Search
Submit Manuscript
1.6CiteScore
Advanced Search
MAP  >  Grass Research
2023 Volume 3
Article Contents
Abstract
Introduction
Types of functional rice
High resistant starch rice
Colored rice
Giant embryo rice
Low glutelin rice
Golden rice
Fe and Zn fortified rice
Breeding technology of functional rice
Traditional polymerization breeding
Transgenic polymerization breeding
Molecular marker-assisted selection polymerization breeding
Cultivation and regulation technology of functional rice
Effect of light on the accumulation of active components in rice
Effect of temperature on the accumulation of active components in rice
Effect of water management on the accumulation of active components in rice
Effect of fertilizer application on the accumulation of active components in rice
Effect of harvesting time on the accumulation of active components in rice
Prevention and control of pests and diseases for functional rice
Conclusions
Acknowledgments
Conflict of interest
Rights and permissions
References
About this article
Next Previous
ARTICLE   Open Access    

Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass

  • 1.

    College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China

  • 2.

    Department of Landscape Architecture, Jiangsu Vocational College of Agriculture and Forestry, Jurong 212400, China

More Information
  • As an effective plant growth regulator, chitosan plays a positive role in enhancing heat tolerance in perennial turfgrass. The objective of this study was to elucidate whether chitosan-promoted thermotolerance was associated with the antioxidant defense system under long-term heat stress in creeping bentgrass (Agrostis stolonifera). Plants were treated with or without 100 mg∙L−1 chitosan under either heat stress (38/28 °C, day/night) or non-stressed condition (25/20 °C, day/night) for 42 d in growth chambers. Foliar application of chitosan significantly enhanced heat tolerance as reflected by the increased turf quality through inhibiting over-accumulation of reactive oxygen species, and increasing ascorbic acid content and antioxidant enzymes activities (peroxidase, POD; ascorbate peroxidase, APX; glutathione reductase, GR; dehydroascorbate reductase, DHAR). Chitosan-treated plants also had higher transcript levels of AsCu/ZnSOD, AsCATB, AsPerox4, AsAPX2, AsAPX3, AsAPX4, AsAPX6, AsAPX8, AsGR2, and AsDHAR genes in comparison to the untreated plants. The results suggested that chitosan-promotion in heat tolerance could be associated with non-enzymatic antioxidants, antioxidant enzymes, as well as relative gene expression.

  • Introduction

    With the development of the world economy, people's lifestyles have changed dramatically, and long-term high-intensity work has put many people's bodies in a sub-healthy state. The increasing incidence of various chronic diseases has not only put enormous pressure on society's healthcare systems but also caused endless suffering to people[1]. Therefore, people's demands on the functionality and safety of food are increasing, and it has become the consensus of people that 'not just eating enough, but more importantly eating well'.

    Rice is the staple food for more than half of the world's population and the main economic source for a large number of rural people[2]. However, due to the rising cost of rice cultivation, farmers are gaining less and less economic benefits from growing rice, which seriously undermines their incentive to grow rice and poses a serious threat to world food security. Increasing the added value of rice not only helps to increase farmers' income but also helps to ensure world food security. The presence of a large number of functional ingredients in rice makes it possible to increase the added value of rice, and functional rice has therefore been widely noticed.

    Functional rice refers to rice containing certain specific components that play a regulatory and balancing role in human physiological functions in addition to the nutrients necessary for human growth and development in the endosperm, embryo, and rice bran. They can increase human physiological defense mechanisms, prevent certain diseases, help recovery, delay aging, and boost physical strength and energy levels[3]. Rice is a staple food for more than half of the world's population[4], and its functional components have a great potential to be exploited for human welfare. Using functional rice as a carrier to address health problems and realize 'medicine-food homology' is an excellent motivation for promoting functional rice. The current typical functional rice is introduced in this paper. It also summarizes the breeding and cultivation technologies of functional rice.

    Types of functional rice

    High resistant starch rice

    Rice has a high glycemic index. Its long-term consumption leads to obesity, diabetes, and colon disease in many people[5]. However, the consumption of rice rich in resistant starch (RS) can greatly reduce the risk of these diseases[6]. Therefore, breeding rice varieties with high RS content has attracted considerable attention from breeders in various countries. However, the variability of RS content between different rice varieties is low, and there are few germplasm resources available for selection, thus making it challenging to breed rice varieties with high RS content using traditional breeding methods. Combining traditional and modern molecular breeding techniques can greatly improve the successful production of high RS rice breeds. Nishi et al.[7] selected a high RS rice variety EM10 by treating fertilized egg cells of Kinmaze with N-methyl-N-nitrosourea. However, its yield was very low, and it was not suitable for commercial production. Wada et al.[8] crossed 'Fukei 2032' and 'EM129' as parents and selected Chikushi-kona 85, a high RS rice variety with a higher yield than EM10. Miura et al.[9] bred ultra-high RS BeI-BEIIB double mutant rice by crossing the Abe I and Abe IIB mutant strains, and the content of RS in the endosperm reached 35.1%. Wei et al.[10] found that the simultaneous inhibition of starch branching enzyme (SBE) genes SBEIIb and SBEI in Teqing by antisense RNA could increase the RS content in rice to 14.9%. Zhu et al.[11] used RNAi technology to inhibit the expression of SBEI and SBEII genes in rice, which increased the content of RS in rice endosperm from 0 to 14.6 %. Zhou et al.[6] found that rice RS formation is mainly controlled by soluble starch synthase (SSIIA). However, its regulation is dependent on the granule-bound starch synthase Waxy (Wx), and SSIIA deficiency combined with high expression of Wxa facilitates the substantial accumulation of RS in the rice. The results of Tsuiki et al.[12] showed that BEIB deficiency was the main reason for the increased accumulation of RS in rice. Itoh et al.[13] developed new mutant rice lines with significantly higher levels of RS in rice by introducing genes encoding starch synthase and granule-bound starch synthase in the rice into the BEIB-deficient mutant line be2b.

    Colored rice

    The accumulation of anthocyanins/proanthocyanidins in the seed coat of the rice grain gives brown rice a distinct color[14]. Most common rice varieties lack anthocyanins in the seed coat, and so far, no rice variety with colored endosperm in its natural state has been identified. However, Zhu et al.[15] bred rice with purple endosperm using transgenic technology. Red rice contains only proanthocyanidins, while black and purple rice contain anthocyanidins and proanthocyanidins[16]. Red seed coat of rice was found to be controlled by the complementary effects of two central effect genes Rc and Rd. The loss of function of the Rc gene prevented the synthesis of proanthocyanidins, while the Rd gene could enhance the effect of the Rc gene in promoting proanthocyanidins synthesis[17]. Purple seed coat color is controlled by two dominant complementary genes Pb and Pp. Pb determines the presence or absence of seed coat color, and Pp determines the depth of seed coat color[18]. In addition, phycocyanin synthesis is also regulated by transcription factors such as MYB, bHLH, HY5, and WD40[14], but the exact regulatory mechanism is not clear. Colored rice is rich in bioactive components, such as flavonoids, phenolic acids, vitamin E (VE), glutelin, phytosterols, and phytic acid (PA). It also contains large amounts of micronutrients such as Ca, Fe, Zn, and Se[19], and has a much higher nutritional and health value than ordinary white rice. In addition, Zhu et al.[20] successfully developed rice with enriched astaxanthin in the endosperm by introducing the genes sZmPSY1, sPaCrtI, sCrBKT, and sHpBHY. This achievement has laid a solid foundation for the further development of functional rice industry.

    Giant embryo rice

    Giant embryo rice refers to rice varieties whose embryo volume is more than twice that of ordinary rice[21]. Rice embryo contains more nutrients than the endosperm; therefore, the nutritional value of giant embryo rice greatly exceeds that of ordinary rice. Studies have found that the levels of γ-aminobutyric acid (GABA), essential amino acids, VE, γ-oryzanol, phenols, and trace elements in giant embryo rice are considerably higher than that in ordinary rice[21]. Satoh & Omura[22] used the chemical mutagen N-methyl-N-nitrosourea to treat the fertilized egg cells of the rice variety Kinmaze to obtain a 'giant embryo' mutant. The mutants’ embryo occupied 1/4–1/3 of the rice grain volume and was 3–4 times larger than normal rice embryo[23]. Its GABA content increased dramatically after the rice was soaked in water. Maeda et al.[24] crossed the giant embryo mutant EM40 of Kinmaze with the high-yielding variety Akenohoshi to produce the giant embryo rice variety 'Haiminori'. The embryo size of 'Haiminori' is 3–4 times that of ordinary rice, and the GABA content of its brown rice is 3–4 times higher than that of 'Nipponbare' and 'Koshihikari' after soaking for four hours in water. A few genes that can regulate the size of rice embryos have been identified, and GE is the first identified rice giant embryo gene[25]. Nagasawa et al.[26] found that the loss of GE gene function resulted in enlarged embryos and smaller endosperm in rice. Lee et al.[27] found that the inhibition of LE gene expression by RNAi technology could lead to embryo enlargement in rice, but the regulatory mechanism remains to be investigated.

    Low glutelin rice

    Protein is the second most crucial nutrient in rice, accounting for 7–10% of the grain weight, and glutenin accounts for 60%–80% of the total protein content in rice grains[28]. Compared to other proteins, glutenin is more easily digested and absorbed by the body[29]. Therefore, higher glutenin content in rice can improve its nutritional value. However, people with renal disease (a common complication of diabetes) have impaired protein metabolism, and consumption of rice with lower glutelin content can help reduce their protein intake and metabolic burden[30]. Japanese breeders treated Nihonmasari with the chemical mutagen ethyleneimine and selected the low-glutelin rice mutant NM67[31]. Iida et al.[31] developed a new rice variety LGC-1 (Low glutelin content-1) with a glutelin content of less than 4% by backcrossing the NM67 mutant with the original variety 'Nihonmasari'. According to Miyahara[32], the low glutelin trait in LGC-1 is controlled by a single dominant gene Lgc-1 located on chromosome 2. Subsequently, Nishimura et al.[33] produced two rice varieties, 'LGC Katsu' and 'LGC Jun' with lower glutelin content by crossing LGC1 with a mutant line Koshikari (γ-ray induction) lacking 26 kDa globulin (another easily digestible protein).

