ARTICLE   Open Access    

Characterization of Epicoccum isolates obtained from Argentinean sorghum grain samples

More Information
  • Received: 04 November 2023
    Revised: 13 March 2024
    Accepted: 21 March 2024
    Published online: 16 April 2024
    Studies in Fungi  9 Article number: e003 (2024)  |  Cite this article
  • Sorghum has numerous agronomic advantages, a great economic importance in food production and various industrial applications. Its consumption has increased in the last ten years and probably its importance may even increase in the future, considering its relationship with global warming since this plant is less demanding with water. However, its productivity is affected by various fungal diseases with the production of mycotoxins that cause great economic losses. Alternaria, Epicoccum and Pyricularia genera are the main fungal contaminants in sorghum grains, and recognized producers of tenuazonic acid, a mycotoxin previously found in assayed sorghum samples in the Mycology and Mycotoxicology laboratory belonging to the Center for Research and Development in Industrial Fermentations. Fungal isolates obtained from these sorghum grains from the National Institute of Agricultural Technology (INTA, Manfredi, Córdoba, Argentina) were characterized using a polyphasic approach based on morphological and genetic characteristics and in the ability to produce mycotoxins. Morphological analysis suggested the identity of Epicoccum sorghinum, which was later confirmed by molecular analysis. The ability of these isolates to produce tenuazonic acid was evaluated and it was determined that 65% of the studied isolates produced tenuazonic acid at variable levels. This is the first study that provides a molecular approach to E. sorghinum isolates in Argentina and clearly confirms the wide genetic and phenotypic variability previously reported for this species in other countries. The presence of these tenuazonic acid-producing isolates in sorghum grains represent an economic and health problem for Argentina that it is considered one of the main exporters worldwide.
  • One of the traditional techniques for increasing value and reducing agricultural produce spoilage is drying. Where more expensive alternative storage methods are used, this is especially crucial[1]. Through the addition of one or more energy sources, moisture from a product is removed throughout the drying process[2,3]. The physicochemical characteristics of the fruit are changed by drying, which can improve the flavor and texture of specific foods like raisins and dates[2]. It lowers the product's water activity (aw), and when the aw value drops to less than 0.6, it inhibits the growth and spread of spoiling bacteria[4]. Drying also reduces product weight, which reduces packing, storage, and shipping costs and ensures off-seasonal production[5,6]. The demand for dried fruit is rising globally as people become more health conscious[7].

    Worldwide pomegranate production is steadily rising, although large post-harvest losses are also common, according to reports[8]. When fruit is unsuitable for standard processing methods due to fruit cracking or sunburn, drying is a great way to reduce post-harvest losses because it extends shelf life and can be utilized to reduce food waste[9]. Numerous products, such as pharmaceuticals, snacks, cereals, quick drinks, and other confectionary items, employ dried pomegranate arils[10]. Dried pomegranate arils, also known as anardana, are utilized both medicinally and culinarily in several regions of the world, including India[11]. Dried arils can therefore be quite useful as value-added items that generate revenue. According to research conducted in the Indian Ramban area, anardana trade accounts for at least 41% of all annual household income[11].

    There are many different drying techniques. The most popular are freeze-drying, hot air drying, vacuum drying, and solar drying. Each technique has pros and cons in terms of the final product's quality and how efficiently it uses energy. Pre-drying procedures are frequently used in conjunction with drying. Pretreatment enhances the drying rate, product quality, and energy efficiency of the drying process. Enzymes that cause enzymatic browning, which lowers the product quality, are rendered inactive by pretreatments[1214]. Sensory qualities like color, texture, taste, scent, microbiological activity, and general acceptability are among the criteria that determine the quality of dried pomegranate arils[15]. These elements are crucial because they can have a big impact on customer preferences and, if not taken into full account, can lead to financial losses[16,17].

    Several studies[12,18,19] have looked at the impact of drying and pretreatment techniques on the general quality of the completed product. However, the combined impact of pretreatment and drying on quality was not sufficiently investigated. Reviews on pomegranate fruit often discuss the fruit's chemistry, nutritive value, and pharmacology. Therefore, by evaluating, highlighting, and reflecting on recent studies on pomegranate aril drying, this review seeks to close these gaps. This review paper compared and contrasted several pretreatment and drying setups with an emphasis on product quality.

    Heat, mass, and momentum exchanges all occur simultaneously during the drying of fruit materials in a sophisticated cellular architecture of biological tissue[20,21]. The characteristics of the material that affect the drying process are intricately dependent on size, shape, porosity, moisture content, and time[22]. For instance, the initial moisture level and the bioactive chemicals in pomegranate arils can vary depending on the cultivar and fruit ripeness. The understanding, engineering, and management of the drying process are further complicated by the intrinsic diversity of biological materials[23,24]. The mass, heat, and momentum transfer events that happen during a typical drying process are shown in Fig. 1[25]. Conduction and convection are the most common heat transfer methods, but radiation is typically only employed for high-end items due to its expensive cost[1,26]. Diffusion, capillary action, and bulk flow are only a few of the processes that might transfer mass. These mass transfer mechanisms must adapt to the ongoing physical changes in the material that take place as it dries out[22,27].

    Figure 1.  A visual representation of the drying processes of solid materials.

    Although it is native to Iran, the pomegranate (Punica granatum L.) is widely distributed worldwide[28]. It belongs to the family Lythraceae and is a deciduous shrub. It is a versatile plant that can be found growing in both semi-arid and subtropical climates. Pomegranates, however, need hot summer temperatures to ripen[29]. Pomegranate fruit has a non-uniform round shape and a range of hues depending on the cultivar and fruit development stage, including yellow, green, pink, deep red, deep purple, and black[30,31]. An outsized calyx crowns the fruit. The leading producers worldwide are Peru, Australia, South Africa, and Chile in the southern hemisphere, and India, China, and Iran in the northern hemisphere[32].

    Pomegranate is a one-of-a-kind fruit with distinct edible seeds (arils) that must be extracted by hand (Fig. 2)[33]. An aril is made up of a seed and fleshy, moist tissue surrounding the seed. Color, sweetness, juice content, and hardness of arils vary depending on cultivar and fruit maturity[30,31]. While the arils can be eaten fresh, they can also be made into jams, jellies, coloring agents, juices, vitamins, and anardana (dried arils). They can also be mixed into yoghurts, biscuits, and cereals[34]. Fresh pomegranate arils can be kept at 7 °C for up to 14 d without losing much quality. Dried pomegranate aril has an extremely low perishability, with a potential shelf life of more than 14 weeks in ambient air[35].

    Figure 2.  A typical breakdown of the material balance throughout the drying process for pomegranate aril.

    As demonstrated in Table 1, pomegranate is high in ellagitannins, gallic acids, ferulic acids, anthocyanins, flavonoids, fiber, and minerals like vitamin C, calcium, and phosphorus. Pomegranates' phenolic components and high vitamin C content (Table 1) have attracted the interest of both researchers and consumers due to their health advantages[3638]. As a result of its strong antioxidant activity and nutritional benefits, pomegranate is considered a superfruit. Pomegranate can also be employed in cosmetics and pharmacology due to its phytochemical and antioxidant qualities[39]. Pomegranate fruit extract (PFE) has bioactive elements that have been found to inhibit or prevent various types and levels of cancer[40]. Punicalagic acid, ellagic acid, urolithin, and luteolin are the most important pomegranate components known to have anticarcinogenic characteristics[40,41]. Pomegranate fruit has also been linked to the prevention of diseases such as Alzheimer's, hypertension, and diabetes[42,43]. Pomegranate supplements may also help during or after exercise because they have the potential to speed up hard exercise recovery[44].

    Table 1.  The nutritional composition of 100 g of pomegranate arils.
    NutrientValueUnit
    Water77.9g
    Energy346kJ
    Protein1.67g
    Total lipid fat1.17g
    Ash0.53g
    Total dietary fiber4g
    Total sugar13.7g
    Calcium10mg
    Phosphorus36mg
    Magnesium12mg
    Iron0.3mg
    Potassium236mg
    Sodium3mg
    Zinc0.35mg
    Vitamin C10.2mg
    Vitamin K16.4µg
    Vitamin E0.6mg
    Vitamin B-60.075mg
    Total choline7.6mg
    Folate38µg
    Adapted from United States Department of Agriculture (Agricultural Research Service), FoodData Central[52].
     | Show Table
    DownLoad: CSV

    Pretreatment procedures are utilized to improve the drying process's effect on product quality characteristics such as color, flavor, appearance, and some physicochemical aspects[45,46]. Figure 3 depicts the most often used pretreatment procedures[46]. A product is immersed in a chemical solution prior to drying in chemical pretreatment. Physical pretreatments, on the other hand, necessitate a physical alteration of the product. When drying with heat, Maillard reactions might occur, resulting in an unpleasant color change[47]. As a result, pretreatment techniques are critical in many drying applications, including the drying of pomegranate arils[45,48,49]. There is evidence that pretreatment reduces the product's exposure to heat by reducing drying time[50,51].

    Figure 3.  A classification of the numerous pretreatment techniques utilized in the drying process for pomegranate aril.

    Soaking in acidic solutions involves immersing the product to be dried in a hot acidic solution for many minutes before drying. Pretreatment with an acidic solution keeps the product's color and speeds up the drying process. The acidic solution suppresses polyphenol oxidase enzyme activity, slowing the rate of enzymatic browning (Fig. 3). Furthermore, numerous investigations[5355] have documented the retention of nutrients such as vitamin C in acidic solution pretreatment samples. Some acid-sensitive components, on the other hand, can be destroyed or leached away. As a result, while employing this strategy, this effect must be considered. In a pomegranate aril drying research, arils prepared with 3% citric acid had the highest sensory acceptance[56]. Vardin & Yilmaz[57] conducted research on the combined effect of acid blanching and subsequent drying temperature. The authors blanched the arils in 0.1% citric solution for 2 min at 80 ± 2 °C followed by drying at 55, 65, or 75 °C and discovered that drying at 55 °C had the maximum antioxidant capacity[46]. Understanding the connection between soaking in acid (balancing in acid) and the subsequent drying temperature is required to carry out the operation correctly.

    This entails immersing products in an alkaline solution. Alkaline solutions act by dissolving the wax covering on the fruit's surface, removing resistance to moisture transfer and increasing drying rate[58]. As a result, this pretreatment accelerates the drying process. However, the usage of alkaline solutions raises food safety concerns because the residue might be harmful to one's health[46,59]. In addition, although acidic solutions retain vitamin C, alkaline solutions leach it out and destroy it[46]. Samples dipped in ethyl oleate for roughly one minute revealed a considerably reduced drying rate: a 26.9, 28.5, and 27.2% decrease in drying time at drying air temperatures of 55, 65, and 75 °C, respectively, than the control[60].

    The fruit is dipped into a hypertonic solution, such as salt or sugar solutions, in this approach (Fig. 3). Because of the osmotic pressure differential, the hypertonic solution causes water to diffuse out of the fruit tissue[61]. When compared to other drying processes, osmotically pretreated dried products have great rehydration capability and little losses in quality parameters such as color, appearance, and nutrients[62]. Madhushree et al.[63] discovered that osmotic pretreatment (in 50oBrix sugar syrup concentrations) dried arils had high color retention. This could be owing to the samples' reduced exposure to oxygen when immersed in the sucrose solution. A separate investigation on the osmotic pretreatment of pomegranate arils with a 65°Brix sucrose solution revealed a decrease in drying rate in hot air drying at 70 °C compared to untreated control samples[64]. The scientists attributed the longer drying time (lower drying rate) to the creation of a dense sucrose layer beneath the fruit's surface, which created an additional barrier to moisture transfer. To that aim, the osmotic solution concentration must be assessed because it can result in prolonged drying times.

