ARTICLE   Open Access    

Understanding perceptions of college students on the operation of automated shuttle for persons with disabilities on campus walkways

More Information
  • Persons with disabilities have difficulties traveling from one point to the other due to the limited options of travel modes for the first and last mile. Western Michigan University tested using an autonomous shuttle on the main campus's sidewalks for persons with disabilities. This study's objectives are to understand the empathy college students without disabilities had on the need for suitable transportation services for students with disabilities and the perceived risks of the services' operation on sidewalks. The Bayesian ordered logit model and text mining analyzed 396 survey responses. The Bayesian ordered logistic regression results revealed that age, gender, and ethnicity are important factors that contribute to different opinions concerning perceived risks and sympathy brought by an autonomous shuttle operating on pedestrians' sidewalks. The text mining results revealed several patterns. While respondents who were against the operation focused on potential safety hazards and the crowdedness of the sidewalks, supporters focused on the expected improved mobility for people with disabilities. The findings from this study are expected to assist policymakers and vehicle manufacturers with pedestrian expectations and considerations related to risk and safety when sharing their walkways with the autonomous shuttle.
  • The intestinal mucosal barrier is composed of epithelial cells and intercellular connections, which can effectively regulate the transportation of large molecules in the intestinal lumen, and prevent microorganisms, harmful solutes, toxins, and intraluminal antigens from entering bodies[1]. Mucosal barrier factors such as trefoil factor (TFF) family, diamine oxidase (DAO), and transform growth factor-ɑ (TGF-α) have protective and restorative effects on intestinal mucosal integrity, which are synthesized and secreted by intestinal mucosa[24]. The damage to intestinal barrier function can cause the invasion of antigens and bacteria in the lumen, and eventually lead to intestinal diseases, including diarrhea, inflammatory bowel disease (IBD), and Crohn's disease[57].

    The Notch signaling pathway plays a crucial role in a series of cellular processes, including proliferation, differentiation, development, migration, and apoptosis. Research suggests that the Notch signaling pathway is involved in intestinal development, and it can be connected to intestinal cell lineage specification[8]. Furthermore, the Notch signaling pathway can regulate intestinal stem cells, CD4+T cells, innate lymphoid cells, macrophages, and intestinal microbiota, and intervene in the intestinal mucosal barriers in cases of ulcerative colitis[9]. The activated Notch signaling pathway can suppress the goblet cells differentiation and mucus secretion, which would result in the disruption of the intestinal mucosal barrier[10]. In addition, the absence of the Notch signaling pathway would cause the dysfunction of tight junctions and adherens junctions of intestinal mucosa, which could lead to increased permeability of epithelial cells and exposure of luminal contents to the immune system and inflammation[11]. Phytochemicals, such as cucurbitacin, honokiol and quercetin have been reported to have therapeutic effects on intestinal diseases by targeting the Notch signaling pathway[1214].

    Plant-based diets rich in phytochemicals, such as phenolics, anthocyanins, and vitamins, have been related to the prevention of human diseases[15]. Anthocyanins belong to a subclass of flavonoids, and are mainly in the form of different anthocyanin combined with glucose, galactose, and arabinose[16]. The physiological action of anthocyanins, such as antioxidant activity, anti-inflammation, and anti-obesity effects have been widely reported[17,18]. M3G is found naturally in plants and is reported to be the most common anthocyanin in different blueberry varieties[19,20]. Previous researchers reported that M3G from blueberry suppressed the growth and metastasis potential of hepatocellular carcinoma cells, modulated gut microbial dysbiosis, and protected TNF-α induced inflammatory response injury in vascular endothelial cells[2123]. Anthocyanins with diverse molecular structures and from different dietary sources are bioavailable at diet-relevant dosage rates, and anthocyanins from berry fruit are absorbed and excreted by both humans and rats[24]. Studies have shown that anthocyanins have a protective effect on intestinal barrier damage by regulating gut microbiota, tight junction (TJ) protein expression, and secretion of MUC2[2527]. In addition to physiological indicators related to the intestinal barrier, the regulation of the Notch signaling pathway was involved in this study. Therefore, it is speculated that M3G could improve the colonic mucosal barrier function via the Notch signaling pathway.

    To prove this hypothesis, the effects of M3G on the colonic mucosal barrier function were investigated in DSS-induced colitis mice. The pathological morphology of the colon tissue, markers of intestinal physical barrier function and immune barrier function and the Notch signaling pathway were evaluated to reveal the mechanism of M3G in improving colonic mucosal barrier function. The results are expected to lay the foundation for the utilization of anthocyanins as a promising natural product for improving intestinal diseases.

    M3G (CAS: 30113-37-2) used in this study was purchased from Xinyi Science and Technology Instrument Business Department, Baoji, Shanxi, China (HPLC ≥ 98%).

    Five-week-old male C57BL/6J mice (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) weighing 16−18 g were housed and given AIN-93M diet (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) feeding. The animal experiment was carried out according to the guidelines of the Standards for Laboratory Animals of China (GB 14922-94, GB 14923-94, and GB/T 14925-94) and the Ethics Committee of Shenyang Agricultural University (IACUC Issue No.: 2023022401). All animal housing and experiments were conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals.

