 10.1111/ppa.12767

    CrossRef   Google Scholar

    [41] Mazzola M. 1997. Identification and pathogenicity of Rhizoctonia spp. isolated from apple roots and orchard soils. Phytopathology 87:582−87 doi: 10.1094/PHYTO.1997.87.6.582

    CrossRef   Google Scholar

    [42] Letunic I, Doerks T, Bork P. 2015. SMART: recent updates, new developments and status in 2015. Nucleic Acids Research 43:D257−D260 doi: 10.1093/nar/gku949

    CrossRef   Google Scholar

    [43] Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, et al. 2020. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular plant 13:1194−202 doi: 10.1016/j.molp.2020.06.009

    CrossRef   Google Scholar

    [44] Zhou Z, Cong P, Tian Y, Zhu Y. 2017. Using RNA-seq data to select reference genes for normalizing gene expression in apple roots. PLoS One 12:e0185288 doi: 10.1371/journal.pone.0185288

    CrossRef   Google Scholar

    [45] Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCᴛ method. Methods 25:402−8 doi: 10.1006/meth.2001.1262

    CrossRef   Google Scholar

    [46] Lloyd SR, Schoonbeek HJ, Trick M, Zipfel C, Ridout CJ. 2014. Methods to study PAMP-triggered immunity in Brassica species. Molecular Plant-Microbe Interactions 27:286−95 doi: 10.1094/MPMI-05-13-0154-FI

    CrossRef   Google Scholar

  • Cite this article

    Zhu Y, Zhou Z. 2021. The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection. Fruit Research 1: 12 doi: 10.48130/FruRes-2021-0012
    Zhu Y, Zhou Z. 2021. The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection. Fruit Research 1: 12 doi: 10.48130/FruRes-2021-0012
    shu

Figures(5)  /  Tables(2)

Download PDF

Article Metrics

Article views(5332) PDF downloads(865)

Other Articles By Authors

ARTICLE   Open Access    

The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection

  • 1.

    United States Department of Agriculture, Agricultural Research Service, Tree Fruit Research Laboratory, Wenatchee, WA 98801, USA

  • 2.

    Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences, Zhengzhou, Henan 450000, China

  • Received: 01 October 2021
  • Accepted: 10 November 2021
  • Published online: 23 November 2021
Fruit Research  1,  Article number: 12  (2021)  |  Cite this article

Abstract: Plant resistance responses against invading pathogens require a coordinated set of cellular processes to optimize the effective defense output. Previous transcriptome analyses have identified a multi-phase and multi-layered defense strategy in apple root towards infection from a necrotrophic oomycete pathogen Pythium ultimum. Among the identified apple genes, members of the laccase gene family represent an actively regulated group at both transcriptional and posttranscriptional levels. In this study, several apple laccase genes were selected for further analyses on their sequence features and potential roles during defense activation in apple roots. Their bioinformatic specifics, genotype-specific induction, and lignin deposition patterns during pathogen infection were examined between two apple rootstock genotypes, a resistant O3R5-#161 and a susceptible O3R5-#132. The sequences these laccase genes contain the conserved cu-oxidase domains and the characteristic gene structures with MdLAC7a as an exception. While MdLAC3 and MdLAC5 showed a partial induction to P. ultimum infection, both MdLAC7a and MdLAC7b genes demonstrated consistent and high-level inducibility. Moreover, MdLAC7b exhibited a differential expression pattern, with a higher expression in the resistant O3R5-#161. Lignin deposition appeared to be stronger in the infected root of the resistant genotype compared to that of the susceptible one. The efficient lignin biosynthesis and deposition at the initial stage of infection is crucial for impeding the progression of this fast-growing necrotrophic pathogen. Future study regarding the role of MdLAC7b, including the transgenic manipulation and biochemical analysis, should provide more definitive evidence for its contribution to resistance to P. ultimum infection.