    Gaseous or liquid sulphur solutions have been used as a food preservation method and as a pretreatment in food drying procedures. Typically, sulphur solutions are utilized for their browning properties, both enzymatic and non-enzymatic[65]. In addition, sulfur pretreatment is associated with high vitamin C and A retention after drying, as well as inhibition of spoilage-related microbial proliferation[66].

    More et al.[23] compared physical pretreatments to chemical pretreatments with 1% potassium metabisulphide on arils. It was discovered that arils prepared with potassium metabisulphide had superior nutritional quality as well as improved color, flavor, taste, and overall acceptability (Table 2)[23]. As a result, processing of pomegranate arils with sulfur solutions can result in high-quality dried goods. Despite their anti-browning, antibacterial, antifungal, and nutrient retention qualities, sulphites might be harmful to one's health if the recommended dosage or daily intake is exceeded[67,68]. Furthermore, while the sulfur solutions maintain vitamins A and C, they deplete vitamin B1[65].

    Table 2.  Key findings in pomegranate aril pretreatment and drying studies.
    Pretreatment methodPretreatmentDrying techniqueKey findingsReference
    BlanchingWater blanching at 90 and 100 °CHot air oven dryingBlanched samples had a shorter drying time.[24]
    Water blanching at 80 °CHot air oven dryerBlanched samples had higher phytonutrient retention than unblanched samples.[69]
    Blanching using 0.1% citric solution
    at 80 ± 2 °C
    Cabinet tray dryerDrying process was shorter for blanched samples and there was a higher rate of bioactive compounds.[57]
    Sulphuring1% potassium metabisulphideSolar drying
    Cabinet tray dryer
    Freeze dryer
    Fruit of cv. Ganesh 1% potassium metabisulphide was of the highest quality and the highest acceptance.[23]
    Blanching and SulphuringHot water blanching 85 °C and 0.2% potassium metabisulphateMechanical dryer
    Solar dryer
    Keeping quality of mechanically dried arils was higher than the solar-dried arils.[70]
    Steam blanching, potassium metabisulphide and 0.3% Sulphur fumigationCabinet tray dryerThe highest dried aril quality was obtained from the combination of steam blanching and 0.3% Sulphur fumigation.[71]
    Steam blanching, sulphuring at 0.3%Vacuum dryer
    Hot oven dryer
    Sun drying
    Poly-tent house drying
    Room drying
    Sun drying had the highest moisture content reduction and the highest overall acceptance.[72]
    Hot water blanching 85 °C,
    potassium metabisulphite varying
    from 0.25% to 1%
    Hot air oven dryerThe best treatment was blanching in hot water at 85 °C for 1 min and then dipping the arils in 0.25% potassium metabisulphite.[70]
    Steam blanching, sulphuringSun drying
    Cabinet dryer
    Blanching reduced drying time. Cabinet drying of blanched samples without sulphuring was considered optimum for anthocyanins.[73]
    Acidic solution2%, 3% and 4% citric acidCabinet tray dryer

    3% acidic treatment was found to be the most acceptable.[56]
    Microwave100 and 200 W.Hot air oven dryer200 W pretreatment resulted in minimum energy utilization and drying time.[74]
    100 and 200 WHot air oven dryer200 W had the highest drying rate.[75]
    Osmotic treatmentSugar syrup, freezing at minus 18 °COpen sun drying,
    Solar tunnel dryer,
    Cabinet tray dryer
    Osmotic treatment and cabinet tray dryer produced dried arils with better physicochemical and sensory qualities.[63]
    • 100% pomegranate juice
    • 50% pomegranate and 50% chokeberry juice
    • 50% pomegranate and 50% apple
    • 50% apple and 50% chokeberry
    • 75% apple and 25% chokeberry
    Freeze drying
    Convective pre-drying vacuum microwave finish drying
    Vacuum-drying and freeze drying
    Pomegranate and chokeberry concentrated juice improved the quality of the dried arils.[12]
    Sucrose solutionHot air oven dryingPretreatment increased the drying time of the samples.[64]
     | Show Table
    DownLoad: CSV

    The dipping or soaking of a product in an alcoholic solution, usually ethanol, is known as alcoholic pretreatment. Ethanol dissolves the cell wall components, which increases moisture loss and thus the drying rate[76]. Several fruits, including melon (Cucumis melo L.) and apples (Malus domestica), have been pretreated in alcoholic solutions before drying[77,78]. However, no investigations on the pretreatment of pomegranate arils with alcohol were reported. This could be owing to the aril's waxy layer, which could impede permeability and hence the efficacy of the alcohol pretreatment[79].

    In this method, the fruit is dipped, submerged, or sprayed with a liquid solution that forms a thin coating layer on the product's surface and then dried (Fig. 3). According to studies, the use of edible coatings can help to retain the color, texture, and nutrient retention of dried items[80]. It is critical to note that the drying pace and dried product quality are affected by the coating thickness, drying method, and coating solution. Most of the research on edible coverings for pomegranate arils has focused on cold preservation and packing.

    Acoustic cavitation is utilized to rupture cell walls using ultrasound pretreatment[81]. According to one investigation on the effect of sonification on osmotic dehydration and subsequent air drying of pomegranate arils, ultrasonography caused a 2-fold and 2.7-fold increase in water loss[82]. The authors hypothesized that ultrasonic promoted cell wall disintegration and enhanced permeability. While using ultrasonic improved color quality, it also reduced anthocyanin content when compared to osmotically dehydrated samples[82].

    Blanching is a pretreatment technique that involves rapidly heating and then cooling a product that will be dried[45]. Blanching can be used to inactivate enzymes that potentially degrade product quality, such as polyphenol oxidase, peroxidase, and polygalacturonase[4]. Unwanted sensory traits in color, flavor, texture, and nutritional aspects are examples[4,83]. Blanching also improves cell membrane permeability, resulting in a faster drying rate[45]. Furthermore, blanching kills bacteria that might cause product spoiling[45,83]. As indicated in Fig. 3, there are several blanching processes, including hot water blanching and modern technologies such as microwave blanching and infrared blanching.

    Adetoro et al.[18] discovered that blanching pomegranate arils in hot water accelerated drying rates compared to unblanched samples. In a separate investigation, the authors found that blanching arils at 90 °C for 30 s and drying at 60 °C had higher total anthocyanin content and radical scavenging activity than blanching at 100 °C for 60 s and drying at 60 °C. In another work, Karaaslan et al.,[69] blanched arils in water at 80 °C for 2 min to investigate the effects of temperature and pretreatment on the arils. The authors discovered that while 75 °C had the fastest drying time, 55 °C had the maximum anthocyanin concentration, phenolic content, and antioxidant capacity. In other studies, pretreatment procedures are combined to produce high-quality dried fruit products.

    Singh et al.[73] conducted a study to evaluate the drying of pomegranate seeds under various drying conditions. They discovered that blanched samples dried faster and had higher acidity than sulphured samples. Furthermore, the anthocyanin concentration of blanched samples was higher than that of blanched and sulphured samples using the mechanical dryer. The authors hypothesized that the reduced anthocyanin concentration seen after sun drying was caused by the long drying hours in the sun. They also suggested that pomegranate arils be dried using blanching rather than sulphuring to achieve the maximum nutritional quality. Sharma et al.[70] investigated ideal methods for drying pomegranate arils by blanching them in hot water at 85 °C for one minute and then immersing them in a solution of potassium metabisulphite with concentrations ranging from 0.25% to 1% for two minutes (Table 2). The highest potassium metabisulphite content resulted in the lowest acidity.

    Thakur et al.[71] used steam blanching for 30 s and 0.3% sulphur fumigation for one hour to standardize pretreatments for dried arils from wild pomegranate. The authors discovered that cabinet drying outperforms solar drying and open sun drying. The solar dryer ranked second in terms of sensory characteristics like texture, taste, and general acceptability. Sun-dried pomegranate arils, on the other hand, exhibited the highest reduction in moisture content and overall acceptance when compared to vacuum drying, hot air oven drying, polytent drying, and room temperature drying, according to Bakshi et al.[72].

    The effect of pulsed electric field treatment on the behavior of microwave-assisted hot air drying of pomegranate arils was examined by Amiali et al.[84]. When compared to drying at 70 °C, they found that pulsed electric field treatment was only advantageous when the subsequent drying process was done at the lowest temperature (50 °C). The lower the temperature, the higher the overall phenolic concentration. Arils treated with a pulsed electric field had a 21.02% higher total phenolic content than untreated arils.

    Various pretreatment procedures on pomegranate arils have been utilized with the goal of conserving physicochemical, physical, and chemical properties or enhancing drying rates. However, pretreatment standardization is currently restricted and underexplored. Table 2 lists some of the methods for preparing dried pomegranate arils.

    Despite the fact that pomegranate is a fruit with numerous health and nutritional benefits, it is now a modest crop with limited marketability. The difficulty in collecting the interior edible seeds (arils) is the greatest impediment to realizing the full potential of this unusual fruit[29,31]. Only manual extraction of pomegranate arils for laboratory scale testing is described in the literature.

    Pomegranates are first cleaned and sorted for uniformity in color, size, shape, and weight before aril extraction[18,85]. All pomegranates should be washed. To avoid introducing bacteria into the arils when the fruit is sliced open, excess water from the fruit surface is dried before cutting[86]. Following that, the fruit is cut along the ridges and the segments are gently pulled apart to form a flower-like structure. The deconstructed pomegranate is then flipped over a bowl of water and gently tapped with a wooden spoon on the skin side. As a result, the arils will begin to come out without being broken. Once all arils have dropped out, the white membranes are skimmed off the surface of the water as it floats, the water is drained, the arils are separated, and the surplus water is gently patted off with a towel. This method involves cutting the pomegranate with a knife, which results in a loss of more than 30% of the arils owing to mechanical damage[86]. As a result, a better approach was required, such as the machinery developed by Schmilovitch et al.[87], which allows opening the fruit without cutting, extracting the arils with minimal damage, separating the arils from extraneous materials, and delivering clean arils to a packaging machine. This technology could be used to produce dried pomegranate on a greater scale.

    The drying time is determined by the pretreatment process, kind, and technique of dehydration used. The dehydration methods that will be investigated in this study are low-temperature drying and high-temperature drying.

    Low-temperature drying methods employ temperatures ranging from subzero to 50 °C[49,88]. These drying processes are time-consuming and are usually utilized for temperature-sensitive goods like herbs. Furthermore, low-temperature drying procedures reduce the risk of scorching the fruit, protecting heat-sensitive components such as vitamin C[89]. Freeze drying, vacuum drying, and sun drying are all low-temperature drying procedures[90]. Pomegranate arils dried using low-temperature procedures such as freeze drying and vacuum drying have a more acceptable look and nutrient composition than most high-temperature drying methods[12,91].

    Freeze-drying (FD) is a low-temperature technology frequently used for drying food samples for high-quality or heat-sensitive products[92]. It is also recognized as one of the most expensive, time-consuming, and energy-intensive procedures in the food industry[93]. It entails removing moisture from food ingredients under low temperature and high vacuum via ice sublimation[48]. Because the product is frequently frozen, it is also known as sublimation drying.

