Search
2021 Volume 1
Article Contents
ARTICLE   Open Access    

A high-throughput S-RNase genotyping method for apple

More Information
  • Knowledge of the genotypes for the self-incompatibility locus (S-locus) in apple varieties and in genotypes being used as parents is critical for breeding and commercial production. We present a high-throughput set of molecular markers for the identification of 13 common S-RNase alleles (S1, S2, S3, S5, S7, S8, S9, S10, S20, S23, S24, S25 and S28). This set is composed of seven allele-specific quantitative PCR-based High-Resolution Melting assays and four multi-allelic SSR markers. Validation of these markers was performed using 86 apple accessions, including cultivars with known S-genotypes and recent commercial varieties arising from the Plant & Food Research (PFR) cultivar breeding programme. We also characterized the S-genotypes of 183 genotypes representing some of the most valuable parents within PFR’s cultivar breeding programme. The results of this work demonstrate the practical usefulness of this marker set to provide accurate cross-compatibility information to optimise choice of pollenisers in commercial apple orchard design, and to identify compatible parents and guide parental selection when executing apple breeding programmes, to optimise fruit crop yield and quality.
  • 加载中
  • Supplemental Table S1 List of 86 commercial apple cultivars used as a validation set in this study, allele sizes (bp) per marker, observed and expected (by previous published assays) S-genotypes and parental pedigrees. a S-genotypes in disagreement with previous reports, * S-genotypes not reported prior this study and (?) Unknown S-allele or unconfirmed pedigree. Each different S-allele and its associated allele sizes are highlighted in a different colour.
    Supplemental Table S2 List of 183 apple genotypes from the PFR cultivar breeding programme grouped by family, allele sizes (bp) per marker and observed S-genotypes.
  • [1] Franklin-Tong V, Franklin FCH. 2003. Gametophytic self-incompatibility inhibits pollen tube growth using different mechanisms. Trends in Plant Science 8:598−605 doi: 10.1016/j.tplants.2003.10.008

    CrossRef   Google Scholar

    [2] Končalová MN. 1978. D. de Nettancourt Incompatibility in angiosperms. Folia Geobotanica et Phytotaxonomica 13:370 doi: 10.1007/BF02851938

    CrossRef   Google Scholar

    [3] Charlesworth D. 2010. Self-incompatibility. F1000 Biology Reports 2:68 doi: 10.3410/B2-68

    CrossRef   Google Scholar

    [4] McClure BA, Franklin-Tong V. 2006. Gametophytic self-incompatibility: understanding the cellular mechanisms involved in "self" pollen tube inhibition. Planta 224:233−45 doi: 10.1007/s00425-006-0284-2

    CrossRef   Google Scholar

    [5] Roalson EH, Mccubbin AG. 2003. S-RNases and sexual incompatibility: structure, functions and evolutionary perspectives. Molecular Phylogenetics and Evolution 29:490−506 doi: 10.1016/s1055-7903(03)00195-7

    CrossRef   Google Scholar

    [6] Minamikawa M, Kakui H,Wang S, Kotoda N, Kikuchi S, et al. 2010. Apple S locus region represents a large cluster of related, polymorphic and pollen-specific F-box genes. Plant Molecular Biology 74:143−54 doi: 10.1007/s11103-010-9662-z

    CrossRef   Google Scholar

    [7] Kubo KI, Entani T, Takara A, Wang N, Fields AM, et al. 2010. Collaborative non-self recognition system in S-RNase–based self-incompatibility. Science. 330:796−799 doi: 10.1126/science.1195243

    CrossRef   Google Scholar

    [8] Okada K, Moriya S, Haji T, Abe K. 2013. Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.). Plant Reproduction 26:101−11 doi: 10.1007/s00497-013-0212-0

    CrossRef   Google Scholar

    [9] Zisovich A, Stern RA, Goldway M. 2009. Identification of seven haplotype-specific SFBs in European pear (Pyrus communis) and their use as molecular markers. Scientia Horticulturae 121:49−53 doi: 10.1016/j.scienta.2009.01.006

    CrossRef   Google Scholar

    [10] Pratas MI, Aguiar B, Vieira J, Nunes V, Teixeira V, et al. 2018. Inferences on specificity recognition at the Malus × domestica gametophytic self-incompatibility system. Scientific Reports 8:1717 doi: 10.1038/s41598-018-19820-1

    CrossRef   Google Scholar

    [11] Broothaerts W. 2003. New findings in apple S-genotype analysis resolve previous confusion and request the re-numbering of some S-alleles. Theoretical and Applied Genetics 106:703−14 doi: 10.1007/s00122-002-1120-0

    CrossRef   Google Scholar

    [12] Broothaerts W, Keulemans J, Van Nerum I. 2004. Self-fertile apple resulting from S-RNase gene silencing. Plant Cell Reports 22:497−501 doi: 10.1007/s00299-003-0716-4

    CrossRef   Google Scholar

    [13] Kim H, Hattori G, Hirata Y, Kim DI, Hwang JH, et al. 2006. Determination of self-incompatibility genotypes of Korean apple cultivars based on S-RNase PCR. Journal of Plant Biology 49:448−54 doi: 10.1007/BF03031125

    CrossRef   Google Scholar

    [14] Kim H, Kakui H, Kotoda N, Hirata Y, Koba T, et al. 2009. Determination of partial genomic sequences and development of a CAPS system of the S-RNase gene for the identification of 22 S haplotypes of apple (Malus × domestica Borkh.). Molecular Breeding 23:463−72 doi: 10.1007/s11032-008-9249-4

    CrossRef   Google Scholar

    [15] Matsumoto S, Kitahara K. 2000. Discovery of a new self-incompatibility allele in apple. HortScience 35:1329−32 doi: 10.21273/HORTSCI.35.7.1329

    CrossRef   Google Scholar

    [16] Nybom H, Sehic J, Garkava-Gustavsson L. 2008. Self-incompatibility alleles of 104 apple cultivars grown in northern Europe. The Journal of Horticultural Science and Biotechnology 83:339−44 doi: 10.1080/14620316.2008.11512389

    CrossRef   Google Scholar

    [17] Sassa H, Nishio T, Kowyama Y, Hirano H, Koba T, et al. 1996. Self-incompatibility (S) alleles of the rosaceae encode members of a distinct class of the T2/S ribonuclease superfamily. Molecular and General Genetics 250:547−57 doi: 10.1007/BF02174443