    HTML

    INTRODUCTION

    • The genotype-specific patterns of defense activation will critically govern the outcome from interactions between plant and its invading pathogens[1−3]. It is well acknowledged that plant responses to infection from necrotrophic pathogens include multi-phased and multi-layered defense mechanisms[4]. Recently, the molecular defense networks in apple roots activated by infection from a soilborne necrotrophic pathogen Pythium ultimum have been systematically investigated through a series of transcriptome analyses[5−8]. Apple laccase genes were identified as a primary component among the transcriptomic changes during defense activation in apple roots[5,7,8]. The role of laccase directed lignin biosynthesis and cell wall fortification to plant disease resistance has been proposed for several decades in different pathosystems[9,10]. More recently, transcriptomic and proteomic analyses have provided the direct and detailed molecular evidence regarding the functions of laccase genes and lignification processes in relation to genotype-specific resistance in several crops[11−15].

      Lignins are heteropolymers covalently associated with polysaccharides in plant cell walls[10,16]. Lignin biosynthesis is the result of oxidative polymerization of three p-hydroxycinnamyl (p-coumaryl, -coniferyl and -sinapyl) alcohols which is mediated by both laccases and peroxidases[17]. The lignification process is crucial for several aspects of plant physiologies including preserving the integrity of the plant cell wall and imparting strength to vascular tissues[17−20]. Additionally, accumulating evidence indicates that lignified cell wall serves as physical barriers against invasions of phytopathogens and other environmental stresses[15,21−23]. As lignification is a non-reversible process, the pathways of monolignol biosynthesis, polymerization and lignin deposition are tightly controlled during development and response to stresses[21,24,25]. For the less investigated pathosystem between apple root and P. ultimum, the contribution of apple laccase encoding genes to root resistance traits remains elusive.

      Laccases (EC 1.10.3.2) are glycosylated multi-copper oxidases (MCOs) that serve as electron transfer proteins and catalyze the oxidation of a variety of aromatic and phenolic compounds[26,27]. The presence of cupredoxin-like domains in the sequences of all MCOs, including polyphenol oxidases (PPOs) and ascorbate oxidases, allows oxygen to be reduced to water without producing harmful byproducts[27,28]. Despite their wide taxonomic distribution (bacteria, fungi, plants, and insects) and diversity of substrates, laccases have a common molecular architecture[27,29]. Plant laccase is composed of three cupredoxin domains that include one mononuclear and one trinuclear copper center[24,30]. The small, 10−20 kDa, cupredoxin-like domain possesses relatively simple 3D structures, primarily composed of beta sheets and turns[27]. Plant laccase activity has been implicated in a wide spectrum of biological activities and, in particular, plays a key role in morphogenesis, development and lignin metabolism[20]. Accumulated evidence suggests the roles of laccase-directed lignin deposition for plant resistance[11,13,15,23]. However, the specific genes and their detailed physiological or biochemical roles remain largely unclear, as plants usually express multiple laccase genes in most tissues, and often with overlapping expression profiles and functional redundancy[12].

      It has been hypothesized that cell wall lignification at the infection sites, through impeding pathogen penetration, offers time or opportunity for plant cells to mount a more effective defense activation such as biosynthesis of phytoalexin and resistance proteins[10]. The intensity and swiftness of tissue lignification at the early stage of infection could be pivotal in differentiating resistance and susceptibility to infection from a fast-growing necrotrophic pathogen like P. ultimum. Based on our recent transcriptome analyses[5−7], including miRNA profiling and degradome sequencing[8], laccase directed lignification appeared to be an integral part of the defense system in apple root towards P. ultimum infection. The objective of the current study is to advance our knowledge regarding the bioinformatic features of these identified laccase encoding genes, the genotype-specific expressions patterns, as well as lignin deposition patterns in apple root tissues in response to P. ultimum infection. Results from this study will be essential to identify target genes for subsequent functional analysis including transgenic expression manipulation.