    After acclimating to the breeding environment for one week, the mice were randomly divided into two groups: control group (CG group, n = 6) and model group (n = 12). On days 1−7, the mice of the model group were given 2.5% DSS (CAS: 9011-18-1) dissolved in drinking water, while the mice of the CG group were given the same volume of drinking water as the model group. On days 8−14, mice of the model group were randomly divided into two equal groups (n = 6): DSS group and M3G group. The mice of the CG and DSS groups were administered intragastrically via drinking water, and the mice of the M3G group were administered intragastrically by M3G (5 mg/kg body weight (BW)/d) dissolved in drinking water, and the liquid volume was controlled to be the same. For all groups of mice, the body weight, food consumption, stool consistency, and bloody stool were measured daily during the experiment. On day 15, mice were sacrificed after a 12 h fast, and the colon tissue samples of the mice were collected. The length of the colon tissue was measured and recorded.

    Colon tissue was embedded with paraffin and then cut into sections. After being dewaxed from paraffin, the tissue was placed in water, and stained with hematoxylin and eosin solution. The stained tissue was dehydrated and sealed for observation. A microscope (BX53, Olympus Co., Ltd., Tokyo, Japan) was used to observe the stained tissue and photographed using 100× magnification. The damage in epithelial cells of colon tissue was evaluated.

    The colon tissue was dewaxed and placed in water after being embedded with paraffin, and then stained with schiff and hematoxylin solution. The stained tissue was dehydrated and sealed for observation. A microscope was used to observe the stained tissue and photographed using 100× magnification. The mucosal thickness and the population of goblet cells of the colon tissue were measured and recorded.

    The expression of MUC2 in colon tissue was detected by RT-PCR. Total RNA was extracted from colon tissue, and the concentration was determined using an ultraviolet spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The single-stranded cDNA of the extracted RNA (0.1 μL) was synthesized using a Transcriptor First Strand cDNA Synthesis Kit (Roche Co., Ltd., Basel, Kanton Basel, Switzerland). ExicylerTM 96 (Bioneer Corporation, Daejeon, Korea) was used to analyze the fluorescence quantitative cDNA. The reaction conditions were as follows: 94 °C for 5 min, 94 °C for 10 s, 60 °C for 20 s, 72 °C for 30 s, then followed by 40 cycles of 72 °C for 2 min 30 s, 40 °C for 1 min 30 s, and then melting from 60 to 94 °C, and incubating at 25 °C for 1−2 min. The primer sequences are shown in Table 1.

    Table 1.  The primer sequences used in the RT-PCR analysis.
    Gene Prime Sequence (5'-3') Size (bp)
    MUC2 Forward TGTGCCTGGCTCTAATA 17
    Reverse AGGTGGGTTCTTCTTCA 17
    β-actin Forward CTGTGCCCATCTACGAGGGCTAT 23
    Reverse TTTGATGTCACGCACGATTTCC 22
     | Show Table
    DownLoad: CSV

    The whole proteins from the colon tissue (200 mg) were extracted using a Whole Cell Lysis Assay kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Briefly, colon tissue was cut into pieces, and then mixed with phenylmethylsulfonyl fluorid (PMSF), followed by adding the protein extraction reagents A and B to prepare the tissue homogenate. Protein concentration was then determined using a Bradford Kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The membranes were blocked with 5% non-fat dry milk in TBST buffer for 1 h, followed by incubating overnight at 4 °C with the appropriate monoclonal primary antibody (detailed information in Table 2). Then membranes were washed to remove non-bound antibodies, and then incubated with the secondary antibody (goat anti-rabbit immunoglobin G-horseradish peroxidase (IgG-HRP), 1:5000; Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) at 37 °C for 45 min. The enhanced chemiluminescence (ECL) western blotting detection reagent (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) was used to detect the protein bands, and then the protein bands were visualized by a Gel Imaging System (Beijing Liuyi Biotechnology Co., Ltd., Beijing, China).

    Table 2.  Details of the primary antibodies used in the experiment.
    Primary antibody Dilution ratio Manufacturer
    Claudin-1 1:500 Wanlei Bio Co., Ltd.
    Occludin 1:500 Wanlei Bio Co., Ltd.
    ZO-1 1:500 Wanlei Bio Co., Ltd.
    iFABP 1:1000 ABclonal Technology Co., Ltd.
    DLL1 1:500 Wanlei Bio Co., Ltd.
    DLL4 1:1000 ABclonal Technology Co., Ltd.
    Notch1 1:500 Wanlei Bio Co., Ltd.
    NICD 1:1000 Affinity Biosciences Co., Ltd.
    Hes1 1:1000 ABclonal Technology Co., Ltd.
    TFF3 1:1000 Affinity Biosciences Co., Ltd.
    β-actin 1:1000 Wanlei Bio Co., Ltd.
     | Show Table
    DownLoad: CSV

    The level of SIgA in colon tissue was detected by SIgA ELISA kit (Model number: EM1362, Wuhan Fine Biotech Co., Ltd., Wuhan, Hubei, China). The experiment was carried out according to the ELISA kit instructions.

    CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells in colonic lamina propria monocytes (LPMC) were detected by FCM. The colonic epithelial cells were isolated by adding digestive solution to the colon tissue. After digestion, screening, re-suspension precipitation, and centrifugation, the precipitate was collected as colonic LPMC. Labeled antibodies were added to the flow tube and incubated according to the instructions. After washing with phosphate buffered saline (PBS), the cells were re-suspended in PBS solution. The CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells were detected by flow cytometric (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Data are expressed as mean ± standard deviation (SD) based on six replicates. Differences between two groups were assessed using Student's t tests. The results were considered statistically significant at p < 0.05. Data were analyzed using Graph Pad Prism 8.0 (Graph Pad Software, San Diego, CA, USA) and SPSS 17.0 (IBM Corporation, Armonk, NY, USA).

    The body weight of mice was monitored daily during the experimental period. As shown in Fig. 1a, after being fed with DSS for 7 d, the body weight of the mice in the DSS group was reduced significantly (p < 0.01) compared with that of the CG group. While the body weight of the mice in the M3G group was increased, and exhibited significantly higher (p < 0.01) body weight gain compared with the DSS group. The DAI score of the mice in the DSS group was significantly higher (p < 0.01) than that of the CG group, but M3G supplementation significantly lowered (p < 0.01) the DAI score (Fig. 1b), which demonstrates that the DSS-induced mice colitis model was established successfully and M3G inhibited colon tissue damage in DSS-fed mice. Compared with the CG group, the food intake of the mice fed with DSS was significantly reduced (p < 0.01), and M3G supplementation significantly increased (p < 0.05) the food intake (Fig. 1c).

    Figure 1.  Effect of M3G on body weight gain, DAI score, and food intake in mice. (a) Body weight gain. (b) DAI score (Fecal consistency: 0 = normal, 1 = semi-formed, 2 = soft stool, 3 = diarrhea or watery stool; bloody stool: 0 = occult blood negative, 1 = occult blood positive, 2 = visible bloody stool, 3 = massive hemorrhage; weight loss: 0 = 0%, 1 = 1%−5 %, 2 = 6%−10% ; 3 = 11%−15% reduction). (c) Food intake. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    Representative HE and PAS-stained sections of the colon are shown in Fig. 2a & b. The morphology of colon tissue in the CG group did not exhibit any damage, while damage in epithelial cells and goblet cells, inflammatory cells infiltration, and separation of the muscle layer and mucosal muscle layer were observed in the DSS group. The above damage to the tissue was changed for the better by M3G supplementation, with only small levels of damage in epithelial cells and goblet cells, inflammatory cell infiltration, and separation of the muscle layer and mucosal muscle layer compared to that in the CG group.

    Figure 2.  Effect of M3G on the pathological morphology of colon tissue. (a) HE staining of colon tissue. Original magnifications: 100×. (b) PAS staining of colon tissue. Original magnifications: 100×. (c) The damage score of colon tissue. (1) Epithelial cell damage: 0 = normal morphology; 1 = regional destruction of the epithelial surface; 2 = diffuse epithelial destruction and/or mucosal ulcers involving submucosa; 3 = severe epithelial damage. (2) Inflammatory cell infiltration: 0 = no infiltration or less than 5 cells; 1 = mild infiltration of the inherent layer; 2 = moderate infiltration of the muscular mucosa; 3 = high infiltration of the muscular mucosa; 4 = severe infiltration involving submucosa. (3) Separation of muscle layer and mucosal muscle layer: 0 = normal; 1 = moderate; 2 = severe. (4) Goblet cell depletion: 0 = no depletion; 1 = presence of disordered goblet cells; 2 = 1 to 3 regions without goblet cells; 3 = more than 3 regions without goblet cells; 4 = complete depletion of goblet cells. (d) The colon length. (e) The mucosal thickness of colon tissue. (f) Number of goblet cells in colon tissue. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    HE score was calculated to evaluate the degree of colon tissue damage. The HE score in the DSS group was significantly higher (p < 0.01) than that in the CG group. Supplementation of M3G significantly reduced (p < 0.01) the score, which decreased by almost 50% of that in the DSS group (Fig. 2c). The colon length in the DSS group was significantly lower (p < 0.01) than that in the CG group, which was significantly increased (p < 0.01) by M3G supplementation (Fig. 2d). The mucosal thickness and the number of goblet cells of the colon tissue were determined by PAS staining. Compared with the CG group, the mucosal thickness and the number of goblet cells of the colon tissue were significantly decreased (p < 0.01) in the DSS group, but those were significantly increased (p < 0.01) in the M3G group (Fig. 2e & f). These results suggest that M3G supplementation can decrease the pathological damage in the colon tissue induced by DSS.

    The mRNA expression level of MUC2 in the colonic mucosa tissue was determined. Compared with the CG group, DSS significantly decreased (p < 0.01) the mRNA level of MUC2, but this effect was significantly suppressed (p < 0.01) by M3G supplementation (Fig. 3a). The protein levels of claudin-1, occludin, ZO-1, iFABP, and TFF3 in the colon tissue were subsequently assessed. The protein expression levels of claudin-1, occludin, and ZO-1 in the DSS group were significantly lower than those in the CG group (p < 0.01). M3G supplementation significantly inhibited (p < 0.01) the reduction in the expression of these proteins (Fig. 3bd). Regarding the protein expression level of iFABP, it was significantly higher (p < 0.01) in the DSS group than that in the CG group. M3G supplementation significantly decreased (p < 0.01) iFABP expression level compared with the DSS group (Fig. 3e). The protein expression level of TFF3 was significantly higher (p < 0.01) in the DSS group than that in the CG group. However, M3G supplementation significantly intensified (p < 0.01) the increase of TFF3 expression compared with the DSS group (Fig. 3f). These results indicate that M3G can regulate colonic epithelial barrier function.