    CrossRef   Google Scholar

    [18] Sheick R, Serra S, Tillman J, Luby J, Evans K, et al. 2020. Characterization of a novel S-RNase allele and genotyping of new apple cultivars. Scientia Horticulturae 273:109630 doi: 10.1016/j.scienta.2020.109630

    CrossRef   Google Scholar

    [19] Larsen B, Ørgaard M, Toldam-Andersen TB, Pedersen C. 2016. A high-throughput method for genotyping S-RNase alleles in apple. Molecular Breeding 36:24 doi: 10.1007/s11032-016-0448-0

    CrossRef   Google Scholar

    [20] De Franceschi P, Bianco L, Cestaro A, Dondini L, Velasco, R. 2018. Characterization of 25 full-length S-RNase alleles, including flanking regions, from a pool of resequenced apple cultivars. Plant Molecular Biology 97:279−96 doi: 10.1007/s11103-018-0741-x

    CrossRef   Google Scholar

    [21] Broothaerts W, Van Nerum I, Keulemans J. 2004. Update on and review of the incompatibility (S-) genotypes of apple cultivars. HortScience 39:943−47 doi: 10.21273/HORTSCI.39.5.943

    CrossRef   Google Scholar

    [22] Morita J, Abe K, Matsumoto S. 2009. S-RNase genotypes of apple cultivars grown in Japan and development of a PCR-RFLP method to identify the S6- and S21-RNase alleles. The Journal of Horticultural Science and Biotechnology 84:29−34 doi: 10.1080/14620316.2009.11512475

    CrossRef   Google Scholar

    [23] Dreesen RSG, Vanholme BTM, Luyten K, Van Wynsberghe L, Fazio G, et al. 2010. Analysis of Malus S-RNase gene diversity based on a comparative study of old and modern apple cultivars and European wild apple. Molecular Breeding 26:693−709 doi: 10.1007/s11032-010-9405-5

    CrossRef   Google Scholar

    [24] Sassa H, Mase N, Hirano H, Ikehashi H. 1994. Identification of self-incompatibility-related glycoproteins in styles of apple (Malus × domestica). Theoretical and Applied Genetics 89:201−5 doi: 10.1007/BF00225142

    CrossRef   Google Scholar

    [25] Sakurai K, Brown SK, Weeden NF. 1997. Determining the self-incompatibility alleles of Japanese apple cultivars. HortScience 32:1258−59 doi: 10.21273/HORTSCI.32.7.1258

    CrossRef   Google Scholar

    [26] Janssens GA, Goderis IJ, Broekaert WF, Broothaerts W. 1995. A molecular method for S-allele identification in apple based on allele-specific PCR. Theoretical and Applied Genetics 91:691−98 doi: 10.1007/BF00223298

    CrossRef   Google Scholar

    [27] Bošković R, Tobutt KR. 1999. Correlation of stylar ribonuclease isoenzymes with incompatibility alleles in apple. Euphytica 107:29−43 doi: 10.1023/A:1003516902123

    CrossRef   Google Scholar

    [28] Komori S, Soejima J, Abe K, Kotoda N, Kato H. 2000. Analysis of S-allele genotypes and genetic diversity in the apple, In ISHS Acta Horticulturae 538, eds. Geibel M, Fischer M, Fischer C. Dresden, Germany: International Society for Horticultural Science http://doi.org/10.17660/actahortic.2000.538.9
    [29] Matsumoto S. 2014. Apple pollination biology for stable and novel fruit production: search system for apple cultivar combination showing incompatibility, semicompatibility, and full-compatibility based on the S-RNase allele database. International Journal of Agronomy 2014:138271 doi: 10.1155/2014/138271

    CrossRef   Google Scholar

    [30] Broothaerts W, Janssens GA, Proost P, Broekaert WF. 1995. cDNA cloning and molecular analysis of two self-incompatibility alleles from apple. Plant Molecular Biology 27:499−511 doi: 10.1007/BF00019317

    CrossRef   Google Scholar

    [31] Kitahara K, Matsumoto S. 2002. Cloning of the S25 cDNA from 'McIntosh' apple and an S25-allele identification method. The Journal of Horticultural Science and Biotechnology 77:724−28 doi: 10.1080/14620316.2002.11511563

    CrossRef   Google Scholar

    [32] Matsumoto S, Furusawa Y, Komatsu H, Soejima J, Soejima J. 2015. S-allele genotypes of apple pollenizers, cultivars and lineages including those resistant to scab. The Journal of Horticultural Science and Biotechnology 78:634−37 doi: 10.1080/14620316.2003.11511676

    CrossRef   Google Scholar

    [33] Long S, Li M, Han Z, Wang K, Li T. 2010. Characterization of three new S-alleles and development of an S-allele-specific PCR system for rapidly identifying the S-genotype in apple cultivars. Tree Genetics & Genomes 6:161−68 doi: 10.1007/s11295-009-0237-6

    CrossRef   Google Scholar

    [34] Matsumoto S, Okada K, Kojima A, Shiratake K, Abe K. 2011. S-RNase genotypes of apple (Malus domestica Borkh.) including new cultivars, lineages, and triploid progenies. The Journal of Horticultural Science and Biotechnology 86:654−60 doi: 10.1080/14620316.2011.11512818

    CrossRef   Google Scholar

    [35] Bus VGM, van de Weg WE, Peil A, Dunemann F, Zini E, et al. 2012. The role of Schmidt 'Antonovka' in apple scab resistance breeding. Tree Genetics & Genomes 8:627−42 doi: 10.1007/s11295-012-0470-2

    CrossRef   Google Scholar

    [36] Janick J, Cummins J N, Brown S, Hemmat M. 1996. Apples. in Fruit breeding, Tree and Tropical Fruits, eds. Janick J, Moore NJ, Vol1:632. Hoboken: John Wiley & Sons, Inc.
    [37] Brancher TL, Hawerroth MC, Kvitschal MV, Manenti DC, Guidolin AF. 2020. Self-incompatibility alleles in important genotypes for apple breeding in Brazil. Crop Breeding and Applied Biotechnology 20:1−9 doi: 10.1590/1984-70332020v20n4a54

    CrossRef   Google Scholar

    [38] Halász J, Hegedűs A, György Z, Pállinger É, Tóth M. 2011. S-genotyping of old apple cultivars from the Carpathian basin: methodological, breeding and evolutionary aspects. Tree Genetics & Genomes 7:1135−45 doi: 10.1007/s11295-011-0401-7