    Golden rice

    Vitamin A (VA) is one of the essential nutrients for the human body[34]. However, rice, a staple food, lacks VA, leading to a VA deficiency in many people. β-carotene is a precursor for VA synthesis and can be effectively converted into VA in the human body[35]. Therefore, breeding rice varieties rich in β-carotene has attracted the attention of breeders in various countries. Ye et al.[36] simultaneously transferred phytoene synthase (psy), phytoene desaturase (crt I), and lycopene β-cyclase (lcy) genes into rice using the Agrobacterium-mediated method and produced the first generation of golden rice with a β-carotene content of 1.6 µg·g−1 in the endosperm. However, due to the low content of β-carotene in rice, it is difficult to meet the human body's demand for VA. To increase β-carotene content in rice, Paine et al.[37] introduced the phytoene synthase (psy) gene from maize and the phytoene desaturase (crt I) gene from Erwinia into rice. They obtained the second generation of golden rice with 37 µg g−1 of β-carotene in the endosperm, with nearly 23-fold increase in β-carotene content compared to the first generation of golden rice.

    Fe and Zn fortified rice

    Fe and Zn are essential trace elements for human beings. The contents of Fe and Zn in common rice are about 2 μg·g−1 and 16 μg·g−1, respectively[38], which are far from meeting human needs. In 2004, to alleviate micronutrient deficiencies among underprivileged people in developing countries, the Consultative Group on International Agricultural Research launched the HarvestPlus international collaborative program for improving Fe, Zn, and β-carotene levels in staple crops, with breeding targets of 13 μg·g−1 and 28 μg·g−1 for Fe and Zn in rice, respectively. Masuda et al.[39] found that expression of the nicotianamine synthase (NAS) gene HvNAS in rice resulted in a 3-fold increase in Fe and a 2-fold increase in Zn content in polished rice. Trijatmiko et al.[38] overexpressed rice OsNAS2 gene and soybean ferritin gene SferH-1 in rice, and the Fe and Zn content in polished rice of rice variety NASFer-274 reached 15 μg·g−1 and 45.7 μg·g−1, respectively. In addition, it has been found that increasing Fe intake alone does not eliminate Fe deficiency but also decreases the amount of Fe absorption inhibitors in the diet or increases the amount of Fe absorption enhancers[40]. The negatively charged phosphate in PA strongly binds metal cations, thus reducing the bioavailability of Fe and Zn in rice[41], while the sulfhydryl group in cysteine binds Fe, thereby increasing the absorption of non-heme Fe by the body[42]. To improve the bioavailability of Fe and Zn, Lucca et al.[40] introduced a heat-tolerant phytase (phyA) gene from Aspergillus fumigatus into rice and overexpressed the cysteine-rich protein gene (rgMT), which increased the content of phytase and cysteine residues in rice by 130-fold and 7-fold, respectively[40].

    Breeding technology of functional rice

    The functional quality of rice is highly dependent on germplasm resources. Current functional rice breeding mainly adopts transgenic and mutagenic technologies, and the cultivated rice varieties are mainly enriched with only one functional substance and cannot meet the urgent demand by consumers for rice enriched with multiple active components. The diversity of rice active components determines the complexity of multifunctional rice breeding. In order to cultivate multifunctional rice, it is necessary to strengthen the application of different breeding technologies. Gene polymerization breeding is a crop breeding technology that can polymerize multiple superior traits that have emerged in recent years, mainly including traditional polymerization breeding, transgenic polymerization breeding, and molecular marker-assisted selection polymerization breeding.

    Traditional polymerization breeding

    The transfer of beneficial genes in different species during traditional polymeric breeding is largely limited by interspecific reproductive isolation, and it is challenging to utilize beneficial genes between different species effectively. Gene transfer through sexual crosses does not allow accurate manipulation and selection of a gene and is susceptible to undesirable gene linkage, and in the process of breed selection, multiple backcrosses are required[43]. Thus, the period of selecting target plants is long, the breeding cost is high, and the human resources and material resources are costly[44]. Besides, it is often difficult to continue the breakthrough after a few generations of backcrossing due to linkage drag. Thus, there are significant limitations in aggregating genes by traditional breeding methods[45].

    Transgenic polymerization breeding

    Transgenic technology is an effective means of gene polymerization breeding. Multi-gene transformation makes it possible to assemble multiple beneficial genes in transgenic rice breeding rapidly and can greatly reduce the time and workload of breeding[46]. The traditional multi-gene transformation uses a single gene transformation and hybridization polymerization method[47], in which the vector construction and transformation process is relatively simple. However, it is time-consuming, laborious, and requires extensive hybridization and screening efforts. Multi-gene-based vector transformation methods can be divided into two major categories: multi-vector co-transformation and multi-gene single vector transformation[47]. Multi-vector co-transformation is the simultaneous transfer of multiple target genes into the same recipient plant through different vectors. The efficiency of multi-vector co-transformation is uncertain, and the increase in the number of transforming vectors will increase the difficulty of genetic screening, resulting in a reduced probability of obtaining multi-gene co-transformed plants. Multi-gene single vector transformation constructs multiple genes into the T-DNA region of a vector and then transfers them into the same recipient plant as a single event. This method eliminates the tedious hybridization and backcrossing process and solves the challenges of low co-transformation frequency and complex integration patterns. It can also avoid gene loss caused by multi-gene separation and recombination in future generations[47]. The transgenic method can break through the limitations of conventional breeding, disrupt reproductive isolation, transfer beneficial genes from entirely unrelated crops to rice, and shorten the cycle of polymerizing target genes significantly. However, there are concerns that when genes are manipulated, unforeseen side effects may occur, and, therefore, there are ongoing concerns about the safety of transgenic crops[48]. Marker-free transgenic technology through which selective marker genes in transgenic plants can be removed has been developed. This improves the safety of transgenic crops, is beneficial to multiple operations of the same transgenic crop, and improves the acceptance by people[49].

    Molecular marker-assisted selection polymerization breeding

    Molecular marker-assisted selection is one of the most widely used rice breeding techniques at present. It uses the close linkage between molecular markers and target genes to select multiple genes directly and aggregates genes from different sources into one variety. This has multiple advantages, including a focused purpose, high accuracy, short breeding cycle, no interference from environmental conditions, and applicability to complex traits[50]. However, few genes have been targeted for the main effect of important agronomic traits in rice, and they are mainly focused on the regulation of rice plant type and the prevention and control of pests and diseases, and very few genes related to the synthesis of active components, which can be used for molecular marker-assisted selection are very limited. Furthermore, the current technical requirements and costs for analyzing and identifying DNA molecular markers are high, and the identification efficiency is low. This greatly limits the popularization and application of functional rice polymerization breeding. Therefore, to better apply molecular marker-assisted selection technology to breed rice varieties rich in multiple active components, it is necessary to construct a richer molecular marker linkage map to enhance the localization of genes related to functional substance synthesis in rice[51]. Additionally, it is important to explore new molecular marker technologies to improve efficiency while reducing cost.

    It is worth noting that the effects of gene aggregation are not simply additive. There are cumulative additive effects, greater than cumulative epistatic effects, and less than cumulative epistatic effects among the polymerization genes, and the effects are often smaller than the individual effect. Only with a clearer understanding of the interaction between different QTLs or genes can functional rice pyramiding breeding be carried out reasonably and efficiently. Except for RS and Se, other active components of rice mainly exist in the rice bran layer, and the content of active components in the endosperm, the main edible part, is extremely low. Therefore, cultivating rice varieties with endosperm-enriched active components have broad development prospects. In addition, because crops with high quality are more susceptible to pests and diseases[52], the improvement of rice resistance to pests and diseases should be considered during the polymerization breeding of functional rice.

    Cultivation and regulation technology of functional rice

    The biosynthesis of active components in rice is influenced by rice varieties but also depends on cultivation management practices and their growth environment.

    Effect of light on the accumulation of active components in rice

    Environmental conditions have a greater effect on protein content than genetic forces[53]. Both light intensity and light duration affect the synthesis and accumulation of active components in rice. Low light intensity in the early stage of rice growth is not conducive to the accumulation of glutelin in rice grains but favors the accumulation of amylose, while the opposite is true in the late stage of rice growth[54]. Low light intensity during the grain-filling period reduces the accumulation of total flavonoids in rice[55] and decreases Fe ions' movement in the transpiration stream and thereby the transport of Fe ions to rice grains[56]. An appropriate increase in light intensity is beneficial to the accumulation of flavonoids, anthocyanins, and Fe in rice, but the photostability of anthocyanins is poor, and too much light will cause oxidative degradation of anthocyanins[57]. Therefore, functional rice is best cultivated as mid-late rice, which would be conducive to accumulating active components in rice.

    Effect of temperature on the accumulation of active components in rice

    The temperature has a great influence on the synthesis of active components in rice. An appropriate increase in the temperature is beneficial to the accumulation of γ-oryzanol[58] and flavonoids[59] in rice. A high temperature during the grain-filling period leads to an increase in glutelin content in rice[60], but an increase in temperature decreases the total phenolic content[61]. The results regarding the effect of temperature on the content of PA in rice were inconsistent. Su et al.[62] showed that high temperatures during the filling period would increase the PA content, while Goufo & Trindade[61] reported that the increase in temperature would reduce the PA content. This may be due to the different growth periods and durations of temperature stress on rice in the two studies. The synthesis of anthocyanins/proanthocyanidins in colored rice requires a suitable temperature. Within a certain range, lower temperatures favor the accumulation of anthocyanins/proanthocyanidins in rice[63]. Higher temperatures will lead to degradation, and the thermal stability of proanthocyanidins being higher than that of anthocyanins[64]. In addition, cold or heat stress facilitates GABA accumulation in rice grains[65]. Therefore, in actual production, colored rice and low-glutelin rice are best planted as late rice, and the planting time of other functional rice should be determined according to the response of its enriched active components to temperature changes.