    Figure 3.  Effects of M3G on the colonic epithelial barrier disruption. (a) The mRNA expression level of MUC2. (b) The protein expression level of claudin-1. (c) The protein expression level of occludin. (d) The protein expression level of ZO-1. (e) The protein expression level of iFABP. (f) The protein expression level of TFF3. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    The content of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in colonic LPMC of mice in each group were detected by FCM as shown in Fig. 4 and Supplemental Fig. S1. Compared with the CG group, the percentages of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in the DSS group were significantly increased (p < 0.01), and those were significantly decreased (p < 0.05) after M3G supplementation (Fig. 4a & b). SIgA was measured as an indicator of immune barrier function in the colon tissue. The level of SIgA in the DSS group was significantly lower (p < 0.01) than that in the CG group. Supplementation of M3G significantly raised (p < 0.01) the level of SIgA (Fig. 4c). These results indicate that M3G can improve the colonic immune dysfunction induced by DSS.

    Figure 4.  Effect of M3G on the colonic immune barrier function. (a) The percentage of CD4+T (CD3+CD4+) cells in the colon tissue. (b) The percentage of CD8+T (CD3+CD8+) cells in the colon tissue. (c) The level of SIgA in the colonic mucosal tissue. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    Subsequently, the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in the colon tissue were measured (Fig. 5). DSS significantly up-regulated (p < 0.01) these protein expression levels compared with the CG group. M3G supplementation significantly (p < 0.01) down-regulated the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in comparison with the DSS group. The results indicate that M3G can inhibit the over-activation of the Notch signaling pathway.

    Figure 5.  Effects of M3G on the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in the colon tissue. (a) The protein expression level of Notch1. (b) The protein expression level of NICD. (c) The protein expression level of DLL4. (d) The protein expression level of DLL1. (e) The protein expression level of Hes1. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    To explain the relationships between them, the Spearman r correlations between biomarkers and the Notch signaling pathway were analyzed, and represented using a heatmap. As shown in Fig. 6, colon length, food intake, ZO-1, number of goblet, MUC2, SIgA, claudin-1, occludin, body weight gain, and mucosal thickness were significantly (p < 0.01 or p < 0.05) positively correlated with Notch1, NICD, DLL4, DLL1, and Hes1. Conversely, HE score, iFABP, DAI score, CD4+T, and CD8+T were significantly (p < 0.01) negatively correlated with Notch1, NICD, DLL4, DLL1 and Hes1. In particular, TFF3 was only significantly (p < 0.05) positively correlated with DLL1, and Hes1. The results indicate that M3G may ameliorate the colonic mucosal barrier dysfunction via modulation of the Notch signaling pathway.

    Figure 6.  Heatmap of the Spearman r correlations between biomarkers and the Notch signaling pathway. * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    Within the last five years, special attention is being paid to the therapeutic effects of anthocyanins. The recent studies could give evidence to prove the therapeutic potential of anthocyanins from different sources against various diseases via in vitro, in vivo, and epidemiological experiments[28]. The anthocyanin supplementation has been demonstrated to have positive effects on intestinal health[29]. The intestinal barrier is one of the crucial factors which can affect intestinal health and normal intestinal barrier function not only maintains intestinal health but also protects overall health by protecting the body from intestine injury, pathogen infection, and disease occurrence[30]. The disruption of intestinal barrier integrity is regarded as an important factor leading to IBD, obesity, and metabolic disorders[3133]. In this study, the effects of M3G on regulating the colonic physical barrier function and colonic immune barrier function in DSS-induced colitis mice were explored.

    M3G supplementation reduced the DAI score and the HE score of colon tissue, and restored colon length, mucosal thickness, and the number of goblet cells in the colon tissue, indicating that M3G can alleviate DSS-induced colon tissue damage and colitis symptoms in mice. The DAI score was developed as a simplified clinical colitis activity index to assess the severity of colitis[34]. Zhao et al. have found that black rice anthocyanin-rich extract can significantly decrease the DAI and HE scores of colon tissue in DSS-induced colitis mice[35]. Intestinal goblet cells are mainly differentiated from multipotential stem cells. Intestinal stem cells were located at the base of the crypt and distributed in intestinal mucosal epithelial cells, composing around 50% of colon epithelial cells[36]. The mucus layer is formed by goblet cell secretion, it separates the intestinal epithelium from the intestinal lumen, thereby preventing the invasion of pathogenic microorganisms and the translocation of intestinal microbiota[37]. The results suggested that M3G might repair the colonic mucosa by increasing the number of goblet cells.