    RESULTS

      Induced apple laccase encoding genes during P. ultimum infection of apple roots

    • As part of the effort to elucidate the molecular regulation of apple root resistance to P. ultimum infection, three transcriptome analyses have been performed sequentially[5,7,8]. The laccase encoding genes are among the notable groups in our first transcriptome analysis which was aimed to determine the timeline of transcriptome changes in apple root in response to P. ultimum infection[5,31]. The subsequent comparative transcriptome analysis revealed that several gene models encoding laccases appeared to be differentially induced between a resistant apple rootstock genotype of G.935 and a susceptible genotype of B.9 in response to P. ultimum infection[7]. Among them, four gene models annotated as Arabidopsis laccase 7 homologues exhibited upregulation in response to P. ultimum infection (Fig. 1). Two of them, MDP0000168850 and MDP0000294031 were highly expressed based on the comparison of normalized transcript levels between mock inoculated roots (C for control) and P. ultimum inoculated (denoted as P) at three time points of 24, 48 and 72 h post inoculation (hpi). The expression of MDP0000168850 appeared to be at relatively comparable induction levels between both genotypes. In contrast, the expression of MDP0000294031 demonstrated a genotype-specific pattern, i.e., a higher expression level was specifically observed in the root of a resistant G.935. The consistent upregulation of these laccase genes, particularly the earlier (at 24 hpi), and stronger expression of MDP0000294031 in the resistant G.935, suggested the potential roles of these laccase genes during defense activation in apple root towards P. ultimum infection.

      Figure 1.  Expression levels of four gene models which encode MdLAC7s in apple root. Images in the top panel shows the resistance phenotypes at 7 dpi for both susceptible B.9 and resistant G.935 apple rootstock genotypes. The heatmap demonstrates the normalized transcript levels between mock inoculated roots (C for control) and P. ultimum inoculated (denoted as P) at three time points of 24, 48 and 72 h post inoculation (hpi) for all four gene models. The levels of expression per genotype/treatment are indicated as the coloration according to legend. The functional annotations of these four genes are according to predicted coding genes of the Malus × domestica Whole Genome v3.0.a1 (www.rosaceae.org/analysis/162).

      In a more recent study using microRNA profiling and degradome sequencing, four apple laccase genes were identified as the cleavage targets of a microRNA, i.e., miR397b, between two groups of resistant and susceptible apple rootstock genotypes in response to P. ultimum infection[8]. Firstly, miR397b was shown to be differentially expressed between resistant and susceptible group (three genotypes in each group), with significantly downregulated expression in roots of three resistant genotypes in response to P. ultimum infection. Secondly, the degradome sequencing data indicated that MdLAC-3, -5 and -7 encoding genes are the cleavage targets of miR397b. Thirdly, the cleavage activity of HF27792, or a gene encoding MdLAC7b, exhibited differential cleavage intensity between the resistant and susceptible genotype groups in response to P. ultimum infection (Table 1). The post-transcriptional regulation of laccase gene expression also suggested the potentially critical roles of laccase and root tissue lignification during defense activation to P. ultimum infection.

      Table 1.  Laccase genes targeted by specific microRNA397b during P. ultimum infection by degradome sequencing and microRNA profiling.

      Gene IDAnnotationTargeted byRelative cleavage intensity
      L1L2L3
      HF40034MdLAC 3miR397b15N/AN/A
      HF23917MdLAC 5miR397b211N/A
      HF26400MdLAC 7amiR397b30N/AN/A
      HF27792MdLAC 7bmiR397b45N/A82

      The IDs of these target gene are based on the Malus x domestica HFTH1 Whole Genome v1.0 of an anther-derived homozygous line HFTH1 (www.rosaceae.org/species/malus_x_domestica_HFTH1/genome_v1.0). Relative cleavage intensity is referred to the detected tag abundance in three degradome libraries, where L1 (or library #1) represents the data from the degradome library constructed from the pooled RNA samples of mock inoculation (of both resistant and susceptible genotypes), L2 (or library #2) represents the data from the degradome library constructed from the pooled RNA samples of P. ultimum inoculated root tissues from three resistant genotypes, L3 (or library #3) represents data from the degradome library constructed from the pooled RNA samples of P. ultimum inoculated root tissues of susceptible genotypes.