    CrossRef   Google Scholar

    [39] Laurens F. 1998. Review of the current apple breeding programmes in the world: objectives for scion cultivar improvement. In ISHS Acta Horticulturae 484: Eucarpia Symposium on Fruit Breeding and Genetics, eds. Tobutt KR, Alston FH. Oxford, United Kingdom: International Society for Horticultural Science. pp. 163–70 http://doi.org/10.17660/ActaHortic.1998.484.26
    [40] Matsumoto S, Eguchi T, Bessho H, Abe K. 2007. Determination and confirmation of S-RNase genotypes of apple pollinators and cultivars. The Journal of Horticultural Science and Biotechnology 82:323−29 doi: 10.1080/14620316.2007.11512236

    CrossRef   Google Scholar

    [41] Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure from small quantities of fresh leaf tissues. Phytochem Bull 19:11−15

    Google Scholar

    [42] Chagné D, Lin-Wang K, Espley RV, Volz RK, How NM, et al. 2013. An ancient duplication of apple MYB transcription factors is responsible for novel red fruit-flesh phenotypes. Plant Physiology 161:225−39 doi: 10.1104/pp.112.206771

    CrossRef   Google Scholar

    [43] Daccord N, Celton JM, Linsmith G, Becker C, Choisne N, et al. 2017. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nature Genetics 49:1099−106 doi: 10.1038/ng.3886

    CrossRef   Google Scholar

    [44] Du L, Zhang C, Liu Q, Zhang X, Yue B. 2018. Krait: an ultrafast tool for genome-wide survey of microsatellites and primer design. Bioinformatics 34:681−83 doi: 10.1093/bioinformatics/btx665

    CrossRef   Google Scholar

    [45] Schuelke M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18:233−34 doi: 10.1038/72708

    CrossRef   Google Scholar

    [46] Hulce D, Li X, Snyder-Leiby T, Liu CS. 2011. GeneMarker® genotyping software: tools to increase the statistical power of DNA fragment analysis. Journal of biomolecular techniques 22:S35−S36

    Google Scholar

    [47] Feng DF, Doolittle RF. 1987. Progressive sequence alignment as a prerequisite to correct phylogenetic trees. Journal of Molecular Evolution 25:351−60 doi: 10.1007/BF02603120

    CrossRef   Google Scholar

    [48] Chagné D, Gasic K, Crowhurst RN, Han Y, Bassett HC, et al. 2008. Development of a set of SNP markers present in expressed genes of the apple. Genomics 92:353−58 doi: 10.1016/j.ygeno.2008.07.008

    CrossRef   Google Scholar

  • Cite this article

    López-Girona E, Bowatte DR, Smart MEM, Alvares S, Brancher TL, et al. 2021. A high-throughput S-RNase genotyping method for apple. Fruit Research 1: 10 doi: 10.48130/FruRes-2021-0010
    López-Girona E, Bowatte DR, Smart MEM, Alvares S, Brancher TL, et al. 2021. A high-throughput S-RNase genotyping method for apple. Fruit Research 1: 10 doi: 10.48130/FruRes-2021-0010

Figures(3)  /  Tables(1)

Article Metrics

Article views(10525) PDF downloads(2370)

ARTICLE   Open Access    

A high-throughput S-RNase genotyping method for apple

Fruit Research  1 Article number: 10  (2021)  |  Cite this article

Abstract: Knowledge of the genotypes for the self-incompatibility locus (S-locus) in apple varieties and in genotypes being used as parents is critical for breeding and commercial production. We present a high-throughput set of molecular markers for the identification of 13 common S-RNase alleles (S1, S2, S3, S5, S7, S8, S9, S10, S20, S23, S24, S25 and S28). This set is composed of seven allele-specific quantitative PCR-based High-Resolution Melting assays and four multi-allelic SSR markers. Validation of these markers was performed using 86 apple accessions, including cultivars with known S-genotypes and recent commercial varieties arising from the Plant & Food Research (PFR) cultivar breeding programme. We also characterized the S-genotypes of 183 genotypes representing some of the most valuable parents within PFR’s cultivar breeding programme. The results of this work demonstrate the practical usefulness of this marker set to provide accurate cross-compatibility information to optimise choice of pollenisers in commercial apple orchard design, and to identify compatible parents and guide parental selection when executing apple breeding programmes, to optimise fruit crop yield and quality.

    • Apple (Malus domestica Borkh.) fruit are the final products of the fusion between two gametic nuclei: the male pollen grain and the female egg-cell. After the pollen grain is deposited onto the flower's stigma, it germinates and grows a pollen tube down the style to fertilize the egg-cell. The pollen can come from the same plant or from a different one. However, a broadly distributed, pre-zygotic and genetic mechanism called gametophytic self-incompatibility (GSI) prevents the self-fertilization of closely related individuals, promoting out-crossing and thereby maintaining genetic diversity. GSI is found in many angiosperms, including the Solanaceae, Rosaceae, and Plantaginaceae families[1,2].

      Apple has a homomorphic GSI mechanism where inhibition of self-fertilization occurs through genetic or biochemical mechanisms that function regardless of flower morphology[3] operating in a reproductive system, which has two different and tightly linked components (S-genes). One is located in the pistil and the other is specific to the pollen[1,4]. The pistil component is an extracellular ribonuclease (S-RNase) that inhibits self-pollen tube growth[5]. The pollen-specific component is controlled by multiple genes called SFBBs (i.e. S-locus F-box brothers) that interact with the S-RNase in an allele-specific way[6]. Both components work in a collaborative manner to control the single, multi-genic and multi-allelic S-locus. Each SFBB interacts with S-RNases, such that non-self-RNases are degraded allowing pollen tube growth[7] (Fig. 1). The selective pressures underlying this collaborative recognition mechanism generate a lower diversity of the S-pollen genes than is found on the S-pistil locus, which shows a higher degree of allelic polymorphism[8]. However, these multi-genic S-haplotypes are inherited as single segregating units keeping their functionality across generations[9,10].

      Figure 1.  Genetic control of gametophytic self-incompatibility (GSI) in Malus. The S-locus is composed of two tightly linked components, found in the pollen and pistil respectively. In GSI, the pollen self-incompatibility phenotype is controlled gametophytically, i.e., the genotype of the haploid pollen itself (gametophyte) determines its incompatibility type. For example, the pollen composition of a certain pollen donor plant is phenotypically half S1 and half S2. In the female parent, two alleles are co-dominant and both are expressed in the pistil. Pollen inhibition occurs when there is a match between the donor pollen S-haplotype and either of the two haplotypes present in the pistil, producing an incompatible reaction that inhibits the growth of the 'self' pollen tube growth. Three types of reactions can occur during a cross: (a) incompatible; neither of the two gametes will germinate, (b) semi-compatible; half the donor pollen will be inhibited and the other half will germinate and grow normally, (c) compatible; all pollen will germinate and grow normally.