    MUC2 is the most abundant mucin secreted by goblet cells of the colon, goblet cells, and MUC2 play important roles in maintaining and protecting the intestinal mucosal barrier[38]. M3G supplementation restored the level of MUC2 by nearly double that of the DSS group. Claudin-1, occludin, and ZO-1 are TJ proteins, which is an important component of the intestinal physical barrier[39]. M3G supplementation mitigated the down-regulation of claudin-1, occludin, and ZO-1 in DSS-induced colitis mice. Wang et al. have found that Lonicera caerulea polyphenols can increase the expression levels of occludin in HFD rats[40]. Chen et al. have found that purple-red rice anthocyanins alleviated intestinal barrier dysfunction in cyclophosphamide-induced mice by up-regulating the expression of tight junction proteins[41]. iFABP can serve as a biomarker of small bowel damage in coeliac disease and Crohn's disease, and supplementation of M3G down-regulated the expression level of iFABP in colon tissue[42]. It has been reported that TFF3 alleviated the intestinal barrier function by reducing the expression of TLR4 in rats with nonalcoholic steatohepatitis, and supplementation of M3G increased the expression level of TFF3 in this research[43]. Although the effect of M3G on epithelial TJ proteins and other related proteins were limited, the beneficial effect of M3G on the colonic mucosal barrier function was supported by histological evaluation.

    The intestinal immune barrier is composed of intestinal mucosal lymphoid tissue and intestinal plasma cell secreted antibodies. Inflammatory damage in acute colitis influences the gut microbiota, epithelial barrier, and immune function in subsequent colitis[44]. Fructose can influence colon barrier function by regulating some main physical, immune, and biological factors in rats[45]. SIgA, CD4+T cells, and CD8+T cells play important roles in the functioning of the human immune system. The results indicated that M3G supplementation can maintain the colonic immune barrier function by modulating the level of SIgA, and the percentages of CD4+T cells and CD8+T cells of colon tissue.

    Notch signaling pathways are important for the maintenance of intestinal epithelial barrier integrity, and its abnormal activation is related to IBD and colon cancer[46]. Among the four Notch receptors in mammals, the most scattered in the intestine is Notch1[47]. NICD is the active form of the Notch receptor, NICD enters the nucleus, binds to the recruitment co-activator transcription complex, and then combines with the Hes gene to regulate the fate of cells[48,49]. DLL1 and DLL4 can serve as ligands for Notch signaling receptors[50]. Lin et al. found that qingbai decoction had beneficial effects on the mucus layer and mechanical barrier of DSS-induced colitis by inhibiting Notch signaling[51]. Supplementation with M3G significantly down-regulated Notch1, NICD, DLL4, DLL1, and Hes1 expression levels in the colon tissue, and there is a significant correlation between biomarkers and Notch signaling pathway-related proteins, suggesting that M3G might sustain the colonic barrier function via inhibiting the Notch signaling pathway.

    The present results showed that M3G exerted an improvement effect on the colonic mucosal barrier (physical barrier and immune barrier) function in DSS-induced colitis mice. The positive impact of M3G on the colonic mucosal barrier function may be ascribed to the modulation of permeability, stability, and integrity of the colonic mucosa by down-regulating the Notch signaling pathway. The results provide theoretical support for anthocyanins as the raw materials of functional products related to intestinal health. However, this study also has limitations, such as lacking intensive research on the effect mechanisms through cell experiments. Therefore, intensive research and clinical tests are the future direction.

    The authors confirm contribution to the paper as follows: study conception and design: Zhang C, Jiao X; data collection: Zhang L; analysis and interpretation of results: Zhang C, Zhang L, Zhang B, Zhang Y; draft manuscript preparation: Zhang C, Wang Y, Tan H, Li L, Jiao X. All authors reviewed the results and approved the final version of the manuscript.

    The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

    We would like to thank the Liaoning Provincial Department of Education Project - General Project (LJKMZ20221060).

  • The authors declare that they have no conflict of interest.

  • [1]

    des Cognets J, Rafert G. 2019. Assessing the unmet transportation needs of Americans with disabilities. https://anyflip.com/ieove/pvfg/basic

    [2]

    Harper CD, Hendrickson CT, Mangones S, Samaras C. 2016. Estimating potential increases in travel with autonomous vehicles for the non-driving, elderly and people with travel-restrictive medical conditions. Transportation Research Part C: Emerging Technologies 72:1−9

    doi: 10.1016/j.trc.2016.09.003

    CrossRef   Google Scholar

    [3]

    Stjernborg V. 2019. Accessibility for all in public transport and the overlooked (social) dimension — a case study of Stockholm. Sustainability 11:4902

    doi: 10.3390/su11184902

    CrossRef   Google Scholar

    [4]

    U.S. Department of Transportation, National Highway Traffic Safety Administration (NHTSA). 2018. Fatal Motor Vehicle Crashes 2017: Overview. Dot Hs 812603. pp. 1–9. https://crashstats.nhtsa.dot.gov/Api/Public/ViewPublication/812603

    [5]

    American Association for People with Disability (AAPD). 2016. Equity in Transportation for People with Disabilities. https://www.civilrightsdocs.info/pdf/transportation/final-transportation-equity-disability.pdf

    [6]