      Bioinformatic characteristics of these induced laccase genes in apple roots

    • The sequence features for these root-expressed members of the laccase gene family, including their intron/exon numbers, domain compositions, cis-elements in the promoter region, and their genomic locations are summarized in Fig. 2. Except MdLAC7a, these laccase-encoding genes are about 2,300−2,500 bp in length and contain 5−6 exons (Fig. 2a). Each gene was predicted to contain three conserved Cu oxidase domains (Fig. 2b). As an exception, MdLAC7a (HF26400) has an additional long exon, which is predicted to encode a PNGaseA domain (Fig. 2a & b ). At the promoter region (2 Kb region before the starting codon) various binding sites were detected, which suggest the putative regulatory roles of various hormones (ABA, JA, and Auxin) and transcription factors (MYB, MYC and WRKY) on the expression of these laccase genes (Fig. 2c). Each of these laccase encoding genes is located on a different chromosome (Fig. 2d).

      Figure 2.  Bioinformatic characteristics of root-expressed apple laccase genes. (a) Numbers and position of introns and exons for each gene. (b) Domain composition contained in their predicted amino acid sequences. (c) Cis elements within 2 Kb of promoter sequences. (d) Location of these laccase encoding genes on apple chromosomes.

      The genotype-specific expression patterns during P. ultimum infection

    • The genotype-specific expression patterns of these laccase-encoding genes were examined between a resistant O3R5-#161 and a susceptible O3R5-#132 during P. ultimum infection. Both MdLAC3 and MdLAC5 showed a slight induction and mostly at 48 hpi. The expression of MdLAC7a was upregulated in both genotypes with a relatively similar intensity. Noticeably, MdLAC7b exhibited a differential expression pattern between these two genotypes (Fig. 3). Specifically, a more consistent and stronger expression was observed in the roots of a resistant genotype O3R5-#161, as it was compared with that in the susceptible genotype O3R5-#132. The elevated expression for both MdLAC3 and MdLAC5 in control tissues (C0 and C00), or before exposure to P. ultimum, possibly indicated that these two genes are more responsive to abiotic stress conditions such as transplant processes or mechanical handling during the infection process.

      Figure 3.  Expression patterns of four apple laccase genes in roots of two apple rootstock genotypes. The left panels, (a, c, e & g) denote the expression of MdLAC3, MdLAC5, MdLAC7a and MdLAC7b, respectively, in root tissue of a susceptible O3R5-#132; The right panels, (b, d, f & h) denote the expression of MdLAC3, MdLAC5, MdLAC7a and MdLAC7b, respectively, in root tissue of a resistant O3R5-#161. Blue bars represent expression level in mock-inoculated control tissues; and orange bars represent expression levels in P. ultimum-infected root tissues. Values on the Y-axis denote the relative expression level, using value of control tissue for MdLAC3 at 161-24 hpi as a calibrator. Labels on the X-axis indicate the tissue collection including five time points for control tissues and three timepoints after P. ultimum inoculation. For each genotype, C00 denotes the root tissues in culture medium (or two weeks before inoculation), and C0 denotes root tissue after one-week in-soil acclimation or one week before mock inoculation. The numbers of 24, 48 and 72 indicate the timepoints of hours post (mock- or P. ultimum) inoculation (hpi). Values represents the averages and sd of three technical repeats of qRT-PCR analyses for each of the two biological replicates.

      Sequence features, microRNA cleavage site and three-dimensional structure of MdLAC7b

    • The differential response of MdLAC7b between resistant O3R5-#161 and susceptible O3R5-#132 added evidence for its roles contributing to apple root resistance to P. ultimum infection. The specifics of amino acid sequences, its known post-transcriptional regulation by microRNA397b mediated cleavage, and the predicated three-dimensional folding pattern of its polypeptides as well as copper ion binding sites were further investigated. A signal peptide at the N-terminus was identified indicating MdLAC7b is a secreted protein like many other plant laccases[24,27]. Three cu-oxidase domains (highlighted in blue, yellow and green, respectively) were predicted, as well as 11 asparagines (N, in red) predicted to be the sites for N-glycosylation, which are responsible for copper retention, enzyme stability and activity (Fig. 4a). The site where the miR397b attacks was located at the 5' region of the large exon of MdLAC7b based on the data from a recent degradome sequencing analysis[8] (Fig. 4b). The folding pattern of a three-dimensional structure of MdLAC7b and the predicated ligands of three copper ions was predicted using Discovery studio 4.1 software (Fig. 4c). Cu1 is coordinated with two histidines, one cysteine and one leucine, Cu2 is coordinated by another two histidines and one H2O ligand, while six histidines coordinate the Cu3 pair in a symmetrical manner, with a bridging OH ligand.