      Apple breeding relies on compatible and productive cross-pollination. A breeder needs information about the self-incompatibility genotypes (S-genotypes) of both parents to execute successful crosses and facilitate the selection of individuals carrying a combination of desirable traits. Traditionally, incompatibility was determined using time-consuming cross-pollination experiments, where successful fruit set was measured over many combinations of parents. Recently, less time consuming and more cost-effective molecular markers have been implemented to replace such field experiments, using either allele-specific markers amplifying a single S-RNase allele[1118] or markers based on restriction enzyme digestion of polymerase chain reaction (PCR) products (cleaved amplified polymorphic sequences CAPS or PCR-RFLP). Simple Sequence Repeat (SSR) markers have also been used for screening S-alleles[14,15,19]. CAPS and SSR markers have helped determine most of the S-genotypes for common commercial apple varieties. However, most of the existing assays involve the use of restriction enzymes after PCR reactions and the visualization of the products on agarose gels, making them very laborious and time-consuming when handling large numbers of samples. This can be problematic evidenced when new seedlings/selections, that are potential parents in a breeding programme, need to be checked for compatibility each season.

      The objective of this study was to develop and validate a high-throughput and practical method to identify 13 different apple S-RNase alleles (S1, S2, S3, S5, S7, S8, S9, S10, S20, S23, S24, S25 and S28). Our method is composed of seven allele-specific High-Resolution Melting (HRM) and four multi-allelic SSR markers, which do not require post-PCR restriction enzyme digestions or agarose gels for allele-scoring analysis. We used as controls 70 out of a total of 86 commercial apple cultivars for which S-genotypes had already been reported, to validate the accuracy of our markers for identifying the correct S-alleles. We then demonstrate the usefulness of these assays by genotyping 183 genotypes representing some of the most valuable parents within the PFR breeding program.

    • The four developed SSR markers Myb110a1_PFR, Myb110a2_PFR, Myb110b_PFR and GSI_SSR_PFR amplify polymorphic PCR products associated with 13 different S-alleles (S1, S2, S3, S5, S7, S8, S9, S10, S20, S23, S24, S25 and S28) (Table 1). All four primer pairs amplify PCR products linked to the S1, S3, S5, S7, S24 and S25 S-alleles. Both Myb110b_PFR and GSI_SSR_PFR can be used to distinguish the S10 S-allele. Myb110b_PFR exclusively identifies S2 and S9, whilst GSI_SSR_PFR amplifies a PCR product linked to the S28 S-allele. All four primer pairs, except Myb110b_PFR, amplify PCR products linked to S20 and all four but Myb110a1_PFR can identify the S23 S-allele.

      Table 1.  Primer sequences of quantitative real-time PCR and SSR-based markers.

      Marker name Type Primer sequences '5 - 3' Physical location Genbank locus S-Rnase alleles and product sizes (bp)
      S1_apple_PFR HRM Forward ACAGGCCACTGGTGGA not found in reference genome MG598487.1:1981−1996 S1, S20, S24 (38)
      Reverse ATTGCGTATGGCATTTTCAAT Chr17:30844510−30844530 MG598487.1:1998−2018
      S2_apple_PFR HRM Forward TTGAACAAATATTATTCAATGGGGA Chr17:31240988−31240964 MG598488.1:860−884 S2 (54)
      Reverse CATCGTAACTATATATACCATCCGCGTA Chr17:31240964−31240943 MG598488.1:886−913
      S5_apple_PFR HRM Forward AATTTATAAAACACGTGATCA not found in reference genome MG598491.1:326−346 S5 (43)
      Reverse GCTCCTATTGATCGATCAT not found in reference genome MG598491.1:350−370
      S8_apple_PFR HRM Forward TTCGATTATTTTCAATTTACGCTT Chr17:31240889−31240871 MG598494.1 :1159−1182 S8 (162)
      Reverse ATTTAAGGTTGTTTCTTTGCAATAC not found in reference genome MG598494.1 :1296−1320
      S9_apple_PFR HRM Forward GCTCAGGAAATGACCCAATATAC not found in reference genome MG598495.1:1284−1306 S9 (61)
      Reverse AATATTACCTTAGTAGAATTCATGGTTGT not found in reference genome MG598495.1:1315−1344
      S23_apple_PFR HRM Forward TTTATGGCCTTCAAACTGGAA not found in reference genome MG598501.1:1065−1085 S23 (42)
      Reverse CAGAAGATTGGGTCGGGT not found in reference genome MG598501.1:1089−1106
      S28_apple_PFR HRM Forward TGCCTCGCTCTTGAACAAA not found in reference genome MG598505.1:782−800 S28 (47)
      Reverse CCCCGTAATTCCCATTGAATAATA not found in reference genome MG598505.1:805−828
      Myb110a1_PFR SSR Forward TCTCCCTCATCCCAGAACA Chr17:32151473−32151491 S1 (166), S3 (184), S5 (180), S7 (170), S20 (158), S24 (176), S25 (188)
      Reverse CGAGCCAAACAAAATTGGA Chr17:32151642−32151624
      Myb110a2_PFR SSR Forward CTCTCCCTCATCCCAGAACA Chr17:32151472−32151491 S1 (325), S3 (343), S5 (339), S7 (314), S20 (317), S23 (309), S24 (320), S25 (347)
      Reverse TCCTACTCGGCTCGACAATC Chr17:32151800−32151781
      Myb110b_PFR SSR Forward CTTCGGGCTTATTTGGGTTT Chr17:32187809−32187790 S1 (202), S2 (233), S3 (214), S5 (209), S7 (191), S9 (247), S10 (216), S23 (239), S24 (217), S25 (238)
      Reverse TTTGCCCCTTCAAAGATCAG Chr17:32187616−32187635
      GSI_SSR_PFR SSR Forward GCCCCTTACATTCCTTTTCTTT Chr17:31704109−31704130 S1 (314), S3 (338), S5 (335), S7 (324), S10 (328), S20 (317), S23 (322), S24 (217), S25 (329), S28 (352)
      Reverse CAATCTTGAGTTGTCGTTGGAG Chr17:31704430−31704409

      Additionally, we developed seven quantitative-PCR allele-specific markers. Six of these markers (S1, S2, S5, S9, S23 and S28_apple_PFR) amplify specific single nucleotide polymorphisms (SNPs) identified by a pairwise alignment of the coding sequences of 25 S-RNase alleles, previously published by De Franceschi et al.[20]. The seventh marker for S8 was adapted to work with our HRM methodology, by modifying the forward primer from the previously published primers pairs (Larsen et al.[19]) (Fig. 2). When used on their own, without the SSR markers, these S-allele-specific qPCR markers can identify eight S-alleles in total. The S1_apple PFR marker can resolve the S20, S24 and S1 S-alleles as separate melting curves.