    Effect of water management on the accumulation of active components in rice

    Moderate water stress can significantly increase the content of glutelin[66] and GABA[67] in rice grains and promote the rapid transfer of assimilation into the grains, shorten the grain filling period, and reduce the RS content[68]. Drought stress can also induce the expression of the phytoene synthase (psy) gene and increase the carotenoid content in rice[69]. Soil moisture is an important medium in Zn diffusion to plant roots. In soil with low moisture content, rice roots have low available Zn, which is not conducive to enriching rice grains with Zn[70]. Results from studies on the effect of soil water content on Se accumulation in rice grains have been inconsistent. Li et al.[71] concluded that flooded cultivation could significantly increase the Se content in rice grains compared to dry cultivation. However, the results of Zhou et al.[72] showed that the selenium content in rice grains under aerobic and dry-wet alternative irrigation was 2.44 and 1.84 times higher than that under flood irrigation, respectively. This may be due to the forms of selenium contained in the soil and the degree of drought stress to the rice that differed between experiments[73]. In addition, it has been found that too much or too little water impacts the expression of genes related to anthocyanin synthesis in rice, which affects the accumulation of anthocyanins in rice[74]. Therefore, it is recommended to establish different irrigation systems for different functional rice during cultivation.

    Effect of fertilizer application on the accumulation of active components in rice

    Both the amount and method of nitrogen application affect the accumulation of glutelin. Numerous studies have shown that both increased and delayed application of nitrogen fertilizer can increase the accumulation of lysine-rich glutelin to improve the nutritional quality of rice (Table 1). However, this improvement is not beneficial for kidney disease patients who cannot consume high glutelin rice. Nitrogen stress can down-regulate the expression of ANDs genes related to the anthocyanins biosynthesis pathway in grains, resulting in a decrease in anthocyanins synthesis[55]. Increased nitrogen fertilizer application can also increase the Fe, Zn, and Se content in rice[75,76]. However, some studies have found that increased nitrogen fertilizer application has no significant effect on the Fe content of rice[77], while other studies have shown that increased nitrogen fertilizer application will reduce the Fe content of rice[78]. This may be influenced by soil pH and the form of the applied nitrogen fertilizer. The lower the soil pH, the more favorable the reduction of Fe3+ to Fe2+, thus promoting the uptake of Fe by rice. Otherwise, the application of ammonium fertilizer can improve the availability of soil Fe and promote the absorption and utilization of Fe by rice. In contrast, nitrate fertilizer can inhibit the reduction of Fe3+ and reduce the absorption of Fe by rice[79].

    Table 1.  Effect of nitrogen fertilizer application on glutelin content of rice.
    SampleN level
    (kg ha−1)    		Application timeGlutelin content
    (g 100 g−1)    		References
    Rough rice05.67[66]
    270Pre-transplanting : mid tillering : panicle initiation : spikelet differentiation = 2:1:1:16.92
    300Pre-transplanting : mid tillering : panicle initiation : spikelet differentiation = 5:2:2:16.88
    Brown rice05.35[83]
    90Pre-transplanting : after transplanting = 4:16.01
    Pre-transplanting : after transplanting = 1:16.60
    180Pre-transplanting : after transplanting = 4:16.53
    Pre-transplanting : after transplanting = 1:17.29
    270Pre-transplanting : after transplanting = 4:17.00
    Pre-transplanting : after transplanting = 1:17.66
    Rough rice05.59[84]
    187.5Pre-transplanting : after transplanting = 4:16.47
    Pre-transplanting : after transplanting = 1:16.64
    300Pre-transplanting : after transplanting = 4:17.02
    Pre-transplanting : after transplanting = 1:17.14
    Polished rice03.88[85]
    90Pre-transplanting : tillering : booting = 2:2:14.21
    180Pre-transplanting : tillering : booting = 2:2:14.43
    270Pre-transplanting : tillering : booting = 2:2:16.42
    360Pre-transplanting : tillering : booting = 2:2:14.87
    Brown rice09.05[86]
    120Flowering22.14
     | Show Table
    DownLoad: CSV

    Appropriate application of phosphorus fertilizer is beneficial in promoting the translocation of Fe and Zn from leaves to rice grains, thus increasing the content in rice grains[80]. However, the excessive application of phosphate fertilizer will reduce the availability of Fe and Zn in soil, resulting in less uptake by the roots and a lower content in the rice grains[81]. The content of PA in rice increased with a higher phosphorus fertilizer application rate[80]. Increasing the phosphorus fertilizer application rate would increase the values of [PA]/[Fe] and [PA]/[Zn] and reduce the effectiveness of Fe and Zn in rice[80]. Currently, there are few studies on the effect of potassium fertilization on the synthesis of active components in rice. Available studies report that increased application of nitrogen fertilizer can increase the Zn content in rice[82]. Therefore, the research in this area needs to be strengthened.

    Because the iron in soil mainly exists in the insoluble form Fe3+, the application of iron fertilizer has little effect on rice biofortification[87]. There are different opinions about the effect of Zn fertilizer application methods. Phattarakul et al.[88] believed that foliar spraying of Zn fertilizer could significantly improve the Zn content in rice grains. Jiang et al.[89] concluded that most of the Zn accumulated in rice grains were absorbed by the roots rather than from the reactivation of Zn in leaves. In contrast, Yuan et al.[90] suggested that soil application of Zn fertilizer had no significant effect on Zn content in rice grains. The different results may be affected by the form of zinc fertilizer applied and the soil conditions in the experimental sites. Studies have found that compared with the application of ZnEDTA and ZnO, zinc fertilizer in the form of ZnSO4 is most effective for increasing rice's Zn[70]. In addition, the application of zinc fertilizer reduces the concentration of PA in rice grains[70].

    The form of selenium fertilizer and the method and time of application will affect the accumulation of Se in rice grains. Regarding selenium, rice is a non-hyperaccumulative plant. A moderate application of selenium fertilizer can improve rice yield. However, the excessive application can be toxic to rice, and the difference between beneficial and harmful supply levels is slight[91]. Selenite is readily adsorbed by iron oxide or hydroxide in soil, and its effectiveness in the soil is much lower than selenite[92]. In addition, selenate can migrate to the roots and transfer to rice shoots through high-affinity sulfate transporters. In contrast, selenite is mainly assimilated into organic selenium in the roots and transferred to the shoots in smaller amounts[93]. Therefore, the biological effectiveness of Se is higher in selenate-applied soil than in selenite application[94] (Table 2). Zhang et al.[95] found that the concentration of Se in rice with soil application of 100 g Se ha-1 was only 76.8 μg·kg-1, while the concentration of Se in rice with foliar spray of 75 g Se ha-1 was as high as 410 μg·kg-1[73]. However, the level of organic selenium was lower in rough rice with foliar application of selenium fertilizer compared to soil application[96], while the bioavailability of organic selenium in humans was higher than inorganic selenium[97]. Deng et al.[73] found that the concentrations of total selenium and organic selenium in brown rice with selenium fertilizer applied at the full heading stage were 2-fold higher than those in brown rice with selenium fertilizer applied at the late tillering stage (Table 2). Although the application of exogenous selenium fertilizer can rapidly and effectively increase the Se content of rice (Table 2), it can easily lead to excessive Se content in rice and soil, which can have adverse effects on humans and the environment. Therefore, breeding Se-rich rice varieties is a safer and more reliable way to produce Se-rich rice. In summary, functional rice production should include the moderate application of nitrogen and phosphorus fertilizer and higher levels of potassium fertilizer, with consideration to the use of trace element fertilizers.

    Table 2.  Effect of selenium fertilizer application on the selenium content of rice.
    SampleSe level (g Se ha−1)Selenium fertilizer formsApplication methodSe content (μg·g−1)References
    Rough rice00.002[98]
    18SeleniteFoliar spray at full heading0.411
    Polished rice00.071[99]
    20SeleniteFoliar spray at full heading0.471
    20SelenateFoliar spray at full heading0.640
    Rough rice75SeleniteFoliar spray at late tillering0.440[73]
    75SeleniteFoliar spray at full heading1.290
    75SelenateFoliar spray at late tillering0.780
    75SelenateFoliar spray at full heading2.710
    Polished rice00.027[100]
    15SeleniteFoliar spray at full heading0.435
    45SeleniteFoliar spray at full heading0.890
    60SeleniteFoliar spray at full heading1.275
     | Show Table
    DownLoad: CSV

    Effect of harvesting time on the accumulation of active components in rice

    The content of many active components in rough rice is constantly changing during the development of rice. It was found that the content of total flavonoids in brown rice increased continuously from flowering stage to dough stage and then decreased gradually[101]. The γ-oryzanol content in rice decreased by 13% from milk stage to dough stage, and then gradually increased to 60% higher than milk stage at full maturity[101]. The results of Shao et al.[102] showed that the anthocyanin content in rice reached its highest level at two weeks after flowering and then gradually decreased. At full ripeness, and the anthocyanins content in brown rice was only about 50% of the maximum level. The content of total phenolics in rice decreased with maturity from one week after flowering to the fully ripe stage, and the loss of total phenolics reached more than 47% by the fully ripe stage. In contrast, the content of total phenolics in black rice increased with maturity[102]. Moreover, RS content in rough rice decreases during rice maturation[68]. Therefore, the production process of functional rice should be timely and early harvested to obtain higher economic value.

    Prevention and control of pests and diseases for functional rice

    Pests and diseases seriously impact the yield and quality of rice[103]. At present, the two most effective methods to control pests and diseases are the use of chemical pesticides and the planting of pest and disease-resistant rice varieties. The use of chemical pesticides has greatly reduced the yield loss of rice. However, excessive use of chemical pesticides decreases soil quality, pollutes the environment, reduces soil biodiversity[104], increases pest resistance, and aggravates the adverse effects of pests and diseases on rice production[105]. It also increases residual pesticide levels in rice, reduces rice quality, and poses a severe threat to human health[106].