      Figure 4.  Sequence features and structure modeling of MdLAC7b. (a) The amino acid sequence of MdLAC7b. The protein consists of 557 amino acids. It has a signal peptide (underlined) at the N-terminal predicted by SignalP 4.1 Server, and three conserved Cu-oxidase domains were identified (highlighted in blue, yellow and green, respectively) according to Pfam. Twelve asparagines predicted to be N-glycosylated by NetNGlyc 1.0 Server were indicated in red. (b) The specificity of MiR397b mediated cleavage of MdLAC7b transcript was revealed by degradome sequencing in a previous study[8]. The blue boxes represent exons, and the horizontal lines represent introns. The white box represents 5′-UTR, while the white arrow represents 3′-UTR. Solid lines indicate the Watson–Crick pairing and the oval indicates G:U wobble pairing between MdLAC7b target sequence and the complementary miRNA397b sequence. (c) Left panel, three-dimensional structure of MdLAC7b predicted using Discovery studio 4.1 software. Upper right panel, the view of ligands at the copper center of MdLAC7b. Lower right panel, Cu1 is coordinated with two histidines, one cysteine and one leucine, Cu2 is coordinated by another two histidines and one H2O ligand, while six histidines coordinate the Cu3 pair in a symmetrical manner, with a bridging OH ligand.

      Lignin deposition patterns between resistant and susceptible genotypes and in response to infection

    • The patterns of lignin deposition in apple root tissues, before and after pathogen infection, were examined using Wiesner's staining on hand-sectioned root tissues. Two apple rootstock genotypes of O3R5-#161 and O3R5-#132, which are known to be resistant or susceptible to P. ultimum infection, respectively[32]. Both genotypes demonstrated the easily detectable lignin staining in vascular tissues even before pathogen exposure (Fig. 5a & c). Under pathogenic pressure, the enhanced lignification in infected root tissues was observed for both genotypes (Fig. 5b & d). Furthermore, several spots can be easily identified at the outer layer of the root cortex tissue of the resistant genotype #161, which appeared to be enhanced tissue lignification (Fig. 5d, arrows). Specific root sections at a similar position or the distance from root tips, were selected for sectioning for better comparability across genotypes and treatments.

      Figure 5.  The genotype-specific patterns of lignification in apple root tissues. Wiesner staining of hand-sectioned root tissue was carried out at 72 hpi on selected root branches from both treatments (mock-inoculation and P. ultimum infection) and for both genotypes. (a) The representative image from a susceptible cultivar O3R5-#132 with mock-inoculation; (b) The representative image from a susceptible cultivar O3R5-#132 after P. ultimum inoculation; (c) The representative image from a resistant cultivar O3R5-#161 with mock-inoculation; (d) The representative image from a resistant cultivar O3R5-#161 after P. ultimum inoculation. Root segments at a similar position, or equal distance from the root tip, were selected for sectioning for a better comparison between treatments and genotypes. The bar at the lower part of panel (d) represents a length of 100 µm.

    DISCUSSION

    • Plants are known to be equipped with an array of defense mechanisms to protect themselves from infection[4,33−35], however, a unique combination of these mechanisms are activated in a specific organ or tissue type to the infection even from the same pathogen. Among various biochemical pathways and cellular processes within the defense networks in apple root, which were revealed by three transcriptome analyses, expression regulation of laccase genes and perhaps the lignification of root tissues appeared to be a focal point. Their differential induction between resistant and susceptible apple rootstock genotypes likely play a key role of defense activation at the early stages of P. ultimum infection. Large-scale and high-throughput genomic approaches, such as transcriptome analyses, offer the advantage of generating a global view over the molecular defense responses in apple root[5,7,8]. However, the data from such approaches are potentially error-prone in terms of gene identity and its verifiable expression pattern. This is particularly necessary for those species with more complex genomes such as apple[36,37].