    Tillmann V, Haveman M, Stöppler R, Kvas Š, Monninger D. 2013. Public bus drivers and social inclusion: evaluation of their knowledge and attitudes toward people with intellectual disabilities. Journal of Policy and Practice in Intellectual Disabilities 10:307−13

    doi: 10.1111/jppi.12057

    CrossRef   Google Scholar

    [7]

    Park J, Chowdhury S. 2018. Investigating the barriers in a typical journey by public transport users with disabilities. Journal of Transport & Health 10:361−68

    doi: 10.1016/j.jth.2018.05.008

    CrossRef   Google Scholar

    [8]

    Council N, June D. 2005. The Current State of Transportation for People with Disabilities in the United States National. Report. National Council on Disability, US. www.govinfo.gov/content/pkg/GOVPUB-Y3_D63_3-PURL-LPS97333/pdf/GOVPUB-Y3_D63_3-PURL-LPS97333.pdf

    [9]

    Cohen S, Shirazi S. 2017. Can We Advance Social Equity with Shared, Autonomous and Electrica Vehicles? California Governer's Office of Planning and Research. Report. US: UC Davis Institute of Transportation Studies. https://3rev.sf.ucdavis.edu/sites/g/files/dgvnsk6431/files/files/page/3R.Equity.Indesign.Final_.pdf

    [10]

    Krueger R, Rashidi TH, Rose JM. 2016. Preferences for shared autonomous vehicles. Transportation Research Part C: Emerging Technologies 69:343−55

    doi: 10.1016/j.trc.2016.06.015

    CrossRef   Google Scholar

    [11]

    Litman T. 2014. Autonomous vehicle implementation predictions: implications for transport planning. Transportation Research Board Annual Meeting 42:36−42

    Google Scholar

    [12]

    Brandshaw-Martin H, Easton C. 2014. Autonomous or "driverless" cars and disability: a legal and ethical analysis. Eurpean Journal of Current Legal Issues. 20(3):00

    Google Scholar

    [13]

    Hwang J, Li W, Stough L, Lee C, Turnbull K. 2020. A focus group study on the potential of autonomous vehicles as a viable transportation option: perspectives from people with disabilities and public transit agencies. Transportation Research Part F: Traffic Psychology and Behaviour 70:260−74

    doi: 10.1016/j.trf.2020.03.007

    CrossRef   Google Scholar

    [14]

    Kassens-Noor E, Kotval-Karamchandani Z, Cai M. 2020. Willingness to ride and perceptions of autonomous public transit. Transportation Research Part A: Policy and Practice 138:92−104

    doi: 10.1016/j.tra.2020.05.010

    CrossRef   Google Scholar

    [15]

    National Center for Mobility Management. 2018. Autonomous Vehicles: Considerations for People with Disabilities and Older Adults. https://nationalcenterformobilitymanagement.org/wp-content/uploads/2018/08/AVs_PwD_OA_Final_sm.pdf.

    [16]

    U.S. Department of Transportation, Federal Highway Administration (USDOT). 2016. Small Town and Rural Multimodal Networks. https://transportation.ky.gov/BikeWalk/Documents/Small%20and%20Rural%20Town%20Multi%20Modal%20Networks%202017.pdf

    [17]

    Machek E, Burkman E, Crayton T, Cregger J, Diggs D, et al. 2018. Strategic Transit Automation Research Plan. https://doi.org/10.21949/1503427

    [18]

    Schoettle B, Sivak M. 2014. A survey of public opinion about connected vehicles in the U.S., the U.K., and Australia. 2014 International Conference on Connected Vehicles and Expo (ICCVE). Vienna, Austria, 3-7 November 2014. USA: IEEE. pp. 687−92. https://doi.org/10.1109/ICCVE.2014.7297637

    [19]

    Bennett R, Vijaygopal R, Kottasz R. 2019. Attitudes towards autonomous vehicles among people with physical disabilities. Transportation Research Part A: Policy and Practice 127:1−17

    doi: 10.1016/j.tra.2019.07.002

    CrossRef   Google Scholar

    [20]

    Hulse LM, Xie H, Galea ER. 2018. Perceptions of autonomous vehicles: relationships with road users, risk, gender and age. Safety Science 102:1−13

    doi: 10.1016/j.ssci.2017.10.001

    CrossRef   Google Scholar

    [21]

    Hwang J, Li W, Stough LM, Lee C, Turnbull K. 2021. People with disabilities’ perceptions of autonomous vehicles as a viable transportation option to improve mobility: an exploratory study using mixed methods. International Journal of Sustainable Transportation 15:924−42

    doi: 10.1080/15568318.2020.1833115

    CrossRef   Google Scholar

    [22]

    Battistini R, Mantecchini L, Postorino MN. 2020. Users' acceptance of connected and automated shuttles for tourism purposes: a survey study. Sustainability 12:10188

    doi: 10.3390/su122310188

    CrossRef   Google Scholar

    [23]

    Haboucha CJ, Ishaq R, Shiftan Y. 2017. User preferences regarding autonomous vehicles. Transportation Research Part C: Emerging Technologies 78:37−49

    doi: 10.1016/j.trc.2017.01.010

    CrossRef   Google Scholar

    [24]

    Xu X, Fan CK. 2019. Autonomous vehicles, risk perceptions and insurance demand: an individual survey in China. Transportation Research Part A: Policy and Practice 124:549−56

    doi: 10.1016/j.tra.2018.04.009

    CrossRef   Google Scholar

    [25]