    Breeding pest and disease-resistant rice varieties are among the safest and effective ways to control rice pests and diseases[107]. In recent years, many pest and disease resistance genes from rice and microorganisms have been cloned[47]. Researchers have used these genes to breed rice varieties resistant to multiple pests and diseases through gene polymerization breeding techniques. Application in production practices delivered good ecological and economic benefits[108].

    Green pest and disease control technologies must consider the synergies between rice and water, fertilizer, and pest and disease management. In this regard, the rice-frog, rice-duck, and other comprehensive rice production models that have been widely used in recent years are the most representative. These rice production models significantly reduced chemical pesticide usage and effectively controlled rice pests and diseases[109]. The nutritional imbalance will reduce the resistance of rice to pests and diseases[110]. Excessive application of nitrogen fertilizer stimulates rice overgrowth, protein synthesis, and the release of hormones, increasing its attractiveness to pests[111]. Increased soluble protein content in rice leaves is more conducive to virus replication and increases the risk of viral infection[112]. Increasing the available phosphorus content in the soil will increase crop damage by pests[113], while insufficient potassium supply will reduce crop resistance to pests and diseases[114]. The application of silica fertilizer can boost the defense against pests and diseases by increasing silicon deposition in rice tissue, inducing the expression of genes associated with rice defense mechanisms[115] and the accumulation of antifungal compounds in rice tissue[116]. The application of silica fertilizer increases the release of rice volatiles, thereby attracting natural enemies of pests and reducing pest damage[117]. Organic farming increases the resistance of rice to pests and diseases[118]. In addition, rice intercropping with different genotypes can reduce pests and diseases through dilution and allelopathy and changing field microclimate[119].

    In conclusion, the prevention and control of rice pests and diseases should be based on chemical and biological control and supplemented by fertilizer management methods such as low nitrogen, less phosphorus, high potassium and more silicon, as well as agronomic measures such as rice-aquaculture integrated cultivation, organic cultivation and intercropping of different rice varieties, etc. The combined use of multiple prevention and control measures can improve the yield and quality of functional rice.

    Conclusions

    Functional rice contains many active components which are beneficial to maintaining human health and have high economic and social value with broad market prospects. However, the current development level of the functional rice industry is low. The development of the functional rice requires extensive use of traditional and modern polymerization breeding techniques to cultivate new functional rice varieties with endosperm that can be enriched with multiple active components and have broad-spectrum resistance to pests and diseases. It is also important to select suitable planting locations and times according to the response characteristics of different functional rice active components to environmental conditions.

    Acknowledgments

    This work is supported by the National Natural Science Foundation of China (Project No. 32060430 and 31971840), and Research Initiation Fund of Hainan University (Project No. KYQD(ZR)19104).

  • The authors declare that they have no conflict of interest.

  • [1]

    Fan J, Zhang W, Amombo E, Hu L, Kjorven JO, et al. 2020. Mechanisms of environmental stress tolerance in turfgrass. Agronomy 10:522

    doi: 10.3390/agronomy10040522

    CrossRef   Google Scholar

    [2]

    Abraham EM, Meyer WA, Bonos SA, Huang B. 2008. Differential responses of hybrid bluegrass and Kentucky bluegrass to drought and heat stress. HortScience 43:2191−95

    doi: 10.21273/HORTSCI.43.7.2191

    CrossRef   Google Scholar

    [3]

    Xu S, Li J, Zhang X, Wei H, Cui L. 2006. Effects of heat acclimation pretreatment on changes of membrane lipid peroxidation, antioxidant metabolites, and ultrastructure of chloroplasts in two cool-season turfgrass species under heat stress. Environmental and Experimental Botany 56:274−85

    doi: 10.1016/j.envexpbot.2005.03.002

    CrossRef   Google Scholar

    [4]

    Li J, Zhao S, Yu X, Du W, Li H, et al. 2021. Role of Xanthoceras sorbifolium MYB44 in tolerance to combined drought and heat stress via modulation of stomatal closure and ROS homeostasis. Plant Physiology and Biochemistry 162:410−20

    doi: 10.1016/j.plaphy.2021.03.007

    CrossRef   Google Scholar

    [5]

    Hasanuzzaman M, Bhuyan MHMB, Zulfiqar F, Raza A, Mohsin SM, et al. 2020. Reactive oxygen species and antioxidant defense in plants under abiotic stress: revisiting the crucial role of a universal defense regulator. Antioxidants 9:681

    doi: 10.3390/antiox9080681

    CrossRef   Google Scholar

    [6]

    Raja V, Majeed U, Kang H, Andrabi KI, John R. 2017. Abiotic stress: interplay between ROS, hormones and MAPKs. Environmental and Experimental Botany 137:142−57

    doi: 10.1016/j.envexpbot.2017.02.010

    CrossRef   Google Scholar

    [7]

    Nadarajah KK. 2020. ROS homeostasis in abiotic stress tolerance in plants. International Journal of Molecular Sciences 21:5208

    doi: 10.3390/ijms21155208

    CrossRef   Google Scholar

    [8]

    Sheikh Mohammadi MH, Etemadi N, Arab MM, Aalifar M, Arab M, et al. 2017. Molecular and physiological responses of Iranian perennial ryegrass as affected by trinexapac ethyl, paclobutrazol and abscisic acid under drought stress. Plant Physiology and Biochemistry 111:129−43

    doi: 10.1016/j.plaphy.2016.11.014

    CrossRef   Google Scholar

    [9]

    Gill SS, Tuteja N. 2010. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry 48:909−30

    doi: 10.1016/j.plaphy.2010.08.016

    CrossRef   Google Scholar

    [10]

    Mittler R, Vanderauwera S, Gollery M, Van Breusegem F. 2004. Reactive oxygen gene network of plants. Trends in Plant Science 9:490−98

    doi: 10.1016/j.tplants.2004.08.009

    CrossRef   Google Scholar

    [11]

    Racchi ML. 2013. Antioxidant defenses in plants with attention to Prunus and Citrus spp. Antioxidants 2:340−69

    doi: 10.3390/antiox2040340

    CrossRef   Google Scholar

    [12]

    Alscher RG, Erturk N, Heath LS. 2002. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. Journal of Experimental Botany 53:1331−41

    doi: 10.1093/jexbot/53.372.1331

    CrossRef   Google Scholar

    [13]

    Mittler R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science 7:405−10

    doi: 10.1016/S1360-1385(02)02312-9

    CrossRef   Google Scholar

    [14]

    Jimenez A, Hernandez JA, del Rio LA, Sevilla F. 1997. Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea leaves. Plant Physiology 114:275−84

    doi: 10.1104/pp.114.1.275

    CrossRef   Google Scholar

    [15]

    Tripathi DK, Mishra RK, Singh S, Singh S, Vishwakarma K, et al. 2017. Nitric oxide ameliorates zinc oxide nanoparticles phytotoxicity in wheat seedlings: implication of the ascorbate-glutathione cycle. Frontiers in Plant Science 8:1

    doi: 10.3389/fpls.2017.00001

    CrossRef   Google Scholar

    [16]

    Soliman WS, Fujimori M, Tase K, Sugiyama SI. 2011. Oxidative stress and physiological damage under prolonged heat stress in C3 grass Lolium perenne. Grassland Science 57:101−6

    doi: 10.1111/j.1744-697X.2011.00214.x

    CrossRef   Google Scholar

    [17]

    Soliman WS, Fujimori M, Tase K, Sugiyama SI. 2012. Heat tolerance and suppression of oxidative stress: comparative analysis of 25 cultivars of the C3 grass Lolium perenne. Environmental and Experimental Botany 78:10−17

    doi: 10.1016/j.envexpbot.2011.12.013

    CrossRef   Google Scholar

    [18]

    Xu Y, Xu Q, Huang B. 2015. Ascorbic acid mitigation of water stress-inhibition of root growth in association with oxidative defense in tall fescue (Festuca arundinacea Schreb. ). Frontiers in Plant Science 6:807

    doi: 10.3389/fpls.2015.00807

    CrossRef   Google Scholar

    [19]

    Li Z, Peng Y, Huang B. 2018. Alteration of transcripts of stress-protective genes and transcriptional factors by γ-aminobutyric acid (GABA) associated with improved heat and drought tolerance in creeping bentgrass (Agrostis stolonifera). International Journal of Molecular Sciences 19:1623

    doi: 10.3390/ijms19061623

    CrossRef   Google Scholar

    [20]

    Liu X, Huang B. 2003. Mowing height effects on summer turf growth and physiological activities for two creeping bentgrass cultivars. HortScience 38:444−48

    doi: 10.21273/HORTSCI.38.3.444

    CrossRef   Google Scholar

    [21]

    Liu X, Huang B. 2001. Seasonal changes and cultivar difference in turf quality, photosynthesis, and respiration of creeping bentgrass. HortScience 36:1131−35

    doi: 10.21273/HORTSCI.36.6.1131

    CrossRef   Google Scholar

    [22]

    Rossi S, Chapman C, Huang B. 2020. Suppression of heat-induced leaf senescence by γ-aminobutyric acid, proline, and ammonium nitrate through regulation of chlorophyll degradation in creeping bentgrass. Environmental and Experimental Botany 177:104−16

    doi: 10.1016/j.envexpbot.2020.104116

    CrossRef   Google Scholar

    [23]

    Rossi S, Chapman C, Yuan B, Huang B. 2021. Improved heat tolerance in creeping bentgrass by γ-aminobutyric acid, proline, and inorganic nitrogen associated with differential regulation of amino acid metabolism. Plant Growth Regulation 93:231−42

    doi: 10.1007/s10725-020-00681-6

    CrossRef   Google Scholar

    [24]