      The results from the current study demonstrated that these laccase genes contain the conserved cu-oxidase domains as well as the typical laccase gene structure, and they are located on different chromosomes. Their distinct expression patterns may be attributed to the various cis elements at the promoter regions and/or post-transcriptional regulation schemes such as selective cleavage by microRNAs. Genotype-specific expression patterns suggested that MdLAC7b likely play a critical role contributing to the resistance trait. The sequence features and three-dimensional modeling of MdLAC7b, based on its predicted protein sequences, added details related to its proposed functions such as its trafficking to the apoplast, Cu ion binding sites and cleavage site by miR397b. The genotype-specific lignin deposition patterns added additional experimental evidence potentially connecting the laccase directed lignification process with apple root resistance traits to P. ultimum infection.

      It can be argued that a quicker and more efficient lignin deposition at the early stage of infection is crucial to impede or slow-down the initial progression of the fast-growing P. ultimum. Such a passive barrier may physically block or delay the disruptive effect of toxins, enzymes and/or effector from this pathogen. Even with such a basal defense strategy, a more robust cellular defense activation can be fully developed for ultimately defeating the pathogen invasion. On the other hand, laccase directed lignin deposition likely only functions as one of the many components in a comprehensive and complex defense system. The effective resistance or tolerance to infection from a necrotrophic pathogen like P. ultimum relies on several factors functioning sequentially, additively, or synergistically to achieve the optimized defense output[4,5,7,38,39]. For example, the metabolites from the phenylpropanoid pathway possesses at least two major roles in host resistance to necrotrophic pathogens, i.e., lignin deposition and phytoalexin accumulation. The biosynthesis of monolignols, the precursor for lignin formation, is part of the phenylpropanoid pathway with a direct impact on the lignification process[20,40]. As observed in many other pathosystems, activation of the phenylpropanoid pathway is one of the most notable transcriptomic changes upon P. ultimum infection in apple roots[5,7,8]. In our previous transcriptome datasets, genes encoding biosynthesis enzymes in several key steps of the phenylpropanoid pathway, such as PAL, CHS and CAD, were almost uniformly upregulated in apple roots upon P. ultimum infection[5,7]. Additionally, several families of TFs (transcription factors) such as MYBs NACs and MYCs, as well as transporter-encoding genes such as those for ABC transporter or MATE family members, showed a quicker, stronger and more consistent upregulation in the root of a resistant apple rootstock genotype as compared with that in susceptible genotypes[7,8]. Therefore, the variation at the biosynthesis and transport of monolignols may also contribute to the lignification process, in addition to the elevated upregulation of laccase gene expression per se.

      The preliminary data from the current study is consistent with the notion that apple laccase genes and the lignin biosynthesis are an important part of the defense network in apple root towards P. ultimum infection. Further studies are needed to substantiate the identity of MdLAC7b as a primary candidate which may contribute to the variable resistance responses between apple rootstock genotypes. Many questions need to be answered related to the detailed functional roles of MdLAC7b to apple root defense activation. What is the critical timeline of lignin deposition in infected root tissues? Is MdLAC7b acting alone or is it a limiting factor to form a functional enzyme complex? How do other regulatory points in the phenylpropanoid pathway such as TFs (MYB, MYC, TCP…) affect the lignification process during P. ultimum infection? Does the relationship between the observed resistance response and lignin deposition apply to other apple rootstock genotypes (beyond O3R5 genetic background)? What is the potential connection between the observed intensity at the lignified vascular tissue and the over-flowed diffusible phenolic compounds or phytoalexins? Maybe the more relevant question is: how does lignin deposition at the initial phase of infection facilitate the effective defeat of the pathogenic arsenal? Further experimental evidence from carefully designed experiments is required for a better understanding on the roles of laccase directed lignification during defense activation to P. ultimum infection. Among them, transgenic manipulation of MdLAC7b expression and associated assays to measure the changes at biochemical and enzymatic levels should generate more definitive answers to these questions.