    Adetoro et al.[94] freeze-dried fresh pomegranate arils at a freezer temperature of −80 °C for 96 h to examine the effect of drying procedures on pomegranate arils. The researchers discovered that color, total phenolic compounds (TPC), total anthocyanin content (TAC), and radical-scavenging activity stability differed significantly from the hot air-drying procedure (Table 3). More et al.[23] investigated the effect of drying procedures on the quality of dried pomegranate arils from three varieties. The authors discovered that FD produced the greatest results in terms of color, flavor, taste, and nutritional factors across all cultivars. However, FD stood out due to its prolonged drying duration, 24−48 h, when compared to solar drying (17 h) and hot air drying (10 h). A study on the influence of freeze-drying on the color attributes of 'Assiuty' pomegranate arils revealed that FD had the best color attributes (L* value of 46.50 ± 4.4 and a* value of 13.97 ± 1.23)[95]. Gölükcü[91] discovered that the FD had the maximum phenolic matter content (5580 mg/kg), followed by vacuum, convective, and sun-dried pomegranate arils (Table 3). Caln-Sánchez et al.[96] investigated the chemical composition, antioxidant capability, and sensory quality of pomegranate arils and rind after exposure to FD. The investigators found that FD pomegranate arils retained the most sensory characteristics and punicalagin content. Similarly, Cano-Lamadrid et al.[12] discovered the best sensory profile and sweetness in FD pomegranate arils at 65 Pa for 24 h at −60 °C. The drying kinetics, total bioactive content, in-vitro bio accessibility of bioactive compounds, and color and microstructural features of pomegranate arils were also studied[97]. When compared to alternative drying methods, the FD was shown to be the best approach in terms of final product quality and has been highly recommended by multiple reviewers[48]. FD arils have been demonstrated to have a higher bioactive chemical content, less shrinking, and excellent color quality. The FD for pomegranate arils has a disadvantage in terms of bioactive chemical recovery when compared to other methods, as well as extensive drying times[97]. Furthermore, FD is costly due to high energy consumption and initial investment expenses[98].

    Table 3.  A summary of the many techniques for drying pomegranate arils.
    CultivarDrying methodDrying
    time (h)
    Drying conditionInitial moisture
    content (%)
    Final moisture
    content (%)
    Key findingsReference
    WonderfulFreeze dryer96−80 °C
    5,999.1 Pa
    74.7 (w.b.)FD showed a higher color shift (19.6% ± 2,77%) at week 4 compared to hot air drying at week 0.[94]
    Ganesh, Bhagwa and AraktaFreeze dryer24−48−45 °C79.9 (w.b.)
    80.5 (w.b.)
    78.9 (w.b.)
    9.65−9.9 (w.b.)
    9.8−10.2 (w.b.)
    9.8−9.9 (w.b.)
    Arakta pre-treated with 1% potassium metabisulphide had the highest ascorbic acid concentration (6.81 ± 0.07 mg 100 g−1).[23]
    AssiutyFreeze dryer36−70 °CTA (18.80, 2.80 mg 100 g−1), TP (608.09a, 41.26 mg 100 g−1), DPPH (68.91, 0.72%), and ABTS (2,956.59c, 120 mol trolox
    100 g−1) were all higher in frozen pomegranate arils than in freeze-dried arils.
    [95]
    Mollar de Elche24−60 °C, 65 Pa,81.5 (w.b.)FD showed higher anthocyanin content (646 mg kg−1) compared to osmotic drying and conventional drying.[12]
    Hicaznar36−20 °C, 100 Pa for
    12 h
    −70 °C, 0.26 Pa
    76.96 (w.b.)10 (w.b.)Arils dried using FD had the highest magnesium content (96.17 ± 6.95 mg kg−1), manganese content (0.96 ± 0.05 mg kg−1) and zinc content (3.93 ± 0.07 mg kg−1) compared to sun drying, hot air drying and vacuum drying.[91]
    KebenFreeze dryer57−55 °C77.6 ± 1 (d.b.)20 ± 1 (d.b.)FD had lower bioactive recovery during in-vitro gastrointestinal digestion (TPC of 2.92%, ABTS of 6.12% and CUPRAC of 38.85%) compared to vacuum drying, hot air drying and ultrasound-assisted vacuum drying.[97]
    KebenVacuum dryer10.855 °C77.6 ± 1 (d.b.)20 ± 1 (d.b.)Vacuum drying had the highest bio accessibility recovery of bioactive compounds at 10.32% compared to HAD, FD and ultrasound-assisted vacuum drying.[97]
    HicaznarVacuum dryer3.7
    4.6
    7.8
    75 °C
    65 °C
    55 °C
    85,000 Pa
    78.1 ± 0.2 (w.b.)16 (w.b.)Drying temperatures of 75°C resulted in higher degradation of anthocyanins, phenolic compounds and antioxidant capacity (20.0%, 51.0%, 29.7% ± 0.28% respectively).[99]
    HicaznarVacuum dryer2455 °C
    3 500 Pa
    76.96 (w.b.)10 (w.b.)FD had the highest quality attributes such as TAC-1288.73 mg/kg) compared to VD and HAD however, due to physical changes that were undesirable physical changes, VD and HAD are recommended for pomegranate aril drying.[91]
    Wild pomegranates (cultivar- unspecified)Vacuum dryer1342 ± 2 °CVD had a higher sensorial overall acceptance (17.1) compared to sun drying (16.2) and room temperature (12.6).[72]
    BasseinSun drying1715.73
    (unspecified)
    Drying rate of pomegranate arils is affected by tray load and the recommended tray load is 1.25 kg m−2[73]
    Wild pomegranates (cv. Unspecified)Solar poly-tunnel14014.9−28.4 °C
    48.5%−74% -RH
    0.639−0.944 -wind speed
    Arils dried in the solar poly-tunnel had higher ascorbic acid, anthocyanins, and phenol content, 12.7 mg 100 g−2, 28.12 mg 100 g−2, and 108.60 mg 100 g−2 respectively than open sun drying.[100]
    SefriIndirect solar dryer75
    10
    6
    4
    40 °C
    50 °C
    60 °C
    75 °C
    78 ± 0.1(w.b.)The optimal water activity for drying and storing arils is 0.3684 ± 0.03.[101]
    Wild pomegranates
    (cv. Unspecified)
    Solar tunnel30−45 °CArils from the Karsog location had the highest TSS, sugars, anthocyanin, total phenols and antioxidant activity[102]
    Microwave2.3
    1.3
    0.7
    270 W
    450 W
    630 W
    70.25 ± 0.5(w.b.)10(d.b.)Color changes increased from 6.77−13.11 with an increase in microwave power from 270−630 W and were lower compared to arils dried using HAD.[85]
    HicazMicrowave1.2
    0.6
    0.4
    210 W
    350 W
    490 W
    23.93 ± 1.4 (unspecified)22.2
    (unspecified)
    Based on quality parameters, a microwave drying power of 350 W was recommended for drying pomegranate arils.
    Sweet acid
    (cv. Unspecified)
    Infrared4.3
    2.2
    1.6
    50 °C
    60 °C
    70 °C
    78 ± 0.2 (w.b.)9 ± 0.2 (d.b.)
    22.2
    (unspecified)
    Drying time for infrared drying was less than for HAD.[103]
    HicazHAD2450, 60, 70 °C at
    1.0 m/s air velocity
    To obtain better dried aril quality, 60 °C was recommended for drying pomegranate arils.[104]
    Wild pomegranates
    (cv. Unspecified)
    HAD16.542 ± 2 °CSun drying resulted in a maximum loss of moisture compared to VD, HAD, poly-tent house drying and room drying.[72]
    Wild pomegranates
    (cv. Unspecified)
    HAD1062 ± 2 °CHAD achieved the highest total soluble solids (39.6°Brix) and drying rate compared to solar drying and open sun drying.[105]
    KebenHAD555 °C; with 1.3 m s−1 constant air velocity77.6 ± 1 (d.b.)20 ± 1 (d.b.)In comparison to hot air oven drying, ultrasound-assisted vacuum drying and freeze-drying have higher quality characteristics.[97]
    Bassein seedlessHAD5−660 ± 5 °C. Airflow in
    the dryer was 1.2−1.8 m s−1.
    8.98 ± 0.091For the finest preparation of anardana, blanched samples (with sulphur) should be dried in a cabinet.[73]
    Mollar de ElcheVacuum-
    microwave
    240, 360, 480 W and pressure ranging
    from 4,000−6,000 Pa
    80.4 (w.b.)Arils dried using vacuum microwave drying at 240 W had the highest sensorial scores for odour and aroma at 3.1 and 5.6 respectively.[106]
     | Show Table
    DownLoad: CSV

    Vacuum drying (VD) is the process of subjecting items to low pressure in a vacuum. Because of the low pressure, water has a lower boiling point, allowing samples to be dried at low temperatures. As a result, VD is appropriate for heat and/or oxygen-sensitive items. During VD, heat transmission can occur by conduction, radiation, or microwave energy. VD is distinguished by faster drying times when compared to FD, and the products are not initially frozen as necessary for FD[107]. This low-temperature operation, combined with the elimination of oxygen during vacuum drying, allows nutrients and bioactive components such as phenolic compounds and vitamins to be retained[108,109].

    Ozay-Arancioglu et al.[97] investigated the influence of drying methods on dried pomegranate arils by comparing four distinct drying techniques: FD, VD, ultra-assisted vacuum drying, and hot air drying. They discovered that VD had better antioxidant capacity values than the samples tested for ABTS following FD. According to Gölükcü[91], VD is second only to FD as the finest choice for producing dried pomegranate (Hicazar) arils. Another study found that arils dried at 55 °C had higher phytonutrient levels than those dried at 65 and 75 °C under vacuum conditions[69]. When compared to other drying procedures, vacuum drying produces products with higher levels of phytochemical components. However, drying times range from 7.8 to 24 h at 55 °C, contributing to high costs, and products can only be dried in batches[91,99,110].

    Sun drying is one of the oldest and most used methods of drying. Sun drying is a low-cost, renewable energy-based drying process. In a nutshell, products are laid out on a flat area where they can be fully exposed to the sun for as long as possible. Because the drying process is dependent on solar radiation, the temperature is low and the drying process can be lengthy, taking approximately 15 d for pomegranate arils[60]. Furthermore, exposure to light and oxygen can lead to decreased preservation of substances like vitamin C. Furthermore, solar drying is an uncontrolled process with substantial risks of pest contamination, dust exposure, and product remoistening at night. To increase safety, solar dryers and solar tunnels are proposed to reduce pest and dust contamination[111]. Solar dryers use a contained environment comprised of a transparent or opaque cover, resulting in either direct or indirect drying[112]. The indirect drier system captures solar heat and transfers it to the product drying chamber via a second solar collector. A solar tunnel dryer is typically large in size and has a clear cover (Fig. 4). To regulate drying conditions such as temperature and relative humidity within the tunnel, solar tunnels often require a forced convection facility. A solar tunnel dryer may also include a solar air heater[111]. Solar dryers have the potential to boost drying temperatures, resulting in a quicker drying time[113].

    Figure 4.  This image depicts a sample of wild pomegranate arils being dried in a solar tunnel drier. Reprinted from Thakur et al.[102].