      Figure 2.  High resolution melting (HRM) curve profiles of seven S-allele-specific markers. Amplification curves of real-time PCR marker assays (left panels), HRM difference plots, where the derivative fluorescence signal (dF/dT) is plotted as a function of temperature (right panels). Each colour represents a specific S-genotype as shown by the legends. Light grey represents samples that were not amplified in the real-time PCR.

    • The S-allele genotyping of 86 apple accessions (81 different cultivars, counting a red mutant sport of 'Fuji' and four 'Gala' mutant sports) – including 70 traditional varieties with previously reported S-alleles, five varieties with unknown S-alleles and ten newer cultivars arose from the PFR breeding programme – was undertaken using the new set of molecular markers. The S-genotypes of 59 of the 70 traditional apple varieties were in complete agreement with previous reports and the S-genotypes of their respective parents. For ten accessions, our results for one of the two S-alleles disagreed with those published previously (Supplemental Table S1): 'Abbondanza' had been reported as (S3 S5)[20], while (S3 S7) S-alleles were detected in the present study. 'Antonovka' was reported (S8 S32)[20], while we detected S8 and other allele sizes that could equally be linked to S3, S7 or S20. 'Priscilla' was reported as (S3 S9)[21] or (S9 S20)[22] or (S7 S10)[20], while we detected (S7 S28) alleles. 'Ingrid Marie' was reported as (S5 S43)[23], while our most likely observed S-genotype was (S3 S5), 'James Grieve' was reported as (S5 S8)[23], while we detected (S5 S20). 'Ben Davis' was reported as (S5 S23) while we detected (S7 S23); 'Jonathan' was reported previously as (S7 S9)[2428]; however, we detected (S9 S23). 'Early Cortland' has been reported as (S5 S28)[29,30]; however, we report it here as (S1 S28)[29]. 'Yellow Transparent' has been reported as (S1 S5)[31,32], while we identified (S1 S7 S9 S24). Finally, 'McIntosh' was reported as (S10 S25)[11,23], while we found (S2 S25).

      The new markers also resolved both S-alleles for three out of four traditional varieties with previously undetermined S-genotypes: 'Red Dougherty' (S1 S7), 'Pinkie' (S2 S3) and 'Merton Russet' (S5 S24). We identified only the S25 allele for 'Paulared'. The ten cultivars that have recently arisen from the PFR breeding programme were successfully typed for their S-alleles: 'Scired' (S2 S9), 'PremA093' (S2 S9), 'Scifresh' (S2 S24), 'PremA153' (S2 S24), 'PremA34' (S2 S3), 'Scilate' (S5 S9), 'PremA96' (S5 S9), 'PremA17' (S5 S24), 'PremA280' (S5 S24) and 'PremA129' (S9 S24). For the Canadian variety 'Sunrise' we identified S-alleles (S3 S24).

      For a remaining set of five cultivars, just one S-allele could be determined: 'Hetlina' and 'Geheimrat Dr Oldenburg' were reported as (S1 S16b)[12] and (S3 S28)[20], respectively. The respective S1 and S3 S-alleles were detected in our study; however, we did not identify allele sizes that could be linked to either S16b or S28 using the new markers. For 'Benoni', reported as (S5 S11)[33], we detected the S5 allele, as well as other marker alleles not linked to the expected S11. 'Regent' was reported as (S3 S10)[34]; we identified the S10 allele, but no S3-linked alleles were observed. Instead, an allele linked to S25 was detected. Finally, 'Panenské České' was reported as (S7 S10)[20], but only the S7 allele was detected using three SSR markers. Marker alleles linked to S10 were not found, rather the Myb110b marker detected alleles linked to S3 and S24.

    • When the new markers were screened over 183 genotypes, including some of the most valuable parents within the PFR apple cultivar breeding programme, we were able to determine their S-genotypes. These genotypes are the seedlings of 76 biparental families (Supplemental Table S2). For 32 of these families (from a total of 132 selections), the S-genotypes of their parental pedigrees could be verified. The frequency of S-RNases alleles found among this pool of genotypes is shown in Fig. 3. Among the 183 genotypes screened, S2 was the most common S-allele, present in 21.3% of the samples, followed by S3 (19.9%), S24 (18.6%), S5 (17.5%), S23 (13.7%), S9 (5.7%) and S7 (0.8%). Rare S-alleles were S28 (0.5%), S25, S1 and S20 (0.3% each). Only 2.2% of the S-alleles could not be assigned. The most prevalent genotypes were: (S3 S24), (S2 S24), (S2 S5), (S2 S23), (S3 S23), (S3 S5) and (S5 S23) observed at frequencies of: 7.1, 7.1, 6.3, 5.2, 4.4, 4.1 and 3%, respectively. Other less prevalent genotypes were: (S5 S24), (S5 S9), (S3 S9), (S2 S3), (S9 S24), (S2 S9) and (S23 S24), which were observed at frequencies of 2.2, 1.6, 1.4, 1.4, 1.4, 1.1 and 0.8%, respectively. The following rare genotypes were each found at a frequency of 0.3%: (S1 S3), (S2 S7), (S5 S7), (S7 S9), (S20 S28) and (S3 S28). For 1.1% of the selections, just one allele was identified (S3 ?) in 0.8% and (S23 ?) in 0.3%).

      Figure 3.  Frequency of S-alleles and S-genotypes of the 183 apple advanced selections of the PFR’s breeding programme. Inner plot shows the percentage frequency distribution of S-alleles from the total 366 alleles observed among the 183 genotypes tested. Outer plot represents the absolute frequency of each S-genotype. All outer slices not showing a percentage value in the figure represent 0.3% respectively.

    • A high-throughput method to identify the S-genotypes of apples was developed and validated in this study. This will help to inform the selection of compatible parental combinations when designing a crossing programme. We present a new high-throughput marker set based on four multi-allelic SSR and seven allele-specific qPCR markers. The four SSR markers can identify 13 S-RNase-alleles (S1, S2, S3, S5, S7, S8, S9, S10, S20, S23, S24, S25 and S28) and the seven HRM markers allow the identification of eight S-RNase-alleles (S1, S2, S5, S8, S9, S20, S23 and S28). The identification of the 13 S-alleles can be achieved economically and efficiently by employing three PCR reactions, using two (Myb110b_PFR and GSI_SSR_PFR) of the four SSR markers and the S8_apple_PFR marker (with the addition of an M13-tail on the 3'-end). These three markers can be multiplexed by using different fluorescent labels that can be simultaneously separated and scored on a capillary electrophoresis instrument.