    MATERIALS AND METHODS

      Preparation of apple plants by tissue culture procedure

    • Tissue culture based micro-propagation procedures were used to obtain individual apple plants for infection assays and tissue collection as described previously[31]. Both B.9 and G.935 are widely used commercial apple rootstock genotypes, while O3R5-#161 and O3R5-#132 apple rootstock genotypes are the progenies from a rootstock cross population between 'Ottawa 3' and 'Robusta 5' (O3R5). A synchronized micro-propagation process was carried out to generate apple plants with non-contaminated root tissues and equivalent developmental stages for both genotypes. Four weeks after root induction in tissue culture medium was followed by 'in-soil' acclimation for one week in a growth chamber allowing further root tissues differentiation before P. ultimum inoculation. To minimize transplanting shock from tissue culture medium to soil conditions, a transparent 7'' Vented Humidity Dome (Greenhouse Megastore, Danville, IL) was placed on top of a 10 × 20-inch flat tray holding the pots for retaining humidity. An identical watering schedule of every other day was applied to both plant genotypes and treatments, i.e., mock inoculation and P. ultimum inoculation.

      Inoculum preparation, infection procedure and root tissue collection

    • The P. ultimum isolate used in this study originates from the roots of 'Gala'/M26 apple grown in Moxee, WA, USA[41]. The procedures of inoculum preparation, quantification and root-dip inoculation were as described previously[31]. Mock-inoculated control plants and P. ultimum inoculated plants were transplanted in individual 4" diameter pot and placed in separate trays. Root tissues from mock inoculated and P. ultimum inoculated plants for both genotypes were sampled at designated timepoints according to experimental design. For hand-sectioning, apple roots were carefully excavated from soil, rinsed under running tap water, and floated in tap water until root branches were selected for sectioning. For gene expression analysis, root tissues were separated from aboveground tissues and flash frozen using liquid nitrogen and stored at −80 °C until RNA isolation. Pooled root tissues were collected from at least three individual plants per genotypes and/or treatments.

      Total RNA isolation and high-throughput mRNA sequencing

    • Total RNA isolation was carried out following the lithium-chlorite method previously described by Zhu et al.[31]. Root tissues of both resistant O3R5-#161 and susceptible O3R5-#132 were represented by two biological replicates, and each replicate included the pooled root tissues from three plants. RNA quantity was determined using a Nanodrop spectrophotometer (ND-1000; Thermo Fisher Scientific) and RNA integrity was confirmed by RNA gel.

      Identification of candidate laccase genes and their bioinformatic analyses

    • The candidate apple laccase (MdLAC) genes were selected based on the analyses of previous transcriptome datasets. The raw RNA-Seq data were deposited in the public domain with the accession numbers SRP117760 and SRP295189. The genomic sequences, the coding region, and the predicted amino acid sequences of these four laccase genes were downloaded from GDR (www.rosaceae.org), which hosts the apple genome sequences. SMART (http://smart.embl-heidelberg.de) was used to identify the conserved domains for selected apple laccase genes[42]. Gene structures were extracted using TBtools[43]. The protein sequence of HF27792 was used as a query to blast against NCBI, and the Zea mays Laccase 3 (PDB ID: 6KLG) was used as a template, as it shared the highest sequence identity (46.08%) with HF27792. Sequence alignment was performed between HF27792 and 6KLG through Align Sequence to Templates module of Discovery Studio 4.1 software to obtain three-dimensional spatial structure of HF27792 encoded protein. Since the target protein and the template protein were quite conserved in the central Cu2+ binding region, the Cu2+ and oxygen molecules in the template were placed into the corresponding positions of the target structure. Two methods, Ramachandran Plot and Profiles-3D, from Discovery studio 4.1 software were used to evaluate the reliability of the model.