    In a comparison of hot air drying (60 °C), solar tunnel drying, and sun drying by Madushree et al.[63], hot air-dried arils were shown to have the highest quality. However, of all the drying techniques, solar drying had the greatest L* values (lightness), a desired quality. This was due to the comparatively low temperature of sun drying. Additionally, Bakshi et al.[72] discovered that when compared to vacuum drying, oven drying (42 ± 2 °C), and room drying (23 ± 2 °C), sun dried arils had the highest sensory overall acceptance and the lowest moisture content. In their comparative analysis of drying techniques, Singh et al.[73] discovered that hot air-dried pomegranate arils had the greatest anthocyanin and acidity contents. But in hot-air oven-dried samples, undesirable non-enzymatic browning was most pronounced. Sharma & Thakur[100] demonstrated that the quality of arils dried in solar polytunnels was superior to that of arils dried in the open sun (Fig. 4). The ascorbic acid, anthocyanins, and phenols were found to be significantly greater in the sun polytunnel dried arils, according to the authors. They also received superior sensory ratings for color, texture, taste, and acceptability.

    Temperatures above 50 °C are used in high-temperature drying processes[88]. These drying processes are energy intensive, have large operating expenses, and so are costly. These technologies rely on fossil fuels, which pollute the environment where they are generated and utilized, and their continued usage is seriously harming our environment[114]. The drying mechanism is designed such that there is a controlled direct or indirect heat transmission to the product, leading in moisture elimination. These drying procedures may not be suited for some foods because they may induce nutritional breakdown[115]. Furthermore, high temperatures might cause product shrinkage and distortion. Hot-air drying ovens, steam drying, heat pump drying, and spray drying are all examples of high-temperature drying processes.

    Using forced convection, hot air oven drying (HAD) eliminates moisture from materials. Objects dry out through evaporation when hot air is forced through and around the substance. As a result, the dried product's flavor, color, nutrients, and ability to rehydrate may alter unintentionally[97,104,106]. The HAD techniques were shown to have a comparatively high total color change by Ozay-Arancioglu et al.[97]. As shown in Fig. 5, hot air-dried arils were darker than freeze-dried and vacuum-dried arils.

    Figure 5.  Illustration of dried pomegranate arils that have been dried using different methods. (a) Freeze drying, (b) vacuum drying, and (c) hot air drying. Adapted from Ozay-Arancioglu et al.[97].

    Başlar et al.[99] prepared dried aril samples using the hot air-drying process and subjected them to various quality assessments. Fresh aril samples were dried at three different temperatures (55, 65, and 75 °C). According to the authors' findings, high temperatures and short drying times are optimal for retaining valuable food biocomponents. However, whereas bioactive chemical losses increased over time, they degraded faster at higher temperatures. The antioxidant activity, on the other hand, decreased with drying time and was unaffected by drying temperatures. Horuz & Maskan[104] investigated the effect of hot air drying on pomegranate aril cv. Hicaz at three different drying temperatures and compared quality metrics such color, shrinkage, rehydration capacity, and drying time (Table 3). The authors suggested 60 °C for pomegranate aril HAD. The authors also discovered that shrinkage was greater in HAD than in microwave drying. In a second study, researchers discovered that the optimal drying temperature for retaining bioactive chemicals when drying pomegranate arils (cv. Hicaznar) in a hot air dryer was 65 °C[116]. When compared to the sun drying method for anardana made from wild pomegranate, Bhat et al.[105] discovered HAD dried arils with maximum acidity of 13.72%, phenols of 110.7 mg per 100 g, total sugars (24.2%), and reducing sugars (21.2%).

    However, Bakshi et al.[72] carried out a study with lower temperatures in which they studied the influence of different drying processes on the moisture content of dried pomegranate aril (cv. Wild). Lower temperatures were employed to gain insight into the quality of the dried product when compared to the low temperature drying methods used in the study, such as sun drying, poly tent house drying, room drying, and VD. When compared to alternative drying methods, the authors discovered that HAD (42 ± 2 °C ) for 16.5 h and drying in room at normal air (23 ± 2 °C ) for 10−12 d produced in the greatest loss of moisture from fresh arils of wild pomegranate (75.12%).

    Singh et al.[73] evaluated the influence of different drying conditions on the quality of dried pomegranate arils (Bassien Seedless) samples (Table 3). The scientists discovered that sun-drying preserved more MC while drying was faster with a HAD dryer and generally recommended it as a better strategy for preparing dried pomegranate arils.

    HAD drying of pomegranate arils is a standard drying procedure that can be utilized in commercial settings. Although HAD does not generate high-quality goods like FD, it does provide better TSS, TA, and antioxidant capacity stability. Furthermore, although having a higher rate of bioactive component degradation, higher temperatures may result in higher retention compared to approaches such as solar drying due to the short drying times.

    Electrical current is passed through the pomegranate aril during electric drying techniques including ohmic heating. The intrinsic resistance of the aril induces internal heating as the electrical current flows through it[117,118]. Ohmic heating is typically employed for liquid, viscous, and particle-containing foods[119]. Regardless of the meal's densities, food products prepared using this approach are heated quickly and uniformly[120].

    Dielectric techniques, on the other hand, use electromagnetic waves to directly produce heat inside the product, such as microwave, radio frequency drying, and infrared radiation[121]. Dielectric heating results from the conversion of electromagnetic energy to kinetic energy by dipolar molecules oscillating in accordance with the rapidly oscillating electric field[122,123]. Compared to traditional methods like hot air drying, dielectric technologies dry materials more quickly[124]. Additionally, the items are of a higher caliber than those produced by traditional drying techniques.

    Microwave drying (MD) is one of the emerging drying technologies. Unlike other techniques, MD utilizes volumetric heating to rapidly dehydrate the sample material[104]. Some studies[85,104] have indicated that arils desiccated at 150 W microwave power and 58 bar (abs) pressure produced the highest quality arils. In another study, microwave power of 80 W and vacuum pressure of 60 mm Hg provided the highest drying efficiency and qualitative attributes, including color and texture[125]. Horuz & Maskan[104] observed that microwave-dried pomegranate samples had lower levels of shrinkage and bulk density than hot air-dried samples. The authors also noted that microwave drying caused a greater loss of color in terms of total color difference (E) compared to air drying. It was observed that microwave-dried samples had a brownish hue.

    Drying with MD reduces drying time, but essential quality parameters, such as color, are sacrificed. Since the product is directly heated, the lack of heating uniformity during MD, which is difficult to control and could contribute to product burning has been cited as a disadvantage[126].

    Infrared drying is an effective technique of drying in which the product is heated directly without the use of air as the drying medium. In a comparative study of drying methods (hot air drying and infrared drying) to dry pomegranate arils, the authors discovered that infrared drying effectively dried pomegranate arils and that the polyphenol content in arils dried using infrared drying was higher at 50 and 60 °C than in arils dried using hot air drying at similar temperatures[103]. Therefore, pomegranate arils can be infrared-dried at 50 °C for optimal nutrient retention[103]. In contrast, a distinct study dried pomegranate arils under near-infrared vacuum conditions and found that drying at 60 °C and 20 kPa air pressure resulted in optimal colour retention and shrinkage[127].

    Although infrared drying is a rapid drying method, it is challenging to control due to parameters such as infrared intensity and radiation distance, and its energy consumption is unpredictable[26].

    Drying kinetics is the study of how factors that influence the removal of moisture from products during a drying process interact[110]. The drying kinetics of a substance is dependent on its thermal and mass transport properties. Understanding drying kinetics relates to process variables, and therefore aids in identifying suitable drying methods and controlling drying processes[57,96,116]. For optimal operating conditions, drying kinetics can be used to estimate drying time, energy requirements, and drying efficiency[2]. Due to the complexity of the drying phenomenon, however, mathematical models describing the drying kinetic of biological tissues are devised based on the time history of the moisture ratio from a controlled drying experiment[128]. There are numerous mathematical models, but Table 4 provides a summary of the most used models.

    Table 4.  A summary of the mathematical equations that are most commonly used to model the drying kinetics of pomegranate arils is shown here.
    Model nameModel expressionReference
    PageMR = exp(-ktn)[129]
    NewtonMR = exp(-kt)[130]
    Henderson and PabisMR = aexp(-kt)[131]
    Midili et alMR = aexp(-ktn) + bt[132]
    Wang and SinghMR = 1 + at + btn[133]
    Two TermMR = (aexp(-k0 t) + bexp(-k1 t))[134]
    LogarithmicMR = aexp(-kt) + c[135]
     | Show Table
    DownLoad: CSV

    The most common models that best describe the hot air drying of pomegranate arils include the Logarithmic, Midili and Page models[24,99]. Baslar et al.[99] found the Logarithmic model as the best in describing hot air drying of arils at 55, 65 and 75 °C. In another study, it was found the Sigmoid model describing the kinetics of hot air drying of pomegranate arils at similar drying temperatures[116].

    In their study on the infrared drying of pomegranate arils, Briki et al.[103] discovered that the Midili model was the most accurate representation of the drying kinetics. In a similar manner, it was discovered that the Midili model provided the best fit to the experimental data for drying using a combination of infrared and hot air[136]. Another investigation indicated that the Aghbashlo model provided the greatest fit for the data obtained from near-infrared vacuum drying at a temperature of 60 °C[127].

    Based on measurement data from three pomegranate cultivars (cvs. 'Acco', 'Herkaswitz', and 'Wonderful') at 60 °C, Adetoro et al. demonstrated cultivar as another influencing factor in selecting an optimal model. While the drying data of the blanched samples of all the cultivars in this investigation were best fit by the Logarithmic model, the unblanched samples of 'Acco' and 'Herkaswitz' and 'Wonderful' were best fitted by the Page and Midili models, respectively[24].

    The bioactive chemicals retained and drying periods may be affected by the pretreatment process, although frequently the drying kinetics of both untreated and pretreated samples may be described by the same model. The Page and Modified Page were determined to be the best models to fit the drying data of both blanched and unblanched pomegranate arils under vacuum air drying by Karaslaan et al.[69]. In a different investigation, the Page and Modified Page were shown to be the model that best suited the drying data of pomegranate arils that had been bathed in citric acid and dried by hot air[57]. Although the drying rate of pre-treated samples is higher than that of untreated samples, the scientists noted that the same models were found to best reflect the drying kinetics. The Page, Logarithmic, and Midili drying models are the most popular and effective drying models for pomegranate arils employing HAD, MD, and VD. The mathematical models that were utilized to explain the drying kinetics of pomegranate arils are summarized in Table 5.

    Table 5.  A synopsis of the results of mathematical modeling of the kinetics of drying pomegranate arils.
    CultivarDrying methodDrying parametersPretreatmentSuitable drying modelReference
    cv. HicazHAD55, 65, 75 °C0.1% citric acidPage and Modified Page[57]
    cv. HicaznarHAD55, 65, 75 °CSigmoid[116]
    HAD55, 55, 60 °CPage[137]
    HAD50, 60, 70 °CPage[85]
    MD270, 450, and 630 WPage[85]
    cv. HicaznarVD55, 65, 75 °CHot water blanchingPage and Modified page[69]
    HAD45, 50, 55, 60, 65, and 70 °CMicrowaveMidili[75]
    cvs. Acco, Herskawitz and WonderfulHAD60 °CHot water blanching (at 90 and 100 °C, each for 30 s
    and 60 s)
    Logarithmic, Page,
    Midili for unblanched arils
    Midili and Page for blanched
    [24]
     | Show Table
    DownLoad: CSV

    The drying procedure aids in reducing bacterial growth, which can result in reducing spoilage. However, while food is being dried, other changes may occur that degrade its quality. To determine the product's expiration life, chemical, physical, physicochemical, and microbiological changes are monitored[138,139]. These modifications are affected by stowage, environment, and packaging methods. The most significant factor affecting the integrity of stored food products is temperature[140]. Consequently, most shelf-life experiments are designed to evaluate the temperature-time history in relation to changes in product quality[138,141]. To accurately evaluate quality changes and safety, shelf-life evaluations should ideally simulate actual storage conditions[142]. In the case of desiccated goods, the actual storage period is lengthy, and the evaluation of shelf-life can become time-consuming and expensive. When the actual storage time is lengthy for practical reasons, an accelerated shelf-life test or analysis of the worst-case scenario is employed[142]. Ordinarily, the end of shelf life is determined by relevant food legislation, guidelines issued by enforcement authorities or agencies, guidelines issued by independent professional organizations, current industrial best practices, self-imposed end-point assessment, and market data[142].