      Alternatively, for laboratories with access to a real-time qPCR system, as well as a capillary electrophoresis instrument, the seven qPCR allele-specific markers and one of the SSR markers (either Myb110b_PFR or GSI_SSR_PFR) will be sufficient to identify and resolve the whole set of 13 S-alleles.

      The usefulness of the new markers was validated in over 59 of 70 well-established apple cultivars with known S-genotypes. Ten of the discrepancies with previous assays are supported by our results from parental pedigree allele analysis, acknowledging that some might be mistakes with labelling, or incorrect germplasm harvest: 'Priscilla' has been reported as (S3 S9)[21], (S9 S20)[22] or (S7 S10)[20], while we detected (S7 S28), with S28 as probably coming from 'Starking Delicious', which is reported as (S9 S28)[29]. 'Ingrid Marie' was reported as (S5 S43)[23], while our most likely observed S-genotype was (S3 S5), where S5 is derived from 'Cox's Orange Pippin' (S5 S9). However, neither S43 nor S3 has been reported in 'Cox's Pomona' S-genotype (S1 S34)[19]. 'Early Cortland' has been reported as (S5 S28)[29,30], which is consistent with its parentage: 'Cortland' (S5 S25)[29] and 'Lodi' (S1 S28)[30]; however, we reported it here as (S1 S28)[29]. 'Abbondanza' was reported as (S3 S5)[20], while (S3 S7) S-alleles were detected here. 'Antonovka' was reported (S8 S32)[20], while we detected allele S8; however, we observed different allele sizes for our SSR markers that we could link to either S3, S7 or S20. There are different 'Antonovka' accessions[35], so it is probable that they have different S-genotypes. 'James Grieve' was reported as (S5 S8)[23], while we detected (S5 S20), although the Myb110b_PFR marker showed an additional 202 bp allele, which is linked to S1 S-RNase, but did not exhibit any other allele sizes linked to S1 in any of the other SSR or qPCR markers. Then, 'Ben Davis' was reported as (S5 S23), while we detected (S7 S23), with the same allele sizes found and expected for 'Lady Williams' (S7 S23). 'Jonathan' was reported previously as (S7 S9)[2428]; however, we characterised it as (S9 S23), but note that we do have molecular and phenotypic indicators suggesting this could be an incorrectly identified accession in the PFR germplasm (Vincent Bus, pers. comm.). Finally, 'Yellow Transparent' is reported as (S1 S5)[31,32], while we identified (S1 S7 S9 S24), which is consistent with this cultivar being a tetraploid sport mutant[36].

      We demonstrated the usefulness of the markers by determining the S-genotypes of ten newer cultivars arising from the PFR breeding programme ('Scired', 'PremA093', 'Scifresh', 'PremA153', 'PremA34', 'Scilate', 'PremA96', 'PremA17', 'PremA280' and 'PremA129'). The S-genotype information for such new cultivars is valuable information for growers, enabling them to plant compatible pollenisers in commercial orchards. Despite the high diversity of S-RNase alleles that have been characterized in Malus (at least 35 different S-alleles were found among cultivars in Matsumoto's database[29]), the common worldwide practise of using a relatively small pool of cultivars that combine premium fruit quality as well as resistance to pests and environmental stresses in breeding programmes leads to new cultivars with restricted allelic combinations. Among the 183 PFR apple genotypes tested here, a pool of only 11 S-alleles was found (S1, S2, S3, S5, S7, S9, S20, S23, S24, S25, and S28). This is not surprising given that all the S-alleles of the main founders of PFR's cultivar breeding programme [namely 'Splendour' (S2 S9), 'Cox's Orange Pippin' (S5 S9), 'Red Delicious' (S9 S28), 'Golden Delicious' (S2 S3), 'Red Dougherty' (S1 S7), 'Worcester Pearmain' (S2 S24), 'Jonathan' (S23 S9), 'Fuji' (S1 S9), 'Braeburn' (S9 S14), 'Granny Smith' (S3 S23), 'James Grieve' (S5 S20), 'Wagener' (S3?), 'Cripp's Pink' (S2 S23) and 'Akane' (S7 S24)[34]] have ten of these 11 S-alleles. However, it is possible that the wider parental pool also has undetected S-alleles beyond these 11, as some breeding parents, not represented in the 183 genotypes tested here, are also derived from minor founders.

      The most frequently observed allele was S2 (21.3%), which is one of the two alleles carried by 'Royal Gala' (S2 S5), a parent or grandparent in pedigrees of most of the PFR genotypes. For instance, 'Scired', 'Sciros', 'Scilate', and 'Sciray' were used as the pollen parents for many crosses and they all are progeny of a cross between 'Gala' (S2 S5) and 'Splendour' (S2 S9). 'Gala's' parentage is 'Golden Delicious' (S2 S3) and 'Kidd's Orange Red' (S5 S9), so 'Golden Delicious' is the source of this allele in 'Gala' or 'Royal Gala' crosses.

      S3 was the second most abundant allele (19.9%), being present in crosses of genotypes with 'Pinkie' in their parentage. 'Pinkie' likely inherited the allele from 'Granny Smith' (S3 S23), although we do not know the S-alleles carried by its other parent A679-2. Also, crosses produced using 'Fiesta' (S3 S5), have inherited the S3 allele from 'Idared' (S3 S7), which has 'Wagener' (S3 ?) as a parent.

      Allele S24 was observed in 18.6% of the genotypes, those arising from crosses with 'Braeburn' (S9 S24) as one of the parents: 'Scifresh' is a progeny of the cross 'Braeburn' 'Royal Gala'; while 'PremA153' is derived from a 'Gala' × 'Braeburn' cross. 'PremA129' has 'Braeburn' as a grandparent, being a progeny of 'PremA280' × 'Scired', with 'PremA280' having 'Gala' and 'Braeburn' as parents. 'PremA17' (S5 S24) also has this allele, presumably from 'Braeburn': this cultivar was derived from a cross between genotypes A045R13T007 × A020R02T167, which unfortunately are no longer available in the orchard. Another source of this allele is 'Akane' (S7 S24)[34], which inherited it from 'Worcester Pearmain' (S2 S24).