    Ali EF, El-Shehawi AM, Ibrahim OHM, Abdul-Hafeez EY, Moussa MM, et al. 2021. A vital role of chitosan nanoparticles in improvisation the drought stress tolerance in Catharanthus roseus (L. ) through biochemical and gene expression modulation. Plant Physiology and Biochemistry 161:166−75

    doi: 10.1016/j.plaphy.2021.02.008

    CrossRef   Google Scholar

    [25]

    Kurita K. 2006. Chitin and chitosan: functional biopolymers from marine crustaceans. Marine Biotechnology 8:203−26

    doi: 10.1007/s10126-005-0097-5

    CrossRef   Google Scholar

    [26]

    Rabêlo VM, Magalhães PC, Bressanin LA, Carvalho DT, Reis COD, et al. 2019. The foliar application of a mixture of semisynthetic chitosan derivatives induces tolerance to water deficit in maize, improving the antioxidant system and increasing photosynthesis and grain yield. Scientific Reports 9:8164

    doi: 10.1038/s41598-019-44649-7

    CrossRef   Google Scholar

    [27]

    Turk H. 2019. Chitosan-induced enhanced expression and activation of alternative oxidase confer tolerance to salt stress in maize seedlings. Plant Physiology and Biochemistry 141:415−22

    doi: 10.1016/j.plaphy.2019.06.025

    CrossRef   Google Scholar

    [28]

    Zhang Y, Li Z, Li Y, Zhang X, Ma X, et al. 2018. Chitosan and spermine enhance drought resistance in white clover, associated with changes in endogenous phytohormones and polyamines, and antioxidant metabolism. Functional Plant Biology 45:1205−22

    doi: 10.1071/FP18012

    CrossRef   Google Scholar

    [29]

    Hao T, Yang Z, Liang J, Yu J, Liu J. 2023. Foliar application of carnosine and chitosan improving drought tolerance in bermudagrass. Agronomy 13:442

    doi: 10.3390/agronomy13020442

    CrossRef   Google Scholar

    [30]

    Liu Z, Liu T, Liang L, Li Z, Hassan MJ, et al. 2020. Enhanced photosynthesis, carbohydrates, and energy metabolism associated with chitosan-induced drought tolerance in creeping bentgrass. Crop Science 60:1064−76

    doi: 10.1002/csc2.20026

    CrossRef   Google Scholar

    [31]

    Seon Sim H, Su Jo J, Jeong Woo U, Jun Jo W, Hyun Moon Y, et al. 2022. Abscisic acid, carbohydrate, and glucosinolate metabolite profiles in kimchi cabbage treated with extremely high temperatures and chitosan foliar application. Scientia Horticulturae 304:111311

    doi: 10.1016/j.scienta.2022.111311

    CrossRef   Google Scholar

    [32]

    Shakoor A, Saleem MF, Sarwar M, Zia Ul Haq M. 2023. Exogenous application of chitosan mediated biochemical, phenological, quality, and yield attributes of heat-stressed cotton (Gossypium hirsutum L.). Gesunde Pflanzen

    doi: 10.1007/s10343-023-00832-5

    CrossRef   Google Scholar

    [33]

    Huang C, Tian Y, Zhang B, Hassan MJ, Li Z, et al. 2021. Chitosan (CTS) alleviates heat-induced leaf senescence in creeping bentgrass by regulating chlorophyll metabolism, antioxidant defense, and the heat shock pathway. Molecules 26:5337

    doi: 10.3390/molecules26175337

    CrossRef   Google Scholar

    [34]

    Li Q, Li R, He F, Yang Z, Yu J. 2022. Growth and physiological effects of chitosan on heat tolerance in creeping bentgrass (Agrostis stolonifera). Grass Research 2:6

    doi: 10.48130/GR-2022-0006

    CrossRef   Google Scholar

    [35]

    Qian YL, Engelke MC, Foster MJV, Reynolds S. 1998. Trinexapac-ethyl restricts shoot growth and improves quality of `Diamond' zoysiagrass under shade. HortScience 33:1019−22

    doi: 10.21273/HORTSCI.33.6.1019

    CrossRef   Google Scholar

    [36]

    Zhang J, Kirkham MB. 1996. Antioxidant responses to drought in sunflower and sorghum seedlings. New Phytologist 132:361−73

    doi: 10.1111/j.1469-8137.1996.tb01856.x

    CrossRef   Google Scholar

    [37]

    Bian S, Jiang Y. 2009. Reactive oxygen species, antioxidant enzyme activities and gene expression patterns in leaves and roots of Kentucky bluegrass in response to drought stress and recovery. Scientia Horticulturae 120:264−70

    doi: 10.1016/j.scienta.2008.10.014

    CrossRef   Google Scholar

    [38]

    Bradford, MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72:248−54

    doi: 10.1016/0003-2697(76)90527-3

    CrossRef   Google Scholar

    [39]

    Xu Y, Burgess P, Huang B. 2015. Root antioxidant mechanisms in relation to root thermotolerance in perennial grass species contrasting in heat tolerance. PLoS One 10:e138268

    doi: 10.1371/journal.pone.0138268

    CrossRef   Google Scholar

    [40]

    Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3:1101−08

    doi: 10.1038/nprot.2008.73

    CrossRef   Google Scholar

    [41]

    Zhang X, Ervin EH. 2008. Impact of seaweed extract−based cytokinins and zeatin riboside on creeping bentgrass heat tolerance. Crop Science 48:364−70

    doi: 10.2135/cropsci2007.05.0262

    CrossRef   Google Scholar

    [42]

    Larkindale J, Huang B. 2005. Effects of abscisic acid, salicylic acid, ethylene and hydrogen peroxide in thermotolerance and recovery for creeping bentgrass. Plant Growth Regulation 47:17−28

    doi: 10.1007/s10725-005-1536-z

    CrossRef   Google Scholar

    [43]

    Pantoja-Benavides AD, Garces-Varon G, Restrepo-Díaz H. 2021. Foliar growth regulator sprays induced tolerance to combined heat stress by enhancing physiological and biochemical responses in rice. Frontiers in Plant Science 12:702892

    doi: 10.3389/fpls.2021.702892

    CrossRef   Google Scholar

    [44]

    Chalanika De Silva HC, Asaeda T. 2017. Effects of heat stress on growth, photosynthetic pigments, oxidative damage and competitive capacity of three submerged macrophytes. Journal of Plant Interactions 12:228−36

    doi: 10.1080/17429145.2017.1322153

    CrossRef   Google Scholar

    [45]

    Jiang Y, Huang B. 2001. Drought and heat stress injury to two cool-season turfgrasses in relation to antioxidant metabolism and lipid peroxidation. Crop Science 41:436−42

    doi: 10.2135/cropsci2001.412436x

    CrossRef   Google Scholar

    [46]

    Jahan MS, Shu S, Wang Y, Chen Z, He M, et al. 2019. Melatonin alleviates heat-induced damage of tomato seedlings by balancing redox homeostasis and modulating polyamine and nitric oxide biosynthesis. BMC Plant Biology 19:414

    doi: 10.1186/s12870-019-1992-7

    CrossRef   Google Scholar

    [47]

    Katuwal KB, Rowe S, Jespersen D. 2021. The use of 5-aminolevulinic acid to reduce heat-stress-related damages in tall fescue. Crop Science 61:3206−18

    doi: 10.1002/csc2.20294

    CrossRef   Google Scholar

    [48]

    Khanna-Chopra R, Chauhan S. 2015. Wheat cultivars differing in heat tolerance show a differential response to oxidative stress during monocarpic senescence under high temperature stress. Protoplasma 252:1241−51

    doi: 10.1007/s00709-015-0755-z

    CrossRef   Google Scholar

    [49]

    Li C, Ma M, Zhang T, Feng P, Chen X, et al. 2021. Comparison of photosynthetic activity and heat tolerance between near isogenic lines of wheat with different photosynthetic rates. PLoS One 16:e0255896

    doi: 10.1371/journal.pone.0255896

    CrossRef   Google Scholar

    [50]

    Zhang L, Hu T, Amombo E, Wang G, Xie Y, et al. 2017. The alleviation of heat damage to photosystem II and enzymatic antioxidants by exogenous spermidine in tall fescue. Frontiers in Plant Science 8:1747

    doi: 10.3389/fpls.2017.01747

    CrossRef   Google Scholar

    [51]

    Zhang J, Xing J, Lu Q, Yu G, Xu B, et al. 2019. Transcriptional regulation of chlorophyll-catabolic genes associated with exogenous chemical effects and genotypic variations in heat-induced leaf senescence for perennial ryegrass. Environmental and Experimental Botany 167:103858

    doi: 10.1016/j.envexpbot.2019.103858

    CrossRef   Google Scholar

    [52]

    Su Y, Huang Y, Dong X, Wang R, Tang M, et al. 2021. Exogenous methyl jasmonate improves heat tolerance of perennial ryegrass through alteration of osmotic adjustment, antioxidant defense, and expression of jasmonic acid-responsive genes. Frontiers in Plant Science 12:664519

    doi: 10.3389/fpls.2021.664519

    CrossRef   Google Scholar

    [53]

    Hu L, Bi A, Hu Z, Amombo E, Li H, et al. 2018. Antioxidant metabolism, photosystem II, and fatty acid composition of two tall fescue genotypes with different heat tolerance under high temperature stress. Frontiers in Plant Science 9:1242

    doi: 10.3389/fpls.2018.01242

    CrossRef   Google Scholar

    [54]

    Hasanuzzaman M, Bhuyan MHMB, Anee TI, Parvin K, Nahar K, et al. 2019. Regulation of ascorbate-glutathione pathway in mitigating oxidative damage in plants under abiotic stress. Antioxidants 8:384

    doi: 10.3390/antiox8090384

    CrossRef   Google Scholar

    [55]

    Li C, Han Y, Hao J, Qin X, Liu C, et al. 2020. Effects of exogenous spermidine on antioxidants and glyoxalase system of lettuce seedlings under high temperature. Plant Signaling & Behavior 15:1824697

    doi: 10.1080/15592324.2020.1824697

    CrossRef   Google Scholar

    [56]

    Buttar ZA, Wu S, Arnao MB, Wang C, Ullah I, et al. 2020. Melatonin suppressed the heat stress-induced damage in wheat seedlings by modulating the antioxidant machinery. Plants 9:809

    doi: 10.3390/plants9070809

    CrossRef   Google Scholar

    [57]

    Xu Q, Huang B. 2004. Antioxidant metabolism associated with summer leaf senescence and turf quality decline for creeping bentgrass. Crop Science 44:553−60

    doi: 10.2135/cropsci2004.5530

    CrossRef   Google Scholar

    [58]

    Lin KH, Huang HC, Lin CY. 2010. Cloning, expression and physiological analysis of broccoli catalase gene and Chinese cabbage ascorbate peroxidase gene under heat stress. Plant Cell Reports 29:575−93

    doi: 10.1007/s00299-010-0846-4

    CrossRef   Google Scholar

    [59]

    Du H, Zhou P, Huang B. 2013. Antioxidant enzymatic activities and gene expression associated with heat tolerance in a cool-season perennial grass species. Environmental and Experimental Botany 87:159−66

    doi: 10.1016/j.envexpbot.2012.09.009

    CrossRef   Google Scholar

  • Cite this article

    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007
    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007
    shu

Figures(9)  /  Tables(1)

Download PDF

Article Metrics

Article views(4638) PDF downloads(559)

Other Articles By Authors

ARTICLE   Open Access    

Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass

  • 1.