    Appropriate packaging material can help to reduce quality losses. The packaging and shelf-life tests on dried pomegranate arils are summarized in Table 6. Sharma et al.[70] examined the packaging of dried pomegranate arils with high-density polyethylene (HDPE), low-density polyethylene (LDPE), and polypropylene (PP) films. For 12 months, samples were held at 7 °C and ambient (14−39 °C). They found that HDPE retained the most color, total tannins, and acidity while gaining the least moisture. The authors proposed a safe storage time of 6 and 9 months for HDPE packed dried pomegranate arils under ambient and refrigerated conditions, respectively.

    Table 6.  A list of the several types of containers used to store dried pomegranate arils.
    Drying methodDrying temperaturePackaging materialStorage period (months)Shelf-life performanceReference
    MC drier
    Solar cabinet drier
    Open sun
    62−64 °C
    50−55 °C
    18−24 °C
    Aluminum laminated polyethylene pouch, polyethylene pouches and thermoform trays.6Aluminum laminated polyethylene pouches were best for packaging.[105]
    Microwave-vacuum drying38 °CHigh-density polypropylene (HDPP) and aluminum laminated polyethylene (ALP).3−6Pomegranate arils stored showed that ALP is more protective than HDPP.[35]
    Solar tunnel30−45 °CGunny bags, aluminum laminated polyethylene pouches (ALP) and vacuum-sealed aluminum laminated polyethylene pouches (ALPV).12Both refrigerated and ambient storage can securely preserve dried pomegranate samples for 12 months. Best performance was ALP with vacuum and cold storage.[144]
    Hot air dryer60 °CAluminum laminated polyethylene pouch (ALP), polyethylene pouch (PEP), and thermofoam tray (TT) covered in shrinkable polypropylene transparent sheet.6Moisture absorbers aid in the preservation of samples.[100]
     | Show Table
    DownLoad: CSV

    Bhat et al.[105] compared aluminum-laminated polyethylene (ALP, 99.8 g m−2) and polyethylene pouches (93.9 g m−2) each storing 100 g dried pomegranate arils and stored at ambient (15−25 °C). The authors discovered that aluminum laminated polyethylene pouches performed best after a 6-month storage period. Dak et al. [35] compared HDPP and ALP under accelerated shelf-life conditions (38 ± 1 °C and 90% ± 1% relative humidity) and evaluated the correlation between packaging material, storage period, and anthocyanin, phenolics, TSS, TA, and microbial count. The authors estimated that HDPP and ALP have shelf lives of 96 and 187 d, respectively. The above two research confirmed that ALP had the best performance features. This could be owing to the pouches' thickness and the opaque barrier of the aluminum lamination. The use of opaque packaging material may extend the shelf life of pomegranate arils by minimizing photodegradation of components such as carotenoids, flavonoids, and lipids, which can alter qualitative qualities such as aroma, texture, and color[143]. Based on safe consumption criteria, Mokapane et al.[19] proposed a shelf life of 5 months for citric acid pretreatment and dried arils wrapped in kraft paper pouches.

    In a second investigation, Thakur et al.[144] examined the effectiveness of gunny bags, ALP, and ALP combined with vacuum for storing dried pomegranate arils for a period of one year. According to the authors' findings, ALP performed best when performed under vacuum. The various types of containers that are used to store dried pomegranate arils are broken down into categories and shown in Fig. 6.

    Figure 6.  Different types of storage bags for dried pomegranate arils. (a) Aluminum-laminated polyethylene pouches, (b) vacuum-sealed aluminum-laminated polyethylene pouches, (c) gunny bags and (d) transparent polyethylene pouch. From Thakur et al.[144], modified.

    Sharma & Thakur[100] investigated the effect of active packaging on the quality features of dried wild pomegranate arils over a 6-month storage period. Salt or sugar sachets were inserted in ALP pouches or Thermofoam trays that had been wrapped in shrinkable polypropylene transparent film or polyethylene pouches. The researchers reported that for arils dried in a mechanical drier, ALP pouches had the best quality retention of criteria such as ascorbic acid, anthocyanins, total phenols, color, and texture. Furthermore, the inclusion of salt or sugar in active packing aids in the production of high-quality dried arils. However, salt-based active packaging had somewhat higher TA, ascorbic acid content, total sugars, anthocyanin content, and total phenols than sugar-based active packaging.

    The shelf life of dried pomegranate aril can range anywhere from three months to a year depending on the pretreatment, drying procedures and packaging that were used. There is, however, no definitive guideline about the influence that pretreatment and drying procedures have on the quality characteristics of the product when it is being stored. Many studies on the shelf life of dried pomegranate arils focus on examining the influence that different types of packaging material have on the storage life. These studies pay less attention to the physical and microbiological changes that accompany quality alterations. Additionally, a specialized shelf-life testing process and quality standard for dried pomegranate arils can be difficult to locate in the literature.

    While high temperatures have a positive influence on the drying rate, it has a negative effect on the product's texture, color, and nutritional content. Because of this, lower temperatures are often ideal for retaining the pomegranate arils' nutritional value and maintaining their consistency. Freeze dryers offer the best result in this regard. Freeze-drying, on the other hand, is a time- and money-consuming process. When paired with other types of pretreatment, inexpensive procedures such as sun dryers can be adjusted to produce high retention on chemicals that are virtually identical to those obtained in freeze dryers. However, before implementation, it is necessary to examine the intended outcome of the pretreated arils. This is because pretreatments affect both the drying rate and the retention of nutrients. Therefore, in order to completely optimize the process, it is necessary to have an awareness of the interaction that occurs between the pretreatments and the subsequent drying procedure. It is proposed that recommendations be formulated to assist in the manufacture and marketing of dried pomegranate arils that are consistent, nutritious, and hygienically safe.

    The authors confirm contribution to the paper as follows: study conception and design: Ambaw A, Opara UL; project administration and supervision: Ambaw A, Opara UL; draft manuscript preparation: Maphosa B; manuscript review and editing: Ambaw A. all authors reviewed the results and approved the final version of the manuscript.

    Data sharing not applicable to this article as no datasets were generated or analyzed during the current study.

    This work is based on the research supported wholly/in part by the National Research Foundation of South Africa (Grant No. 64813). The opinions, findings and conclusions or recommendations expressed are those of the author(s) alone, and the NRF accepts no liability whatsoever in this regard. Research reported in this publication was supported in part by the Foundation for Food and Agriculture Research under award number 434—grant ID: DFs-18- 0000000008.

  • The authors declare that they have no conflict of interest.

  • [1]

    Food and Agricultural Organization of the United Nations (FAO). 2023. Crops Statistics of 2021. www.fao.org/faostat/en/#data/QCL (Accessed on March 30, 2023).

    [2]

    Fardin F, Sani B, Moaveni P, Afsharmanesh G, Mozafari H. 2023. Nutritional value and agronomic traits of forage sorghum under drought stress. Biocatalysis and Agricultural Biotechnology 48:102624

    doi: 10.1016/j.bcab.2023.102624

    CrossRef   Google Scholar

    [3]

    Astoreca AL, Emateguy LG, Alconada TM. 2019. Fungal contamination and mycotoxins associated with sorghum crop: its relevance today. European Journal of Plant Pathology 155:381−92

    doi: 10.1007/s10658-019-01797-w

    CrossRef   Google Scholar

    [4]

    Mwamahonje A, Eleblu JSY, Ofori K, Deshpande S, Feyissa T, et al. 2021. Sorghum Production Constraints, Trait Preferences, and Strategies to Combat Drought in Tanzania. Sustainability 13(23):12942

    doi: 10.3390/su132312942

    CrossRef   Google Scholar

    [5]

    Asam S, Rychlik M. 2013. Potential health hazards due to the occurrence of the mycotoxin tenuazonic acid in infant food. European Food Research and Technology 236:491−97

    doi: 10.1007/s00217-012-1901-x

    CrossRef   Google Scholar

    [6]

    Oliveira RC, Goncalves SS, Oliveira MS, Dilkin P, Mallmann CA, et al. 2017. Natural occurrence of tenuazonic acid and Phoma sorghina in Brasilian sorghum grains at different maturity stages. Food Chemistry 230:491−96

    doi: 10.1016/j.foodchem.2017.03.079

    CrossRef   Google Scholar

    [7]

    Clausi L. 2022. Relevance of the sorghum crop with emphasis on its contamination with mycotoxins. Thesis. National University of La Plata, Argentina.

    [8]

    Griffin GF, Chu FS. 1987. Toxicity of the Alternaria metabolites alternariol, alternariol methyl ether, altenuene, and tenuazonic acid in the chicken embryo assay. Applied and Environmental Microbiology 46:1420−22

    doi: 10.1128/aem.46.6.1420-1422.1983

    CrossRef   Google Scholar

    [9]

    Yekeler H, Bitmiş K, Ozçelik N, Doymaz MZ, Calta M. 2001. Analysis of toxic effects of Alternaria toxins on esophagus of mice by light and electron microscopy. Toxicologic Pathology 29:492−97

    doi: 10.1080/01926230152499980

    CrossRef   Google Scholar

    [10]

    Rosett T, Sankhala RH, Stickings CE, Taylor MEU, Thomas R. 1957. Studies in the biochemistry of micro-organisms. 103. Metabolites of Alternaria tenuis Auct.: culture filtrate products. Biochemistry Journal 67:390−400

    doi: 10.1042/bj0670390

    CrossRef   Google Scholar

    [11]

    Lee HB, Patriarca A, Magan N. 2015. Alternaria in food: ecophysiology, mycotoxin production and toxicology. Mycobiology 43:93−106

    doi: 10.5941/MYCO.2015.43.2.93

    CrossRef   Google Scholar

    [12]

    Meronuck RA, Steele JA, Mirocha CJ, Christensen CM. 1972. Tenuazonic acid, a toxin produced by Alternaria alternata. Applied on Microbiology 23:613−17

    doi: 10.1128/am.23.3.613-617.1972

    CrossRef   Google Scholar

    [13]

    Steyn PS, Rabie CJ. 1976. Characterization of magnesium and calcium tenuazonate from Phoma sorghina. Phytochemistry 15:1977−79

    doi: 10.1016/S0031-9422(00)88860-3

    CrossRef   Google Scholar

    [14]

    Rychlik M, Lepper H, Weidner C, Asam S. 2016. Risk evaluation of the Alternaria mycotoxin tenuazonic acid in foods for adults and infants and subsequent risk management. Food Control 68:181−85

    doi: 10.1016/j.foodcont.2016.03.035

    CrossRef   Google Scholar

    [15]

    Bandyopadhyay R, Mughogho LK, Satyanarayana MV, Kalisz ME. 1991. Occurrence of airborne spores of fungi causing grain mold over a sorghum crop. Mycological Research 95:1315−20

    doi: 10.1016/S0953-7562(09)80583-2

    CrossRef   Google Scholar

    [16]