      The origin of S5 (17.5%) in our breeding programme is 'Cox's Orange Pippin' (S5 S9). Crosses that involve 'Fiesta' or 'James Grieve' have 'Cox's Orange Pippin' as a grandparent. It is also a great-grandparent in crosses that have 'Gala' as a parent and a great-great-grandparent in crosses that include cultivars such as 'Sweetie', 'PremA17' and 'PremA96' as parents.

      The S23 allele is present (13.7%) in seedlings derived from our A068 family; however, we still need to confirm the source of the allele as we do not know the S-genotypes of grand-parents. S9 is found in 5.7% of seedlings derived from crosses where one of the parents was 'Scired', or alternatively with 'Splendour' as one of the grandparents or great-grandparents. Other important sources of the S9 allele are 'Cox Orange Pippin' (S5 S9) and 'Braeburn' (S9 S24).

      At the other end of the scale, the S7 allele was only found in 4.8% progeny of crosses with 'Red Free' (S3 S7) as a parent or grandparent and in some crosses using 'Akane' (S7 S24)[34], which has 'Jonathan' (S7 S9) as the likely parental source of this allele. The alleles S25 and S28 occur rarely in the PFR breeding programme. They probably come from 'McIntosh' (S10 S25) and 'Delicious' (S9 S28), respectively; however, the pedigree of the few selections with these alleles is not complete: further information is needed to confirm this hypothesis.

      According to Sheick et al.[18], 11 S-alleles (S1, S2, S3, S5, S9, S10, S20, S23, S24, S25, and S28) are represented among the U.S. industry's most produced apples. These are predominantly coming from 'Red Delicious' (S9 S28), 'Gala' (S2 S5), 'Granny Smith' (S3 S23), 'Fuji' (S1 S9), 'Golden Delicious' (S2 S3), 'Honeycrisp' (S2 S24), 'McIntosh' (S10 S25), 'Rome' (S20 S24), 'Cripps Pink' (S2 S23), and 'Empire' (S10 S28). These same 11 S-alleles but S10 are represented in the New Zealand PFR breeding programme. Instead of S10, we have S7 included in our pool of S-alleles, which is represented in crosses having 'Jonathan' (S7 S9) and 'Red Free' (S3 S7) in their pedigree. Another recent study by Lays Brancher et al.[37] identified 11 S-alleles (S1, S2, S3, S5, S7, S9, S10, S19, S20, S23, and S24) among 42 apple genotypes, including cultivars, advanced selections and accessions of the Apple Germplasm Bank of Epagri (Caçador, Santa Catarina, Brazil). The S3 and S5 alleles were most frequent (30.2% and 18.6%, respectively). The higher frequency of these alleles can be explained as 26 of the 42 accessions tested were direct or indirect descendants from the cultivars Imperatriz (S3 S5), Golden Delicious (S2 S3) and/or Gala (S2 S5), which have served as the basis for the crosses of the Epagri Apple Breeding Program.

      A Danish study by Larsen et al.[19] found 25 S-alleles (S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11, S16b, S16c, S20, S21, S23, S24, S25, S26, S28, S31, S33, S34, S36 and S40) in 432 Malus accessions including a selection of M. domestica cultivars of mainly Danish origin (402 accessions), as well as a selection of other Malus species (30 accessions). Among the 402 Danish accessions the allele S3 (28 %) was the most common followed by S1 and S7 (both 27 %). Previous studies[16,38] using cultivars from Northern Europe and the Carpathian basin found similar results where S3 and S7 were the two most common S-alleles.

      Although selections used as parents in breeding programmes around the world are different due to consumer preferences, climate conditions, resistances to pest and diseases, etc., there is a common set of cultivars among worldwide breeding programmes[39]. These are 'Golden Delicious' (S2 S3), 'Braeburn' (S9 S24), 'Fuji' (S1 S9), 'Gala' (S2 S5), 'Granny Smith' (S3 S23), 'Idared' (S3 S7), 'Jonathan' (S7 S9) and 'Red Delicious' (S9 S28). The S-alleles carried by these cultivars are also the most common among the total 183 advanced selections tested within PFR's breeding programme. The S3 allele is the most common S-allele worldwide as seen in the previous studies mentioned here and among other older studies including European, American and Japanese cultivars[12,23,40]. This low diversity of S-RNase alleles highlights the need of introducing breeding cultivars with some of the less common S-alleles into breeding programmes to increase mate compatibility among parental selections.

    • Leaves from 86 apple cultivars were collected at PFR, Havelock North, New Zealand, and Washington State University, Pullman, WA, USA. Total genomic DNA was extracted using the cetyltrimethyl ammonium bromide (CTAB) method[41]. This DNA was used as a set for evaluating the new markers (Supplemental Table S1). Additionally, leaves from 183 apple genotypes, from 76 biparental families, were collected from trees in PFR's elite parental apple collections, to identify their S-genotypes.

    • Three new primer pairs were designed around two single sequence repeats (SSR) linked to the Myb110a and Myb110b genes[42] and named Myb110a1_PFR, Myb110a2_PFR and Myb110b_PFR, which are closely linked to the S-locus on apple chromosome 17. A fourth primer pair was designed for a SSR located within the S-locus (GSI_SSR_PFR) (Table 1). Design of the primer pairs was based on the GDDH13v1.1[43] apple genome as a reference and employed using the Krait software[44]. The M13 sequence TGTAAAACGACGGCCAGT was added to the 5′ end of the forward primer to enable the use of Schuelke's[45] approach to fluorescent labelling. PCR was performed in a 15 µL reaction mixture containing 1.5 mM MgCl2, 200 uM dNTPs, 13 nM of forward primer, 200 nM of reverse primer, 8.33 µL DNA-free water and 1× PCR Buffer (-MgCl2) and 0.5 U of Platinum™ Taq DNA polymerase (Thermo Fisher Scientific, 10966034). The conditions of the touchdown PCR included an initial denaturing at 94 °C for 2 min, then five cycles (94 °C for 55 s, 65 °C for 55 s (decreased by 1 °C each cycle), 72 °C for 1 min and 39 s), then 35 cycles (94 °C for 55 s, 55 °C for 55 s and 72 °C for 1 min and 39 s) and a final extension at 72 °C for 10 min. The final amplicons were subjected to capillary electrophoresis using an ABI 3500 DNA sequence analyser (Applied Biosystems, Foster City, USA) and sized using GenScan™ 500 LIZ Size Standard (Applied Biosystems). SSR allele profiles were analysed using GeneMarker™[46] version 2.20 (SoftGenetics LLC®, State College, PA, USA, www.softgenetics.com).