      Genotype-specific expression patterns of selected apple laccase genes by RT-qPCR

    • The total RNA was treated with DNase I (Qiagen, Valencia, CA) and then purified with RNeasy cleanup columns (Qiagen, Valencia, CA). Two micrograms of DNase-treated RNA was used to synthesize first-strand cDNA using SuperScriptTM II reverse transcriptase (Invitrogen, Grand Island, NY) and poly dT (Operon, Huntsville, AL) as the primer. The RT-qPCR procedure was performed as previously reported[7]. The target gene expression was normalized to that of a previously validated internal reference gene (MD02G1221400) specific for gene expression analysis in apple roots[44] using the 2−∆∆Cᴛ method (the comparative Ct method)[45]. Primer sequences for laccase genes and internal reference gene for qRT-PCR analysis are listed in Table 2.

      Table 2.  Primer sequences of laccase and reference genes for qRT-PCR analysis.

      Gene IDsGene descriptionPrimers F/R [5'-3']
      HF40034Laccase-3F-5' CAACCCCAGAACAGATCCAG 3'
      R-5' AAACCCAGGAAGAGATGTGC 3'
      HF23917Laccase-5F-5' TGGGCAGTCATTCGATTTGT 3'
      R-5' AACAAAGAGGCAGATCCACC 3'
      HF26400Laccase-7aF-5' TAATCCGCAAGTACGCAACA 3'
      R-5' CAGATCAAGTGGTGGTGGAG 3'
      HF27792Laccase-7b5'- TCCTACACGACTCCTTATGAT -3'
      5'- GAGATTGGTGAGGAACTTATGG -3'
      MD02G1221400Reference geneF-5' ATGGAGAGATGGAATGGCAAAG 3'
      R-5' GTGAGCATCGGATCCCATTTAG 3'

      Lignin deposition patterns by Wiesner staining

    • The Wiesner staining method[46] on hand-sectioned apple root tissues was used to detect the lignin deposition patterns between genotypes, and before and after the exposure to P. ultimum. At least three plants were used per genotype and treatment. For comparability between genotypes and treatments, the root segments at a similar position (or distance from the root tips), preassembly at the equivalent developmental stages were selected for tissue sectioning.

      Acknowledgments
      • This work was supported by the USDA-ARS base fund. The authors would like to thank Soon-Li Teh and Amanda Roelant for language editing and reviewing the manuscript.
      Conflict of interest
      • The authors declare that they have no conflict of interest.
      Rights and permissions
      • Copyright: © 2021 by the author(s). Exclusive Licensee Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (5)  Table (2) References (46)
  • About this article
    Cite this article
    Zhu Y, Zhou Z. 2021. The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection. Fruit Research 1: 12 doi: 10.48130/FruRes-2021-0012
    Zhu Y, Zhou Z. 2021. The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection. Fruit Research 1: 12 doi: 10.48130/FruRes-2021-0012
    shu

Catalog

  • Html

  • Introduction
  • Results

  • Induced apple laccase encoding genes during p. ultimum infection of apple roots

  • Bioinformatic characteristics of these induced laccase genes in apple roots

  • The genotype-specific expression patterns during p. ultimum infection

  • Sequence features, microrna cleavage site and three-dimensional structure of mdlac7b

  • Lignin deposition patterns between resistant and susceptible genotypes and in response to infection

  • Discussion
  • Materials and methods

  • Preparation of apple plants by tissue culture procedure

  • Inoculum preparation, infection procedure and root tissue collection

  • Total rna isolation and high-throughput mrna sequencing

  • Identification of candidate laccase genes and their bioinformatic analyses

  • Genotype-specific expression patterns of selected apple laccase genes by rt-qpcr

  • Lignin deposition patterns by wiesner staining

  • Acknowledgments
  • Conflict of interest
  • Rights and permissions
  • About this article
logo

Contents

Policies

Services

Partnerships

© 2025 Maximum Academic Press, except Open Access articles. MAP is a member of ALPSP, COPE, CrossRef, cOAlition S, OASPA and STM.

Privacy Policy  |  Site Map  |  Terms and Conditions

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return