    Hussaini AM, Timothy AG, Olufunmilayo HA, Ezekiel AS, Godwin HO. 2009. Fungi and some mycotoxins found in mouldy sorghum in Niger State, Nigeria. World Journal of Agricultural Sciences 5(1):5−17

    Google Scholar

    [17]

    de Oliveira RC, Carnielli-Queiroz L, Correa B. 2018. Epicoccum sorghinum in food: occurrence, genetic aspects and tenuazonic acid production. Current Opinion on Food Science 23:44−48

    doi: 10.1016/j.cofs.2018.05.011

    CrossRef   Google Scholar

    [18]

    Prendes LP, Merín MG, Fontana AR, Bottini RA, Ramirez ML, et al. 2018. Isolation, identification and selection of antagonistic yeast against Alternaria alternata infection and tenuazonic acid production in wine grapes from Argentina. International Journal of Food Microbiology 266:14−20

    doi: 10.1016/j.ijfoodmicro.2017.10.033

    CrossRef   Google Scholar

    [19]

    González HH, Martínez EJ, Resnik SL. 1997. Fungi associated with sorghum grain from Argentina. Mycopathologia 139:35−41

    doi: 10.1023/a:1006803901969

    CrossRef   Google Scholar

    [20]

    Emateguy L, Giorda LM, Lombardo L, Astoreca A. 2018. Aislamiento y caracterización de hongos potencialmente toxicogénicos asociados a granos de sorgo en Argentina. 5° Latin American Congress of Engineering and Applied Sciences "CLICAP 2018", Mendoza, Argentina, 2018. pp. 239. http://fcai.uncuyo.edu.ar/upload/01-memorias-clicap-2018-resumenes.pdf

    [21]

    Boerema GH, Gruyter J, Noordeloos ME, Hamers MEC. 2004. Phoma identification manual. Differentiation of specific and infraspecific taxa in culture. Wallingford: CABI. www.cabidigitallibrary.org/doi/book/10.1079/9780851997438.0000

    [22]

    Aveskamp MM, de Gruyter J, Woudenberg JHC, Verkley GJM, Crous PW. 2010. Highlights of the Didymellaceae: a polyphasic approach to characterize Phoma and related pleosporalean genera. Studies in Mycology 65:1−60

    doi: 10.3114/sim.2010.65.01

    CrossRef   Google Scholar

    [23]

    King AD Jr, Hocking AD, Pitt JI. 1979. Dichloran-rose bengal medium for enumeration and isolation of moulds from foods. Applied of Environmental Microbiology 37:959−64

    doi: 10.1128/aem.37.5.959-964.1979

    CrossRef   Google Scholar

    [24]

    Andersen B, Hansen ME, Smedsgaard J. 2005. Automated and unbiased image analyses as tools in phenotypic classification of small-spored Alternaria spp. Phytopathology 95:1021−29

    doi: 10.1094/PHYTO-95-1021

    CrossRef   Google Scholar

    [25]

    Tannous J, Atoui A, El Khoury A, Kantar S, Chdid N, et al. 2015. Development of a real-time PCR assay for Penicillium expansum quantification and patulin estimation in apples. Food Microbiology 50:28−37

    doi: 10.1016/j.fm.2015.03.001

    CrossRef   Google Scholar

    [26]

    Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied of Environmental Microbiology 61(4):1323−30

    doi: 10.1128/aem.61.4.1323-1330.1995

    CrossRef   Google Scholar

    [27]

    Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41:95−98

    Google Scholar

    [28]

    Raja HA, Miller AN, Pearce CJ, Oberlies NH. 2017. Fungal identification using molecular tools: a primer for the natural products research community. Journal of Natural Products 80:756−70

    doi: 10.1021/acs.jnatprod.6b01085

    CrossRef   Google Scholar

    [29]

    Chen Q, Hou LW, Duan WJ, Crous PW, Cai L. 2017. Didymellaceae revisited. Studies in Mycology 87:105−59

    doi: 10.1016/j.simyco.2017.06.002

    CrossRef   Google Scholar

    [30]

    Hou LW, Groenewald JZ, Pfenning LH, Yarden O, Crous PW, et al. 2020. The phoma-like dilemma. Studies in Mycology 96:309−96

    doi: 10.1016/j.simyco.2020.05.001

    CrossRef   Google Scholar

    [31]

    Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947−48

    doi: 10.1093/bioinformatics/btm404

    CrossRef   Google Scholar

    [32]

    Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688−90

    doi: 10.1093/bioinformatics/btl446

    CrossRef   Google Scholar

    [33]

    de Gruyter J, Aveskamp MM, Woudenberg JHC, Verkley GJM, Groenewald JZ, et al. 2009. Molecular phylogeny of Phoma and allied anamorph genera: Towards a reclassification of the Phoma complex. Mycological Research 113:508−19

    doi: 10.1016/j.mycres.2009.01.002

    CrossRef   Google Scholar

    [34]

    Stokholm MS, Wulff EG, Zida EP, Thio IG, Néya JB, et al. 2016. DNA barcoding and isolation of vertically transmitted ascomycetes in sorghum from Burkina Faso: Epicoccum sorghinum is dominant in seedlings and appears as a common root pathogen. Microbiological Research 191:38−50

    doi: 10.1016/j.micres.2016.05.004

    CrossRef   Google Scholar

    [35]

    Aveskamp MM, de Gruyter J, Crous PW. 2008. Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance. Fungal Diversity 31:1−18

    Google Scholar

    [36]

    Chen Q, Jiang JR, Zhang GZ, Cai L, Crous PW. 2015a. Resolving the Phoma enigma. Studies in Mycology 82:137−217

    doi: 10.1016/j.simyco.2015.10.003

    CrossRef   Google Scholar

    [37]

    Chen Q, Zhang K, Zhang G, Cai L. 2015b. A polyphasic approach to characterise two novel species of Phoma (Didymellaceae) from China. Phytotaxa 197:267−81

    doi: 10.11646/phytotaxa.197.4.4

    CrossRef   Google Scholar

    [38]

    Aveskamp MM, Verkley GJM, de Gruyter J, Maurice MA, Woudenberg JHC, Crous PW. 2009. DNA phylogeny reveals polyphyly of Phoma section Peyronellaea and multiple taxonomic novelties. Mycologia 101(3):363−82

    doi: 10.3852/08-199

    CrossRef   Google Scholar

    [39]

    Oliveira RC, Goncalves SS, Silva CDC, Dilkin P, Madrid H, et al. 2019. Polyphasic characterization of Epicoccum sorghinum: A tenuazonic acid producer isolated from sorghum grain. International Journal of Food Microbiology 292:1−7

    doi: 10.1016/j.ijfoodmicro.2018.12.004

    CrossRef   Google Scholar

  • Cite this article

    Hipperdinger ML, Colman DI, Gortari MC, Pereyra CM, Astoreca AL. 2024. Characterization of Epicoccum isolates obtained from Argentinean sorghum grain samples. Studies in Fungi 9: e003 doi: 10.48130/sif-0024-0004
    Hipperdinger ML, Colman DI, Gortari MC, Pereyra CM, Astoreca AL. 2024. Characterization of Epicoccum isolates obtained from Argentinean sorghum grain samples. Studies in Fungi 9: e003 doi: 10.48130/sif-0024-0004

Figures(3)  /  Tables(2)

Article Metrics

Article views(3447) PDF downloads(1056)

ARTICLE   Open Access    

Characterization of Epicoccum isolates obtained from Argentinean sorghum grain samples

Studies in Fungi  9 Article number: e003  (2024)  |  Cite this article

Abstract: Sorghum has numerous agronomic advantages, a great economic importance in food production and various industrial applications. Its consumption has increased in the last ten years and probably its importance may even increase in the future, considering its relationship with global warming since this plant is less demanding with water. However, its productivity is affected by various fungal diseases with the production of mycotoxins that cause great economic losses. Alternaria, Epicoccum and Pyricularia genera are the main fungal contaminants in sorghum grains, and recognized producers of tenuazonic acid, a mycotoxin previously found in assayed sorghum samples in the Mycology and Mycotoxicology laboratory belonging to the Center for Research and Development in Industrial Fermentations. Fungal isolates obtained from these sorghum grains from the National Institute of Agricultural Technology (INTA, Manfredi, Córdoba, Argentina) were characterized using a polyphasic approach based on morphological and genetic characteristics and in the ability to produce mycotoxins. Morphological analysis suggested the identity of Epicoccum sorghinum, which was later confirmed by molecular analysis. The ability of these isolates to produce tenuazonic acid was evaluated and it was determined that 65% of the studied isolates produced tenuazonic acid at variable levels. This is the first study that provides a molecular approach to E. sorghinum isolates in Argentina and clearly confirms the wide genetic and phenotypic variability previously reported for this species in other countries. The presence of these tenuazonic acid-producing isolates in sorghum grains represent an economic and health problem for Argentina that it is considered one of the main exporters worldwide.

    • Sorghum is the fifth most important cereal worldwide, after corn, wheat, rice and barley[1]. The particular agronomic characteristics of sorghum have led to an increase in the area under cultivation in recent years, since it can be included in rotations and be beneficial for the soil, occupying a fundamental role in the new Argentina agro-industrial chain and gaining more and more worldwide relevance[2]. The uses of sorghum are multiple: it is used mainly in animal feed (especially for cattle) and also in human consumption (food for celiacs). Some properties make it suitable as an input for the production of paper, adhesives, mineral refinement and sausage production, among other industrial uses[3]. These qualities have been reflected in a notable increase in its consumption worldwide. However, their productivity and economic value are threatened by fungal diseases[4] that reduce yields and alter the quality and safety of crops due to the presence of mycotoxins such as aflatoxins, fumonisins, zearalenone and deoxynivalenol[3]. However, in recent years, the focus has been on another mycotoxin, tenuazonic acid (TeA), since it was associated with the contamination of sorghum grains and derivatives[5,6]. Its presence was recently reported in 100% of the sorghum samples analyzed in our laboratory, and the isolates analyzed in this work were obtained from those same samples[7].

      Tenuazonic acid [(S)-3-acetyl-5-(S)-sec-butyltetramic acid)] is a derivative of tetramic acid, a potent inhibitor of protein biosynthesis that causes various pathologies in animals and man[8,9]. Tenuazonic acid was first isolated by Rosett et al.[10] and its production is fundamentally associated with the Alternaria genus[11] and, to a lesser extent, with other fungal species such as Epicoccum sorghinum (= Phoma sorghina) and Pyricularia oryzae[12,13]. However, in recent years the scientific community has paid special attention to this toxin due to its persistent occurrence in foods and beverages, and mainly after the Bavarian Health and Food Safety established a permitted limit in sorghum/millet-based baby foods (500 μg/kg)[14].

      Epicoccum sorghinum (Sacc.) Aveskamp, Gruyter & Verkley 2010, in addition to being one of the main fungal contaminants in pre and post-harvest sorghum grains[15,16], is a recognized producer of tenuazonic acid. According to Oliveira et al.[17] there are numerous reports of its presence in food and beverages in recent years, although few report its presence in sorghum and derivatives. Not enough attention has been paid to the relationship between TeA contamination and the presence of E. sorghinum, which is why more studies are needed to understand the association between TeA contamination of food and the presence of E. sorghinum in cereals. There is clear evidence of the involvement of Alternaria in contamination with TeA in food, especially in sorghum grains as a producer of that mycotoxin[18]. The presence of E. sorghinum in sorghum grains from the humid Argentine Pampa has been reported for more than a decade[19], however, there are no previous reports in Argentina that associate it with the presence of TeA.