    Payre W, Cestac J, Delhomme P. 2014. Intention to use a fully automated car: attitudes and a priori acceptability. Transportation Research Part F: Traffic Psychology and Behaviour 27:252−63

    doi: 10.1016/j.trf.2014.04.009

    CrossRef   Google Scholar

    [26]

    Hohenberger C, Spörrle M, Welpe IM. 2016. How and why do men and women differ in their willingness to use automated cars? The influence of emotions across different age groups. Transportation Research Part A: Policy and Practice 94:374−85

    doi: 10.1016/j.tra.2016.09.022

    CrossRef   Google Scholar

    [27]

    Madigan R, Louw T, Wilbrink M, Schieben A, Merat N. 2017. What influences the decision to use automated public transport? Using UTAUT to understand public acceptance of automated road transport systems. Transportation Research Part F: Traffic Psychology and Behaviour 50:55−64

    doi: 10.1016/j.trf.2017.07.007

    CrossRef   Google Scholar

    [28]

    Zhang T, Tao D, Qu X, Zhang X, Lin R, et al. 2019. The roles of initial trust and perceived risk in public’s acceptance of automated vehicles. Transportation Research Part C: Emerging Technologies 98:207−20

    doi: 10.1016/j.trc.2018.11.018

    CrossRef   Google Scholar

    [29]

    Xu Z, Zhang K, Min H, Wang Z, Zhao X, et al. 2018. What drives people to accept automated vehicles? Findings from a field experiment. Transportation Research Part C: Emerging Technologies 95:320−34

    doi: 10.1016/j.trc.2018.07.024

    CrossRef   Google Scholar

    [30]

    Fan HSL. 1990. Passenger car equivalents for vehicles on Singapore expressways. Transportation Research Part A: General 24:391−96

    doi: 10.1016/0191-2607(90)90051-7

    CrossRef   Google Scholar

    [31]

    McNeish D. 2016. On using Bayesian methods to address small sample problems. Structural Equation Modeling: A Multidisciplinary Journal 23:750−73

    doi: 10.1080/10705511.2016.1186549

    CrossRef   Google Scholar

    [32]

    Williams R. 2016. Understanding and interpreting generalized ordered logit models. The Journal of Mathematical Sociology 40:7−20

    doi: 10.1080/0022250x.2015.1112384

    CrossRef   Google Scholar

    [33]

    Eberly LE, Casella G. 2003. Estimating Bayesian credible intervals. Journal of Statistical Planning and Inference 112:115−32

    doi: 10.1016/s0378-3758(02)00327-0

    CrossRef   Google Scholar

    [34]

    Bürkner PC. 2018. Advanced Bayesian multilevel modeling with the R package brms. The R Journal 10:395

    doi: 10.32614/rj-2018-017

    CrossRef   Google Scholar

    [35]

    Kutela B, Kidando E, Kitali AE, Mwende S, Novat N. 2023. Examining in-vehicle distraction sources in relation to crashes using a Bayesian Multinomial Logit model. Advances in Transportation Studies 61:3−18

    Google Scholar

    [36]

    Yoon B, Park Y. 2004. A text-mining-based patent network: analytical tool for high-technology trend. The Journal of High Technology Management Research 15:37−50

    doi: 10.1016/j.hitech.2003.09.003

    CrossRef   Google Scholar

    [37]

    Hong HS, Lee SK. 2021. Text network analysis of research topics and trends on global health nursing literature from 1974−2017. Journal of Advanced Nursing 77:1325−34

    doi: 10.1111/jan.14685

    CrossRef   Google Scholar

    [38]

    Kutela B, Novat N, Langa N. 2021. Exploring geographical distribution of transportation research themes related to COVID-19 using text network approach. Sustainable Cities and Society 67:102729

    doi: 10.1016/j.scs.2021.102729

    CrossRef   Google Scholar

    [39]

    Kutela B, Langa N, Mwende S, Kidando E, Kitali AE, et al. 2021. A text mining approach to elicit public perception of bike-sharing systems. Travel Behaviour and Society 24:113−23

    doi: 10.1016/j.tbs.2021.03.002

    CrossRef   Google Scholar

    [40]

    Paranyushkin D. 2012. Visualization of text's polysingularity using network analysis. https://api.semanticscholar.org/CorpusID:61464677

    [41]

    Kim Y, Jang SN. 2018. Mapping the knowledge structure of frailty in journal articles by text network analysis. PLoS One 13:e0196104

    doi: 10.1371/journal.pone.0196104

    CrossRef   Google Scholar

    [42]

    Kyriakidis M, Happee R, de Winter JCF. 2015. Public opinion on automated driving: results of an international questionnaire among 5000 respondents. Transportation Research Part F: Traffic Psychology and Behaviour 32:127−40

    doi: 10.1016/j.trf.2015.04.014

    CrossRef   Google Scholar

    [43]

    Hussain Q, Alhajyaseen WKM, Adnan M, Almallah M, Almukdad A, et al. 2021. Autonomous vehicles between anticipation and apprehension: investigations through safety and security perceptions. Transport Policy 110:440−51

    doi: 10.1016/j.tranpol.2021.07.001

    CrossRef   Google Scholar

    [44]