    College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China

  • 2.

    Department of Landscape Architecture, Jiangsu Vocational College of Agriculture and Forestry, Jurong 212400, China

  • Received: 12 March 2023
  • Accepted: 19 April 2023
  • Published online: 10 May 2023
Grass Research  3,  Article number: 7  (2023)  |  Cite this article

Abstract: As an effective plant growth regulator, chitosan plays a positive role in enhancing heat tolerance in perennial turfgrass. The objective of this study was to elucidate whether chitosan-promoted thermotolerance was associated with the antioxidant defense system under long-term heat stress in creeping bentgrass (Agrostis stolonifera). Plants were treated with or without 100 mg∙L−1 chitosan under either heat stress (38/28 °C, day/night) or non-stressed condition (25/20 °C, day/night) for 42 d in growth chambers. Foliar application of chitosan significantly enhanced heat tolerance as reflected by the increased turf quality through inhibiting over-accumulation of reactive oxygen species, and increasing ascorbic acid content and antioxidant enzymes activities (peroxidase, POD; ascorbate peroxidase, APX; glutathione reductase, GR; dehydroascorbate reductase, DHAR). Chitosan-treated plants also had higher transcript levels of AsCu/ZnSOD, AsCATB, AsPerox4, AsAPX2, AsAPX3, AsAPX4, AsAPX6, AsAPX8, AsGR2, and AsDHAR genes in comparison to the untreated plants. The results suggested that chitosan-promotion in heat tolerance could be associated with non-enzymatic antioxidants, antioxidant enzymes, as well as relative gene expression.

    HTML

    Introduction

    • Heat stress is one of the crucial environmental stresses limiting plant growth and development, and ultimately influencing productivity and quality of many plants including turfgrass species[1, 2]. Under heat stress, the unfavorable disorders in fundamental metabolic processes often occur in turfgrass species, such as disturbance in homeostasis of reactive oxygen species (ROS)[3, 4]. ROS are the by-products of enzymatic reactions, including superoxide anion (O−2), hydroxyl radical (•OH), and hydrogen peroxide (H2O2)[5]. Numerous evidence revealed that abiotic stress triggered overproduction of ROS, which would lead to oxidative damage on nucleic acids, proteins, lipids, and carbohydrates in various plants[6−8].

      In order to resist oxidative injuries, plants have evolved a complex antioxidant defense system to scavenge and detoxify the excessive accumulation of ROS to maintain the relative steady balance between generation and elimination of ROS. The defense mechanism is composed of both non-enzymatic and enzymatic systems[9]. Non-enzymatic systems (ascorbic acid, glutathione, and nonprotein amino acids, etc.) are one of an important component of antioxidant defense systems[10]. Acting as electron donors, antioxidants directly or indirectly transform toxic ROS into less harmful oxidized products, and modulate redox homeostasis[11]. Enzymatic system involves several antioxidant enzymes, including superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), glutathione reductase (GR), and ascorbate peroxidase (APX)[9]. The first line of defense in ROS-scavenging enzyme is SOD that catalyzes O2− to H2O2 and molecular oxygen (O2)[11]. Based on different metal co-factors, SOD could be distinguished into three classes including Cu/ZnSOD, MnSOD, and FeSOD, which have various subcellular localization[12]. CAT, POD, and the ascorbate-glutathione cycle further convert H2O2 into H2O and O2[13]. Ascorbate-glutathione cycle including two antioxidants (ascorbic acid and glutathione), as well as four important enzymes (APX, GR, DHAR, and MDHAR), plays a key role in detoxifying the excess H2O2[14, 15]. However, redox homeostasis is still destroyed when plants are exposed to prolonged heat stress[16, 17]. Therefore, maintaining the stability of antioxidant defense system is essential for enhancing heat tolerance in plants, especially in cool-season grass species[18, 19].

      As a cool-season turfgrass, creeping bentgrass (Agrostis stolonifera) is widely used in golf greens and other high-quality turfs due to its fine texture and superior tolerance to low mowing height[20]. However, creeping bentgrass is sensitive to heat stress, and likely to be injured by heat stress during the summer season[21, 22]. Thus, it is an urgent need for turf managers to promote heat tolerance in creeping bentgrass. Previous studies have demonstrated that foliar application of plant growth regulators was an effective and convenient strategy to alleviate stress-induced damages[23, 24]. Chitosan is a natural, biocompatible, and biodegradable polysaccharide produced from chitin[25]. Chitosan has nucleophilic behavior, which allows it to form multifunction via structural chemical modifications[26]. Exogenous chitosan with the appropriate concentration and method could greatly mitigate harmful effects of abiotic stresses on plants. Under salt stress, chitosan application led to a significant improvement in salt tolerance through promoting plant growth, and enhancing the expression and activation of alternative oxidase in maize (Zea mays) seedlings[27]. Under drought stress, chitosan effectively alleviated drought stress in association with the altered antioxidant metabolism and various metabolic processes in white clover (Trifolium repens)[28], bermudagrass (Cynodon transvaalensis × C. dactylon)[29], and creeping bentgrass[30]. Under heat stress, foliar application of 200 and 800 mg∙L−1 chitosan had positive effect on mitigating heat damage in kimchi cabbage (Brassica rapa ssp. Pekinensis)[31] and cotton (Gossypium hirsutum)[32], respectively. Exogenous 100 mg∙L−1 chitosan also improved heat tolerance in creeping bentgrass through regulating chlorophyll metabolism, antioxidant defense, and the heat shock pathway[33]. In our previous study, foliar application of chitosan significantly enhanced heat tolerance in creeping bentgrass by inhibiting the decline in photosynthesis and maintaining cell membrane stability[34]. Despite present knowledge, chitosan-induced regulating mechanism on antioxidant defense system has not been well understood in creeping bentgrass under heat stress. Therefore, the objective of this study was to elucidate whether chitosan-promoted thermotolerance associated with the antioxidant defense system under long-term heat stress, including the content of antioxidants, activities of antioxidant enzymes, as well as the expression level of genes encoding antioxidant enzymes. Our findings would be expected to provide a new understanding for chitosan-induced promotion on heat tolerance in perennial turfgrass species.

    Materials and methods

      Plant material and growth conditions

    • Creeping bentgrass seeds (A. stolonifera cv. 'Penn A-4') were sown in polyvinyl chloride tubes (25-cm height and 10-cm diameter) filled with sand. Plants were grown for 2 months in a greenhouse at 25/20 °C (day/night) and 14 h photoperiod[34]. During establishment, plants were irrigated daily, fertilized once a week with water-soluble fertilizer (Scotts Miracle-Gro Company, USA), and trimmed every 2 d in order to maintain a canopy height of 4−5 cm. Plants were moved to a growth chamber (XBQH-1, Jinan Xubang, Jinan, Shandong Province, China) with temperature of 25/20 °C (day/night), 14 h photoperiod, and 60% relative humidity. Plants were pre-acclimated to the environment of growth chambers for one week before treatments.

      Experimental design and treatments

    • After acclimation, the two-month-old plants were divided into four groups as four treatments: (1) control + H2O, foliar application with 10 mL deionized water under non-stressed condition (25/20 °C, day/night); (2) control + chitosan, foliar application with 10 mL chitosan under non-stressed condition (25/20 °C, day/night); (3) heat + H2O, foliar application with 10 mL deionized water under heat stress (38/28 °C, day/night); (4) heat + chitosan, foliar application with 10 mL chitosan under heat stress (38/28 °C, day/night). During 42 d of treatments, plants were sprayed with either deionized water or chitosan every 7 d. For chitosan treatment, chitosan concentration was set as 100 mg∙L−1 based on our previous study in creeping bentgrass[34]. This experiment was arranged in a completely randomized design with four biological replicates (four tubes) for each treatment. Each tube was rearranged daily to reduce impacts of the environment.

      Turf quality and staining of ROS

    • Turf quality is a common parameter of overall turf performance rated on a scale of 1 (lowest) to 9 (best) based on texture, color, uniformity, and density[35]. A rating of 1 represented plants that were completely dead with brown leaves, and a rating of 9 indicated plants that were healthy with green and dense turf canopy. Turf quality at the minimal acceptable level was rated a 6.

      The presence of hydrogen peroxide (H2O2) and superoxide (O−2) at 0, 21, and 42 d of treatments were detected based on the method documented by Xu et al.[18] with some modifications. Histochemical staining for H2O2 was used 1% (w/v) 3,3-diaminobenzidine (DAB) in 50 mM Tris-HCl buffer (pH 7.5). Staining of O−2 was used 0.5% (w/v) nitro blue tetrazolium (NBT) in 25 mM HEPES buffer (pH 7.6). All leaves were stained for 16 h at room temperature in darkness. Then, the staining solution was discarded, 85% ethanol was added, and incubated at 85 °C until leaf chlorophyll was dissolved completely. The DAB- or NBT-stained leaves were rinsed with deionized water.