      In a previous study carried out by this research group[20], the mycotoxicological quality of 19 samples of visibly healthy sorghum grains destined for animal consumption was evaluated. These grains were harvested in March 2017 and sent post-harvest for analysis without prior storage. One hundred grains of each sample previously disinfected were placed in Dichloran-Glycerol 18% (DG18) and Dichloran Rose Bengal Chloramphenicol (DRBC) medium, incubated at 28 °C during 7 d and the infection percentage was calculated. It was observed that 100% of assayed sorghum grain samples were contaminated with several fungal genera that potentially produce mycotoxins, being Epicoccum genus the most prevalent (84%). This fact, added to the limited current information on the occurrence of this fungal species in this cereal in Argentina, is intended to characterize the isolates of Epicoccum obtained from the sorghum samples previously analyzed.

    • From a total of 180 isolates of several fungal genera obtained from sorghum grain samples (experimental hybrids) from the experimental station of the National Institute of Agricultural Technology (INTA)-Manfredi, Córdoba, 40 isolates belonging to Epicoccum genus were used in order to carry out this study.

      These isolates were deposited in the Collection of the Mycotoxins Laboratory of the Center for Research and Development in Industrial Fermentations (CINDEFI-CONICET-UNLP), where they are preserved by freeze-drying and cryopreservation.

    • For the morphological characterization, the Phoma Identification Manual was used[21]. All isolates were inoculated on oat agar (OA) and malt extract agar (MEA) and incubated in complete darkness at 22 °C for 7 d. The OA medium contained rolled oats (65 g·L−1) and purified agar (20 g·L−1), while the MEA medium contained the following components: malt extract (20 g·L−1), peptone (10 g·L−1), dextrose (20 g·L−1) and purified agar (20 g·L−1). Subsequently, the plates were kept for an additional 7 d at 22 °C with a day-night regime of approximately 13 h of UV light and 11 h of darkness to stimulate the pigmentation of the colonies and the formation of pycnidia[21]. The diameter and the descriptions of the colony were made after 7 d of incubation from the isolates grown in MEA whereas the micromorphological structures were studied from the isolates from OA cultures as Aveskamp et al.[22] suggest. Preparations were mounted in distilled water to study the mature ascomata/conidiomata, ascospores/conidia and conidiogenous cells. Observations were conducted with a Leica DM2500 microscope. The sizes of the structures were determined by averaging the measurements of 50 replicates of each structure.

    • In order to evaluate the toxigenic potential of 40 assayed isolates, plates containing DRYES medium[23] were inoculated with each E. sorghinum isolate (at three points equidistant from each other) and incubated for 14 d at 25 °C in darkness. Basal medium consisted of glucose (10 g·L−1), peptone (5 g·L−1), MgSO4·7H2O (0.5 g·L−1); K2HPO4 (10 g·L−1), agar (15 g·L−1) and rose bengal (5% [wt/vol] aqueous). Filter-sterilized chlortetracycline was added to sterilized media to give a final concentration of 10 µg mL−1.

      The extraction was carried out at micro-scale using the method described by Andersen et al.[24] for Alternaria metabolites. Three agar plugs from the centre of each colony, and therefore nine plugs from each isolate, were placed in a 4 mL vial. One mL of ethyl acetate with the addition of 1% (v/v) formic acid was added to each vial and the toxin was extracted by sonication for 30 min. The extract was transferred to a clean 2 mL vial, evaporated to dryness under N2 flow and re suspended in 200 µL of a solution of methanol : water (50/50). The extract was filtered (through filter syringe filters, 17 mm, 0.45 μm, nylon membranes, TITAN) and kept at −18 °C until analysis.

    • HPLC grade acetonitrile (ACN) was purchased from Sigma–Aldrich and all other chemicals utilized in this study were HPLC quality. Tenuazonic acid standard was dissolved in methanol by further dilution with acidified water (pH 4.0) to obtain concentrations of 30, 50, 80 and 100 mg mL−1.

    • The HPLC equipment used was the Waters 717 plus Autosampler, equipped with a quaternary pump and the Empower software (Chromatography Data System, CDS, Waters Corporation, Milford, MA, USA) for data analysis. The TeA was analyzed after separation on a reverse phase column using a C18 column (150 mm × 4.6 mm, 5 μm particle sizes, Waters Corporation) with an ultraviolet photodiode array detector set at 280 nm.

      The mobile phase consisted of methanol : water (70:30, v/v) containing 300 mg of zinc sulphate L−1 with a constant flow rate of 1 mL·min−1. Each analysis was performed in duplicate. Photodiode array detection (DAD) was performed to control toxin identity; the injection volume was 20 μL and the retention time was around 10 ± 1 min. Identification was performed by comparing retention time and spectra monitored (280 nm) by a photodiode array detector of peak in the sample with those of the pure toxin standard, and external calibration was used for quantitation. The calibration curve for quantification purposes was constructed using the toxin standards, and the values were obtained by correlation of concentration and peak-area.

      The quantification limits of the method were taken as the minimum amount of toxin detected in the samples that allowed obtaining contrary information using the diode array detector. Detection limits using the DAD detector were measured as three times the reference standard variation under the same conditions used for those samples. The limit of quantification (LOQ) for TeA was 60 μg·kg−1.

    • Of the 40 studied isolates, nine isolates were selected for the molecular characterization, including representatives of each of the morphological groups observed, as well as isolates both producers and non-producers of TeA.

    • DNA extraction was done according to the protocol described by Tannous et al.[25] with some modifications. For the production of biomass, each isolate was inoculated in an Erlenmeyer flask with 2% of yeast extract and 15% of sucrose (YES broth) for 24 h, the mycelium was taken with sterile forceps and placed in a sterile Eppendorf. Then 700 µL of CTAB buffer [1 M Tris-HCl pH 8.4 (10 mL), NaCl (8.2 g), 0.5M EDTA pH 8 (5 mL), CTAB (2 g), distilled water (100 mL)] preheated to 65 °C was added and pipetted several times until a homogeneous suspension was formed. Then, it was incubated at 65 °C for half an hour, 600 µL of chloroform was added and shaken. They were centrifuged at maximum speed for 10 min. The upper aqueous phase was transferred to an Eppendorf tube, and the same volume of cold isopropanol was added to precipitate the DNA. The tubes were inverted 2−3 times and incubated for 30 min in the −20 °C freezer. They were centrifuged at maximum speed for 10 min. Supernatants were removed and the pellets washed with 600 µL of 70% ethanol. They were centrifuged at maximum speed for 10 min and the upper phase were carefully removed. The pellets were allowed to dry at room temperature and resuspended in 60 µL of sterile DNase-free water. The samples obtained were measured in NanoDrop™ 2000/2000c Spectrophotometers (Thermo Scientific) to confirm the presence of DNA in the observed precipitate and the degree of purification.

    • The extracted DNA was used to amplify two gene regions with the polymerase chain reaction (PCR). The 5.8S ribosomal RNA (rRNA) gene was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) and β-tubulin target gene (TUB2) was amplified with primers Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC)[26]. PCR was performed using a 50 mL reaction mixture containing the following (per reaction): 50 ng of genomic DNA; 5X GoTaq reaction buffer; 0.2 mM (concentration of each deoxynucleoside triphosphate); 2 mM concentration of each primer (ITS1-ITS4 and Bt2a-Bt2b); 1.25 units of GoTaq DNA polymerase. Amplifications with both sets of primers were performed in a GeneAmp_PCR System 9700 (Applied Biosystems) and the PCR program was as follows: 95 °C for 2 min and 30 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 45 s, and extension at 72 °C for 1 min 45 s followed by a 10 min final extension at 72 °C. Five microliters of the mixture were analysed by electrophoresis on 1% agarose gels and visualized by ethidium bromide (0.4 mg·mL−1).

      Amplified and purified gene products were sent to sequence by Macrogen services (Macrogen Inc., Seul Korea). It was purified with AMPure XP beads (Beckman-Coulter), and the DNA was sequenced by capillary electrophoresis with the Genetic Analyzer 3500xl (Applied Biosystems) equipment.

    • Sequences were handled with BioEdit 7.0.5.3 software[27] which included examining the chromatograms files, assembling the forward and reverse reads and manual trimming. Combinated sequences of ITS and TUB2 were used. The similarity of nucleotide sequences separated and combined were calculated using the BLAST procedure (http://blast.ncbi.nlm.nih.gov) by database Nucleotide collection (nr/nt). Hits for each query sequence exceeded the threshold for coverage and sequence similarity recommended by expert mycology researchers[28].

      To construct the cladogram, phylogenetically close isolates to E. sorghinum previously reported by Chen et al.[29] & Hou et al.[30] were used to provide robustness to our analysis. Subsequent multiple alignment was generated with ClustalW[31]. Maximum Likelihood analyses including 1000 bootstrap replicates, which were conducted using RAxML[32]. A general time reversible (GTR) model was applied with a gamma distributed rate variation. The resulting tree was viewed using FigTree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree). Leptospaheria doliolum CBS 505.75 was selected as an outgroup.

    • Significant variations in the macromorphological characteristics of the 40 analyzed E. sorghinum isolates were observed, as expected considering the high intraspecific variation presented by this group of fungi[33]. This fact allowed us to differentiate the isolates into three specifically defined groups (A, B and C) based, mainly, on their growth rate and their ability to produce pigments and exudates (Fig. 1). All the characteristics described below were observed after 7 d of incubation in MEA medium. Group A included 12 isolates with smaller diameter colonies, visibly furrowed, mycelium with a light centre that becomes darker towards the periphery and pink edges; intense pink reverse, especially in the centre, the intensity of the colour decreases towards the periphery of the colony, with the youngest mycelium being whitish. Some of these isolates presented transparent exudates. On the other hand, 21 isolates are classified within group B and the colonies, in this case, had an intermediate diameter, floccose but not scarce with mycelium from pink in the centre to greyish green towards the periphery, culminating in whitish colour; reverse of homogeneous intense brown to almost black colour, with reddish pigment that extends to the culture medium. Finally, group C was represented by seven isolates whose colonies showed the greatest development over time, presenting soft grooves, a light brown centre that turns salmon, with white edges; clear back, light salmon centre that turns whitish towards the periphery.

      Figure 1. 

      Macroscopic characteristics of E. sorghinum: colony on MEA medium after 7 incubation days (front and reverse). Representatives of morphological groups A, B and C.

      The members of the B group covered the whole Petri dish, in contradistinction to the members of the other two groups whose colonies reached a maximum diameter between 60−75 mm.

      The macromorphology observed in the colonies grown in OA was similar for all the analyzed isolates, showing no differences between the morphological groups described. The colony reached a diameter between 50−90 mm, with regular edges, and olive-green conidia. The colonies showed a compact and felty texture, while on the reverse a brown pigmentation was observed.

      All the studied isolates showed typical micromorphological characteristics of this species: brown globose pycnidia with a straight neck, of 69 to 11.5 × 44.5 to 90 µm in size (n = 50); multicellular hyaline to brown chlamydospores, massively produced with measurements ranging between 3 and 50 μm, and mostly ovoid conidia of 3.5 to 5.5 × 1.8 to 3 µm (n = 50) (Fig. 2).

      Figure 2. 