    • SNPs were identified by performing a multiple sequencing progressive pairwise alignment[47] of the coding sequences of 25 S-RNase alleles previously published by De Franceschi et al.[20] in Geneious version 10.0.9 (https://www.geneious.com), with the following parameters: global alignment with free end gaps algorithm, 70% similarity cost matrix, gap open penalty of 11.9, gap extension penalty of 2 and 2 refinement iterations.

      Seven S-RNase allele specific primer pairs named Sx_apple_PFR (x being: 1, 2, 5, 8, 9, 23 or 28 alleles) were designed to amplify a single product of 250 bp or less. These primer pairs can be used on a conventional PCR machine or by employing the High Resolution Melting (HRM) methodology[48] on a quantitative PCR instrument. The primer pairs for S8_apple_PFR marker were modified from the ones previously published by Larsen et al.[19].

      Conventional PCR reactions were carried out in 15 µL volume containing 1× PCR buffer mix (Invitrogen), 200 μM of each dNTP, 1.5 mM MgCl2, 3 μM each primer, 0.1 U Platinum™ DNA polymerase (Thermo Fisher Scientific, 10966034) and 20 ng template DNA. Amplifications were carried out on a MasterCycler ProS thermocycler (Eppendorf). The conditions of the touchdown PCR included an initial denaturing at 95 °C for 5 min, then ten cycles (94 °C for 30 s, 60 °C for 30 s (decreasing 1 degree in each cycle) and 72 °C for 45 s), then forty cycles (94 °C for 30 s, 50 °C (for S5_apple_PFR primer pair) or 55 °C (for S1, 2, 9, 23, 28_apple_PFR primer pairs) for 30 s and 72 °C for 45 s) and a final extension at 72 °C for 5 min. PCR products were then visualized on a 2% agarose gel stained with RedSafe™ 20000x (ChemBio, UK) after 1 h of electrophoresis at 100 V.

      Quantitative PCR reactions were performed in a total volume of 10 µL containing 20 ng of template DNA, 2.5 mM MgCl2, 200 nM forward and reverse primers and 1× HRM master mix (Roche Applied Science). PCR and HRM were performed on a LightCycler® 480 (Roche Diagnostics). The PCR parameters were an initial denaturation step of 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s, 55 °C for 20 s, and 72 °C for 20 s. Following amplification, the samples were heated to 95 °C for 1 min and then cooled to 40 °C for 1 min. Melting curves were generated with continuous fluorescence acquisition during a final ramp from 65 °C to 95 °C at 4.8 °C/s, followed by a final cooling step of 40 °C for 30 s. The resultant fluorescence data were processed using the LightCycler® 480 software (version 1.5; Roche Applied Science). Primer sequences, fragment sizes and their respective associated S-RNase alleles are shown in Table 1.

    • The four SSR-based markers were initially screened using a DNA set from 70 out of a total of 86 apple cultivars with known S-genotypes, based on previously reported CAPS or PCR-RFLP detection methods (as referenced in Supplemental Table S1). Following this, the seven HRM assays were screened over the same cultivars to validate the allele-specificity of each primer pair (Table 1).

      Following the screening of the first DNA set, all 11 markers for S-genotype were further validated using 183 apple genotypes from the PFR breeding programmes. The S-alleles were confirmed by verifying the S-genotype composition within each family and by examining their pedigree composition up to the grandparent level. For the PFR breeding populations, a summary of the S-genotype composition of the tested seedlings within families was made.

    • Raw data and R script for statistical analysis are available at link https://github.com/hrpelg/Rnotebook_Self-incompatibility

    • We demonstrated the efficiency of a set of markers for the S-locus in a Malus domestica germplasm set with known S-genotypes and we determined the S-genotypes of uncharacterized cultivars, with an emphasis on new commercial releases. We showed the S-genotyping efficacy of this method on a large sample of advanced apple genotypes from the PFR breeding programme, where S-genotypes were concordant with their parental pedigree.

      This robust, reproducible, simple and cost-efficient S-RNase-genotyping method is an alternative to the present molecular approaches. The existing molecular methods employ single allele specific markers per every single S-allele or use marker based restriction enzyme digestions of PCR products to distinguish among few S-alleles needing to be visualized on agarose gels. The flexibility of our method permits to know 13 different S-alleles by employing just three different PCR reactions in a laboratory provided with a capillary electrophoresis instrument. These three PCR reactions can be multiplexed in a single electrophoresis run by using three different fluorescent colours. Alternatively, if a qPCR instrument is also available, this can be done using seven different HRM-markers and a single SSR marker. The use of a qPCR instrument allows the analysis of 384 samples per run or the multiplexing of four markers per PCR for every 96 samples.

      This method is provided to scientists, breeders and growers to select compatible pollenisers and to develop new cultivars. The benefits of knowing the S-alleles that each parental selection carries are: pollination success between compatible parental pollen and pistil, higher yields of orchards planted with compatible varieties and possible parentage identificationof unknown seedlings' descent due to undesired open pollination.

      • We would like to gratefully thank Stijn Vanderzande for providing the US plant material and Susan E. Gardiner for helpful advice and review of the manuscript. This work was funded by Prevar Limited (https://prevar.co.nz).
      • The authors declare that they have no conflict of interest.
      • Supplemental Table S1 List of 86 commercial apple cultivars used as a validation set in this study, allele sizes (bp) per marker, observed and expected (by previous published assays) S-genotypes and parental pedigrees. a S-genotypes in disagreement with previous reports, * S-genotypes not reported prior this study and (?) Unknown S-allele or unconfirmed pedigree. Each different S-allele and its associated allele sizes are highlighted in a different colour.
      • Supplemental Table S2 List of 183 apple genotypes from the PFR cultivar breeding programme grouped by family, allele sizes (bp) per marker and observed S-genotypes.
      • Copyright: © 2021 by the author(s). Exclusive Licensee Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (3)  Table (1) References (48)
  • About this article
    Cite this article
    López-Girona E, Bowatte DR, Smart MEM, Alvares S, Brancher TL, et al. 2021. A high-throughput S-RNase genotyping method for apple. Fruit Research 1: 10 doi: 10.48130/FruRes-2021-0010
    López-Girona E, Bowatte DR, Smart MEM, Alvares S, Brancher TL, et al. 2021. A high-throughput S-RNase genotyping method for apple. Fruit Research 1: 10 doi: 10.48130/FruRes-2021-0010

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return