      Non-enzymatic antioxidant content and antioxidant enzyme activity measurements

    • Glutathione content and ascorbic acid content in leaves of creeping bentgrass at 0, 21, and 42 d of treatments were determined using kits (Nanjing Yurun Biotechnology Co., Ltd., Jiangsu, China; Suzhou Comin Biotechnology Co., Ltd., Jiangsu, China). Antioxidant enzyme activity in leaves was measured using the previously described method[36, 37] with some modifications. Fresh leaf tissues (0.35 g) at 0, 21, and 42 d of treatments were sampled, then stored at −80 °C to conduct further analysis. Leaves were ground with liquid nitrogen to a fine powder, then extracted with 4 mL of cold extraction buffer (50 mM potassium phosphate, 1 mM ethylenediaminetetraacetic acid, 1% polyvinylpyrrolidone, pH 7.8). The extraction solution was centrifuged at 15,000 g for 30 min at 4 °C and the supernatant was collected for determination of antioxidant enzyme activity. SOD activity was determined based on the rate of NBT reduction in absorbance at 560 nm. CAT, POD, APX, DHAR, MDHAR, and GR activities were assayed following the increase or decrease in absorbance at 240, 470, 290, 265, 340, and 340 nm, respectively. All enzyme activities were determined using a spectrophotometer (Ultrospec 2100 pro, Biochrom Ltd., Cambridge, UK) and expressed on the basis of protein content, which was measured according to Bradford's method[38].

      Gene expression analysis of antioxidant enzyme in leaves

    • The transcription levels of selected gene encoding antioxidant enzyme in leave tissue at 0, 21, and 42 d of treatments were detected by real-time quantitative polymerase chain reaction (qRT-PCR). Total RNA was isolated from leaves with using a FlaPure Plant Total RNA Extraction Kit (Genesand, Beijing, China) according to the manufacturer’s instructions. Determination in RNA concentration was conducted by Tecan Infinite 200 pro (Grödig, Austria). The RNA was reverse-transcribed to cDNA by using MonScript™ RTIII Super Mix with dsDNase (Two-Step) (Monad, Wuhan, China).

      For detecting transcript levels of genes in heat-treated and chitosan-treated conditions, Roche LightCycler480 II machine (Roche Diagnostic, Rotkreuz, Switzerland) and MonAmp™ ChemoHS qPCR Mix (Monad, Wuhan, China) were used for performing qRT-PCR. Primer sequences of SOD (AsFeSOD, AsCu/ZnSOD, AsMnSOD), CAT (AsCATA, AsCATB, AsCATC), POD (AsPerox4), APX (AsAPX1, AsAPX2, AsAPX3, AsAPX4, AsAPX5, AsAPX6, AsAPX8), GR (AsGR1, AsGR2), DHAR (AsDHAR), MDHAR (AsMDHAR) genes, and reference gene (ACT2) are provided in Table 1[39]. The specificity of each primer pair was confirmed by analyzing melting curve in qRT-PCR. PCR condition for all genes was set on the basis of the following parameters: 95 °C at 10 min, 15 s at 95 °C (40 cycles of denaturation), annealing for 15 s at 60 °C, and extending for 20 s at 72 °C. The relative expression level between interest genes and reference gene was to calculate according to 2−ΔΔCᴛ method[40].

      Table 1.  Primer sequences used in the experiment.

      Gene nameForward primer (5’-3’)Reverse primer (5’-3’)
      AsFeSODTGCTCGTCTGTCATCCTTGTGGTTGGGTTTGGCTTGTCTT
      AsCu/ZnSODAATGTGACAGCTGGAGTGGACCCTTGCCAAGATCATCAGC
      AsMnSODAGGAACCAGGTTTGCTCCTTGATGAATGCAGAGGGTGCTG
      AsCATATACTCCGACGACAAGATGCTTTCTTGAATCCGCACTTGGG
      AsCATBAGTGGATTCCAGGGACAGTGGACCATCGATGCAGATCACG
      AsCATCCCTGGCTGCTTGAAGTTGTTACTTCCCGTCCAGGTTTGAT
      AsPerox4GATGTTGCCCATCTTGACCAACTACAGCAACCTCCTGTCC
      AsAPX1CTCCTACGCCGATCTCTACCTGCCGAAGACTTGCCTTAGA
      AsAPX2GGAGAGAGGACAAGCCTGAGAAACCCATCTGAGCGGAGAA
      AsAPX3TACATCGCGGAGATCGAGAGGATCTTGAGCCCTGCATTGG
      AsAPX4CTGCAACTACTCCAGCAAGCCACAAGAACTGGTGGTGCAA
      AsAPX5GCGGCTTAGTCAAGGAGTTGCGACGAGATGGTCTCTGACA
      AsAPX6CAAGTCTCTGCATGGAACGGCCATACTTTGCTGCTGCCAT
      AsAPX8TCCTTGTCATCAAGGCCCATCACAGCTCCTGAGCAATGTC
      AsDHARTGCGTGAACTCTATCGCTCTGAGCGTGCAGCTCCATTATT
      AsGR1TCCTCCGCAGTCCACATATCGTTAGGGTTTGGAGGGTGGT
      AsGR2CACACGGCGAAACACATACTAGAATCACAGCACGTTTCGG
      AsMDHARGCACGTACTGGGTCAAAGACTTCATATGTTGGCGGCGAAG
      ACT2CCTTTTCCAGCCATCTTTCAGAGGTCCTTCCTGATATCCA

      Statistical analysis

    • Data were analyzed using the SPSS statistics software (SPSS 21.0; SPSS Inc., Chicago, IL, USA). The means ± standard error (SE) was calculated for all measured parameters in column charts. ANOVA analysis and Duncan multiple comparison were applied to determine significant differences between mean values for each parameter at the probability level of 0.05.

    Results

      Turf performance and ROS

    • Heat stress led to a significant decrease in turf quality at 21 and 42 d of treatments, and increased accumulation of both H2O2 and O−2 as reflected by the darker color in leaves of creeping bentgrass at 42 d of treatments compared with non-stressed control regardless of chitosan application (Figs 1 & 2). Chitosan-treated plants kept better shoot phenotype and showed 1.2-fold increase in turf quality than untreated plants at 42 d of heat stress (Fig. 1a, b). Exogenous chitosan played a positive effect on decreasing the accumulation of both H2O2 and O−2 under 42 d of heat stress (Fig. 2a, b).

      Figure 1. 

      Effects of heat stress and exogenous chitosan on (a) turf quality and (b) shoot phenotype in creeping bentgrass exposed to non-stressed control and heat stress. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Shoot phenotype was taken at 42 d of treatments. Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Figure 2. 

      Effects of heat stress and exogenous chitosan on staining of (a) hydrogen peroxide and (b) superoxide in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night).

      Non-enzymatic antioxidant content

    • At 21 and 42 d under heat stress, chitosan-treated plants had 54% and 32% higher ascorbic acid content than untreated plants, respectively (Fig. 3a). Plants with or without chitosan under heat stress exhibited an obviously decrease in glutathione content at 21 and 42 d compared with non-stressed control (Fig. 3b). Chitosan-treated plants had higher glutathione content than untreated plants at 21 d of heat stress, but were not observed the significant difference in glutathione content at 42 d of heat treatment.

      Figure 3. 

      Effects of heat stress and exogenous chitosan on content of (a) ascorbic acid and (b) glutathione in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Antioxidant enzyme activity

    • At 21 d of non-stressed treatment, exogenous chitosan caused 38% and 48% significant increase in activities of SOD and POD, respectively, compared with untreated plants (Fig. 4a, c). At 21 d of treatments, heat stress significantly decreased POD activity compared with plants under non-stressed condition (Fig. 4c). At 42 d, activities of SOD, CAT, and POD increased significantly in response to heat stress compared with plants under non-stressed condition, but no significant difference in activities of SOD and CAT was found between plants with or without chitosan (Fig. 4a−c). Foliar application of chitosan had 30% higher POD activity than untreated plants at 42 d of heat stress.

      Figure 4. 

      Effects of heat stress and exogenous chitosan on activities of (a) SOD, (b) CAT, and (c) POD in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      At 21 d of non-stressed condition, exogenous chitosan significantly increased APX activity compared with plants without chitosan. Chitosan-treated plants had 58% higher increase in APX activity than untreated plants at 42 d of heat stress (Fig. 5a). Heat stress significantly increased activities of both GR and DHAR compared with non-stressed control at 21 and 42 d. Plants applied with chitosan demonstrated significant enhancement in GR and DHAR activities compared with untreated plants at 42 d under heat stress (Fig. 5b, c). Exogenous chitosan significantly increased MDHAR activity by 94% compared with untreated plants at 21 d of heat stress (Fig. 5d), but there was no significant difference in MDHAR activity between chitosan-treated and untreated plants at 42 d of heat stress.

      Figure 5. 

      Effects of heat stress and exogenous chitosan on activities of (a) APX, (b) GR, (c) DHAR, and (d) MDHAR in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/2 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Gene expression of antioxidant enzyme

    • The expression levels of SOD (AsFeSOD, AsCu/ZnSOD, and AsMnSOD), CAT (AsCATA, AsCATB, and AsCATC), and POD (AsPerox4) genes in leaves were measured in this experiment (Figs 6 & 7). For SOD genes, expression levels of both AsCu/ZnSOD and AsMnSOD were down-regulated and up-regulated significantly compared with non-stressed control at 21 d and 42 d, respectively (Fig. 6b, c). Chitosan-treated plants showed 1.1-fold higher expression level in AsCu/ZnSOD than untreated plants at 42 d of heat stress (Fig. 6b). At 42 d of heat stress, exogenous chitosan significantly up-regulated the expression of AsCATB by 82% compared with untreated plants, but without significant effects on AsCATA and AsCATC genes (Fig. 7a−c). Chitosan-treated plants had 1.2-fold higher expression levels of AsPerox4 than that without chitosan at 42 d of heat stress (Fig. 7d).