      Micromorphological structures of E. sorghinum. (a) hyaline/brown dictyochlamydospores, and (b) Hyaline/brown glabrous pycnidia. Scale bars = 10 μm.

    • A considerable variability in mycotoxin production was also observed as it happened with the morphological diversity. Regarding the toxigenic capacity of E. sorghinum, the results suggest a toxicological risk for animals exposed to tenuazonic acid (TeA) through the consumption of feed contaminated with this producer species. This assertion is based on the correlation between the sorghum samples contaminated with TeA and the origin of the isolates that turned out to be TEA-producers isolates. Sixty-five percent of the analyzed isolates (n = 40) were producers of TeA with levels that ranged from 112 to 47,237 μg·kg−1. Table 1 shows the TeA concentration by the 26 TeA-producing E. sorghinum isolates.

      Table 1.  Tenuazonic acid (TeA) concentration produced by assayed E. sorghinum isolates and their corresponding morphological group.

      Morphological groupIsolatesTeA concentration (μg·kg−1)
      ALMCIN-2.113,846.39
      LMCIN-5.37,556.21
      LMCIN-5.7112.45
      LMCIN-5.1111,948.50
      LMCIN-7.128,000.83
      LMCIN-8.12,001.46
      LMCIN-9.61,679.33
      LMCIN-9.115,129.46
      LMCIN-11.1548.78
      LMCIN-12.43,870.20
      LMCIN-18.4721.33
      BLMCIN-1.125,890.30
      LMCIN-3.216,395.00
      LMCIN-3.111,289.45
      LMCIN-7.23,058.24
      LMCIN-7.3389.49
      LMCIN-9.37,790.25
      LMCIN-9.105,900.17
      LMCIN-11.718,374.58
      LMCIN-13.547,237.28
      LMCIN-15.36,720.12
      LMCIN-16.43,245.55
      CLMCIN-6.92,190.36
      LMCIN-12.84,069.33
      LMCIN-18.716,280.38
      LMCIN-19.28,130.35
    • The phylogenetic analysis of the ITS and TUB2 sequences separately and the morphological characteristics finally allowed us to identify the analyzed strains as E. sorghinum. The analysis by Blast database could identify the majority of the isolates as E. sorghinum, whose e-values and percentage of identity were of 0.0 and 100%, respectively. Except for the isolate LMCIN-18.4 (e-value 0.0 and percentage of identity 100%) that was identified as Phoma sp.

      Most of the isolates showed 100% similarity in the analyzed sequences, therefore not all of them were included in the phylogenetic analysis, since the objective of the work was to verify the morphological identification and to determine the degree of similarity with those reported strains.

      Table 2 shows the access number of GenBank of the nucleotide sequences of the assayed isolates in this study and the number access of the sequences used by the phylogenetic analysis.

      Table 2.  Reference sequences selected according to the taxonomic closeness and downloaded from GenBank to construct the phylogenetic tree.

      SpeciesIsolateCountryGenBank accession
      ITSTUB2
      E. sorghinumLMCIN-1.12ArgentineOQ971382OR125009
      E. sorghinumLMCIN-1.12ArgentineOQ971382OR125010
      E. sorghinumLMCIN-5.11ArgentineOQ971384OR125011
      E. sorghinumLMCIN-6.9ArgentineOQ971385OR125012
      E. sorghinumLMCIN-9.6ArgentineOQ971386OR125013
      E. sorghinumLMCIN-9.11ArgentineOQ971387OR125014
      E. sorghinumLMCIN-11.7ArgentineOQ971388OR125015
      E. sorghinumLMCIN-12.8ArgentineOQ971389OR125016
      E. sorghinumLMCIN-18.4ArgentineOQ971390OR125017
      E. sorghinumCBS 179.80Puerto RicoFJ427067FJ427173
      E. sorghinumCBS 627.68FranceFJ427072FJ427178
      E. sorghinumLC 4860ChinaKY742116KY742358
      E. viticisLC 5126ChinaKY742118KY742360
      E. camelliaeLC 4858ChinaKY742091KY742333
      E. latusicollumLC 5158ChinaKY742101KY742343
      E. pimprinumCBS 246.60IndiaFJ427049FJ427159
      E. longiostiolatumCBS 886.95Papua New GuineaFJ427074FJ427180
      Leptosphaeria doliolumCBS 505.75NetherlandsJF740205JF740144

      Figure 3 shows the phylogenetic dendrogram constructed starting the combined ITS + TUB2. Associations between macro morphological variation, toxicogenic capacity and the phylogenetic results were found. In this way, LMCIN-9.11, LMCIN-9.6 and LMCIN-5.11 isolates were grouped in a cluster presenting all these isolates the morphology described within group A; on the other hand, isolates representatives of morphological group B were grouped into the following cluster: LMCIN-1.12, LMCIN-3.11 and LMCIN-11.7 isolates. It is highlight that all the isolates mentioned above are mycotoxin-producing isolates while the two non-mycotoxin-producing isolates included in the molecular analysis (LMCIN-6.9 and LMCIN-12.8) are located in the same subnode, however, in this case there was no correlation with the macromorphological characteristics since they belong to different morphological groups.

      Figure 3. 

      Phylogenetic tree of the Epicoccum isolates obtained from sorghum samples, derived from sequences of the ITS and β-tubulin region of the nuclear ribosomal DNA.

      Other results of the taxonomic search for isolates: LMCIN-1.12, LMCIN-3.11, LMCIN-6.9, LMCIN-11.7, LMCIN-12.8, were relationated to Epicoccum latusicollum with similar values confidence to obtained above.

    • Epicoccum sorghinum is a fungal species studied worldwide in the last decade, however, in Argentina there are no current records of its incidence in sorghum grains or the occurrence of tenuazonic acid in that crop. This would be the first work in Argentina that emphasizes a new and emerging pathogen of many vegetable crops. This study also provides a molecular phylogenetic approach to E. sorghinum strains isolated from sorghum in Argentina, confirming their significant genetic and phenotypic variability. Oliveira et al.[17] have isolated this species from different cereals from tropical and subtropical areas. In Argentina as well as in other countries, its distribution has been underestimated due to the difficulty in morphological identification. Currently, molecular tools are used to identify species within the Phoma complex, achieving satisfactory results[6,34].

      Species of the Didymellaceae family are cosmopolitan and distributed in a wide range of environments. Most members of this family are phytopathogens of diverse hosts, most of them showing no specificity[3537]. The various associations with the host plant and its varied morphology make the accurate identification of species in this family challenging[22,36]. However, Chen et al.[36] published a robust main tree has been developed based on internal transcribed spacer regions and 5.8S nrDNA sequences (ITS), partial 28S large subunit (LSU) nrDNA sequences, and partial regions of the second largest subunit of RNA polymerase II (rpb2) and β-tubulin (tub2). To complement our cladogram, we included several Epicoccum type species used by these authors to investigate if the phylogenetic relationships among the isolates corresponded with morphological results and TeA production. We also included the isolate E. longiostiolatum CBS 886.95 in the phylogenetic analysis because it was originally identified as Phoma sorghina, but subsequent studies confirmed it forms a distinct clade from other strains of this species. In later phylogenetic analyses, where P. sorghina was transferred to the genus Epicoccum, the two isolates reported so far of E. longiostiolatum were excluded. More recently, in a phylogenetic study by Hou et al.[30], these two isolates formed a well-supported clade distant from E. sorghinum. Based on the group's phylogenetic history, it is not surprising that the LMCIN-18.4 isolate shows similar phylogenetic distances to both other analyzed isolates in this study and to Epicoccum strains belonging to other species.

      Several researchers[6,17,34] have identified E. sorghinum by amplifying only the ITS region of rRNA. Taxonomic studies[22,38] have shown that molecular analysis of a single sequence is insufficient for resolving the group's phylogeny. In this study, molecular tools were used to complement the morphological analysis of the strains and authenticate their identity. However, a more comprehensive systematic study is needed to make sense of the phylogenetic relationships presented in the cladogram.

      It is important to highlight that there are no studies of TeA production by E. sorghinum in Argentina, and there are only studies in Brasil reporting the ability of E. sorghinum isolates to produce TeA. Oliveira et al.[17] assessed the ability of a smaller number of E. sorghinum isolates also obtained from sorghum samples to produce this mycotoxin. However, the extraction and quantification methodology assayed, including the media in which the capacity was tested were different that those used in this study. They observed a percentage of producing isolates similar to that found in the present study (57%) but with much lower concentrations. One year later, the same author analyzed the capacity to produce TeA of 11 isolates and observed that 100% of them produced toxin at levels ranging from 98.6 to 148,000 μg·kg−1, concentrations that exceeded those found in our study[39]. However, it would be necessary to widen the number of analyzed isolates to be able to assert that the behaviour of this species is similar in both cases.

      This prompts us to continue studying these isolates in depth and to evaluate the transcription profiles of the TeA (TAS1) biosynthetic gene to show whether its expression is consistent with the production of TeA under the conditions in which all the isolates were tested in this study. Knowing this could serve for the formulation of some type of bioinput that blocks or considerably reduces the production of mycotoxins from the varieties of E. sorghinum present in Argentina. In order to propose strategies to sow and postharvest storage of this sorghum and avoid their TEA-contaminated, future in situ ecophysiology studies could be conducted.

      This preliminary study reveals that E. sorghinum isolates obtained from sorghum showed wide phenotypic variability, confirming high intraspecific diversity. In addition, it was determined that most of them were TeA producers, representing an economic and sanitary problem for the producers of that crop in Argentina. This finding is an important advance to focus on agroecological alternatives such as the search for bio-inputs (microorganisms isolated from the sorghum ecosystem) based on microorganisms with a fungistatic/fungicidal effect against the growth of these this species and consequently inhibit the TeA production. However, these results transcend the mere replacement of technologies, and challenge us to broaden the look and study of the productive aspects that enhance the contamination of sorghum grains by various fungal species with the expectation of achieving extensive agro-ecological based production that ensures the quality and safety of the sorghum grains that are harvested in Argentina.

      Genus Epicoccum exhibits significant genetic and phenotypic variability, making its accurate identification challenging. This has sparked considerable debate and taxonomic changes in recent years. Nonetheless, its environmental, economic, and health significance warrants further ecological and taxonomic research.

    • The authors confirm contribution to the paper as follows: Marcela Hipperdinger: Writing– original draft, molecular characterization and investigation. Déborah Colman: Methodology, formal analysis phylogenetic and investigation. Cecilia Gortari: Morphological characterization and investigation. Carina Pereyra: Physiological characterization, writing – review and editing and supervision. Andrea Astoreca: Conceptualization, resources, writing – review and editing, supervision, project administration and funding acquisition. All authors reviewed the results and approved the final version of the manuscript.

    • All data generated or analyzed during this study are included in this published article.

      • This work was financed by the Consejo Nacional de Investigaciones Científicas y Tecnológicas and Universidad Nacional de La Plata.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2024 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (3)  Table (2) References (39)
  • About this article
    Cite this article
    Hipperdinger ML, Colman DI, Gortari MC, Pereyra CM, Astoreca AL. 2024. Characterization of Epicoccum isolates obtained from Argentinean sorghum grain samples. Studies in Fungi 9: e003 doi: 10.48130/sif-0024-0004
    Hipperdinger ML, Colman DI, Gortari MC, Pereyra CM, Astoreca AL. 2024. Characterization of Epicoccum isolates obtained from Argentinean sorghum grain samples. Studies in Fungi 9: e003 doi: 10.48130/sif-0024-0004

Catalog

  • About this article

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return