      Figure 6. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsFeSOD, (b) AsCu/ZnSOD, and (c) AsMnSOD in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Figure 7. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsCATA, (b) AsCATB, (c) AsCATC, and (d) AsPerox4 in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      The transcript levels of APX, GR, DHAR, and MDHAR genes related to ascorbate-glutathione cycle were also quantified (Figs 8 & 9). Under normal condition, exogenous chitosan significantly up-regulated AsAPX1 compared with untreated plants at 21 and 42 d. The expression level of AsAPX1 in chitosan-treated plants also higher than untreated plants at 21 d of heat stress (Fig. 8a). At 42 d of heat stress, expressions of different APX genes were significantly up-regulated to certain extent due to foliar application of chitosan, including AsAPX2, AsAPX3, AsAPX4, AsAPX6, and AsAPX8, which demonstrated 1.4-fold, 1.2-fold, 1.0-fold, 0.8-fold, and 1.1-fold higher than untreated plants, respectively (Fig. 8b−d, f, g). At 42 d of treatments, transcript levels of both AsGR1 and AsMDHAR were significantly up-regulated compared with non-stressed control in response to heat stress, however, there was no significant difference in the expression of these genes between chitosan-treated and untreated plants under heat stress (Fig. 9a, d). Chitosan-treated plants showed 2.0-fold and 1.4-fold increase in expression level of both AsGR2 and AsDHAR, respectively, compared with untreated plants at 42 d of heat stress (Fig. 9b, c).

      Figure 8. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsAPX1, (b) AsAPX2, (c) AsAPX3, (d) AsAPX4, (e) AsAPX5, (f) AsAPX6, and (g) AsAPX8 in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

      Figure 9. 

      Effects of heat stress and exogenous chitosan on expression levels of (a) AsGR1, (b) AsGR2, (c) AsDHAR, and (d) AsMDHAR in creeping bentgrass. Control + H2O, foliar application with deionized water under non-stressed condition (25/20 °C, day/night); Control + chitosan, foliar application with 100 mg∙L−1 chitosan under non-stressed condition (25/20 °C, day/night); Heat + H2O, foliar application with deionized water under heat stress (38/28 °C, day/night); Heat + chitosan, foliar application with 100 mg∙L−1 chitosan under heat stress (38/28 °C, day/night). Different lowercase letters represent significant difference between different treatments during the experimental period (P ≤ 0.05). Error bars represent standard error (SE).

    Discussion

    • It is generally known that the application of plant growth regulators is an effective method to enhance thermotolerance, which might be associated with changes in various physiological and biochemical processes under heat stress[41−43]. In this study, heat stress led to serious damages in creeping bentgrass, but chitosan application induced an improvement in heat tolerance as indicated by the reduction in ROS accumulation, better maintenance in antioxidant defense system, as well as the higher gene expression compared with the untreated plants under heat stress as discussed below.

      The imbalance between the production and scavenging of ROS in heat-stressed plant resulted in oxidative stress, and influenced normal physiological activities in plants[44, 45]. Jahan et al.[46] observed a significantly increased ROS (O−2 and H2O2) content and decreased cellular membrane integrity in tomato (Solanum lycopersicum) seedings subjected to heat stress. Thus, maintaining ROS homeostasis is an important strategy to enhance heat tolerance, which is benefitial to promote plant growth and development[47, 48]. Results in this study also showed that heat stress promoted ROS overaccumulation and decreased turf quality. Chitosan-treated plants had lower accumulation of both H2O2 and O−2, and superior turf quality in comparison to untreated plants under heat stress (Figs 1 & 2), which was consistent with previous report in creeping bentgrass[33]. Meanwhile, heat-induced adverse effects on cell membrane stability and photosynthesis were significantly alleviated in plants treated with exogenous chitosan according to our previous study[34]. Similar reports about better maintenance in ROS homeostasis in association with the enhancement in heat tolerance were also found in other plants, such as in wheat (Triticum aestivum)[49], tall fescue (Festuca arundinacea)[50], and perennial ryegrass (Lolium perenne)[51]. The result suggested that exogenous chitosan could contribute to the improved heat tolerance through maintaining the equilibrium between the ROS generation and elimination.

      ROS scavenging system plays a key role in mitigating the adverse effects of oxidative stress and conferring heat tolerance in turfgrass species[52, 53]. Various non-enzymatic antioxidants and antioxidant enzymes including SOD, CAT, POD, and ascorbate-glutathione cycle components (ascorbic acid, glutathione, APX, GR, DHAR, and MDHAR) functions in detoxifying the overproduction of ROS[9]. Ascorbate-glutathione cycle is also referred to as the Asada–Halliwell pathway, which is a crucial antioxidant defense pathway to detoxify H2O2 and remain redox homeostasis in plant cells[54]. In lettuce (Lactuca sativa) seedlings, exogenous spermidine positively alleviated oxidative damage via enhancing ascorbate-glutathione cycle under heat stress[55]. Antioxidant enzymes involved in ascorbate-glutathione cycle showed a significant activation due to melatonin application, mitigating heat-induced damage in wheat seedlings[56]. In the present study, heat stress induced a significant increase in multiple antioxidant enzyme activities indicating that antioxidant defense system was triggered in response to heat stress to prevent plants from severe injury. Chitosan application improved heat tolerance mainly associated with positive changes in POD activities and ascorbate-glutathione cycle, as confirmed by significantly increased ascorbic acid content, POD, APX, GR, and DHAR activities compared with untreated plant under heat stress (Figs 3, 4 & 5). Huang et al.[33] previously found that chitosan-pretreated plants had higher heat tolerance through improving activities of four antioxidant enzymes (SOD, CAT, POD, and APX) at 15 d of heat stress. But in our study, no significant difference in activities of SOD and CAT was found between plants with or without chitosan at 42 d of long-term heat stress. Generally, activities of SOD and CAT increased and then declined under heat stress[57]. The different change in activities of SOD and CAT might indicate that both enzymes played an important role in the early duration of treatments. Moreover, heat stress also induced the up-regulation in transcriptional level of antioxidant enzyme genes in order to protect cellular components against oxidative stress[58]. Li et al.[19] revealed that exogenous application of γ-aminobutyric acid up-regulated the transcript of genes encoding antioxidant enzymes (SOD, CAT, POD, APX, MDHAR, DHAR, and GR) under water deficit stress. In this study, exogenous chitosan significantly up-regulated several relative gene expressions compared with untreated plants under heat stress, including SOD (AsCu/ZnSOD), CAT (AsCATB), POD (AsPerox4), APX (AsAPX2, AsAPX3, AsAPX4, AsAPX6, and AsAPX8), GR (AsGR2), and DHAR genes (AsDHAR) (Figs 6, 7, 8&9). Results showed that exogenous chitosan induced a significant increase in POD, APX, GR, and DHAR at both enzymatic and gene expression levels under heat stress. However, antioxidant enzyme activities were regulated by multiple factors, which might lead to variations in the transcript levels of antioxidant enzymes inconsistent with antioxidant enzyme activities[59]. Therefore, in the current study, foliar application of chitosan up-regulated transcript levels of AsCu/ZnSOD and AsCATB, but did not enhance activities of SOD and CAT. Our above results indicated that chitosan-induced promotion in heat tolerance resulted from alterations in antioxidant defense system including non-enzymatic antioxidants, antioxidant enzymes, as well as relative gene expression for ROS scavenging in creeping bentgrass.

      In conclusion, exogenous chitosan significantly enhanced heat tolerance in creeping bentgrass. Chitosan-induced heat tolerance could be attributed to the less oxidative damage and better maintenance of antioxidant defense system detoxifying ROS. Foliar application of chitosan suppressed overproduction of ROS (H2O2 and O2−), improved ascorbic acid content and antioxidant enzymes activities (POD, APX, GR, and DHAR), as well as up-regulated transcript levels of AsCu/ZnSOD, AsCATB, AsPerox4, AsAPX2, AsAPX4, AsAPX6, AsAPX8, AsGR2, and AsDHAR compared with untreated control. In the future, further investigating into the molecular mechanisms of chitosan in improving heat tolerance is necessary.

      Acknowledgments

      • This study was supported by the Fundamental Research Funds for the Central Universities (XUEKEN2022020) and the project of the Innovation and Promotion of Forestry Science and Technology of Jiangsu Province (LYKJ[2021]29).

      Conflict of interest

      • The authors declare that they have no conflict of interest.

      Rights and permissions
      • Copyright: © 2023 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (9)  Table (1) References (59)
  • About this article
    Cite this article
    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007
    Li Q, Bian Y, Li R, Yang Z, Liu N, et al. 2023. Chitosan-enhanced heat tolerance associated with alterations in antioxidant defense system and gene expression in creeping bentgrass. Grass Research 3:7 doi: 10.48130/GR-2023-0007
    shu

Catalog

  • HTML

  • Introduction
  • Materials and methods

  • Plant material and growth conditions

  • Experimental design and treatments

  • Turf quality and staining of ROS

  • Non-enzymatic antioxidant content and antioxidant enzyme activity measurements

  • Gene expression analysis of antioxidant enzyme in leaves

  • Statistical analysis

  • Results

  • Turf performance and ROS

  • Non-enzymatic antioxidant content

  • Antioxidant enzyme activity

  • Gene expression of antioxidant enzyme

  • Discussion
  • Acknowledgments
  • Conflict of interest
  • Rights and permissions
  • About this article
logo

Contents

Policies

Services

Partnerships

© 2025 Maximum Academic Press, except Open Access articles. MAP is a member of ALPSP, COPE, CrossRef, cOAlition S, OASPA and STM.

Privacy Policy  |  Site Map  |  Terms and Conditions

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return