    Rahman MT, Dey K, Das S, Sherfinski M. 2021. Sharing the road with autonomous vehicles: a qualitative analysis of the perceptions of pedestrians and bicyclists. Transportation Research Part F: Traffic Psychology and Behaviour 78:433−45

    doi: 10.1016/j.trf.2021.03.008

    CrossRef   Google Scholar

  • Cite this article

    Lyimo SM, Kwigizile V, Kutela B, Asher ZD. 2024. Understanding perceptions of college students on the operation of automated shuttle for persons with disabilities on campus walkways. Digital Transportation and Safety 3(2): 36−45 doi: 10.48130/dts-0024-0004
    Lyimo SM, Kwigizile V, Kutela B, Asher ZD. 2024. Understanding perceptions of college students on the operation of automated shuttle for persons with disabilities on campus walkways. Digital Transportation and Safety 3(2): 36−45 doi: 10.48130/dts-0024-0004

Figures(5)  /  Tables(2)

Article Metrics

Article views(2243) PDF downloads(449)

ARTICLE   Open Access    

Understanding perceptions of college students on the operation of automated shuttle for persons with disabilities on campus walkways

Digital Transportation and Safety  3 2024, 3(2): 36−45  |  Cite this article

Abstract: Persons with disabilities have difficulties traveling from one point to the other due to the limited options of travel modes for the first and last mile. Western Michigan University tested using an autonomous shuttle on the main campus's sidewalks for persons with disabilities. This study's objectives are to understand the empathy college students without disabilities had on the need for suitable transportation services for students with disabilities and the perceived risks of the services' operation on sidewalks. The Bayesian ordered logit model and text mining analyzed 396 survey responses. The Bayesian ordered logistic regression results revealed that age, gender, and ethnicity are important factors that contribute to different opinions concerning perceived risks and sympathy brought by an autonomous shuttle operating on pedestrians' sidewalks. The text mining results revealed several patterns. While respondents who were against the operation focused on potential safety hazards and the crowdedness of the sidewalks, supporters focused on the expected improved mobility for people with disabilities. The findings from this study are expected to assist policymakers and vehicle manufacturers with pedestrian expectations and considerations related to risk and safety when sharing their walkways with the autonomous shuttle.

    • Accessibility to flexible transportation for persons with disabilities is currently a developing field. It can be very challenging for persons with disabilities, especially block-to-block movements when the distance is too long to walk and too short to drive. While persons without disabilities can choose whether to walk, bike, use scooters, or use skateboards over short distances, the disabled population is underserved in available transportation options[1,2]. Given the type of disability, persons with disabilities can be restricted to specific transportation modes such as walking or wheelchairs where infrastructure permits[3,4]. Public transportation is essential for most of this population[1,3,5]. Persons with disabilities have different transportation needs, even within the group. However, driver behavior is a common problem[6,7]. Fixed routes, public right of way, private taxicabs, flex service, and other nontraditional transit services are the primary ways transportation barriers in public transit can occur[8]. Barriers to transportation among persons with disabilities create a transportation inequality problem between persons with disabilities and those without disabilities.

      Autonomous vehicle technology can address the existing transportation barriers by expanding transportation options among persons with disabilities[1]. The new technology provides room to improve transportation services among persons with disabilities because it can promote transportation justice by providing door-to-door transportation services[911]. It will also increase transportation independence among persons with disabilities[12]. However, how traditional transportation mediums and individuals would interact with autonomous vehicles is unknown. Specifically, how active transportation will perceive, interact, and behave with autonomous vehicles remains nebulous.

      This study, therefore, intends to narrow the literature gap on this issue. The study focuses on understanding college students' perception of the autonomous shuttles on the walkways. Specifically, the study intends to understand how students perceive the service to people with disabilities and perceived risk when sharing the walkway with the shuttle. It is hypothesized that direct interaction with the shuttle would make a difference in terms of the risk but not in the service rendered by the shuttle. Several demographic factors are also considered for upscaled shuttle operations on other campuses. The study findings are expected to open opportunities for more testing of the service on other campuses to improve the movements of people with disabilities within campuses.

      The remainder of the manuscript is arranged as follows: The literature review summarizing previous work on the perception of autonomous vehicle adoption, their acceptance by people with disabilities, and factors that increased positive perception towards adopting autonomous technology. Next is the description of the material and methods used in achieving the study's objective, in which the data description and analytical analysis are explained. It is followed by a results and discussion section whereby a summary of results from the analysis is performed; namely, the Bayesian ordered logit model and the text network analysis are presented. A detailed discussion of the results and their interpretation is also presented. The conclusion section concludes and summarizes the main observation of the study and also documents some study limitations, and highlights areas for future research. Lastly, the data availability statement and list of references are presented.

    • Due to its benefits on the traffic stream, autonomous vehicle technology in the form of first/last mile shuttles is getting more attention from researchers and practitioners in providing mobility for persons with disabilities[13,14]. Post-alterations to the conventional vehicle are necessary for a person with disabilities to own an accessible vehicle privately. These alterations, in turn, increase the final price of the vehicle compared to unaltered. Associated low income among persons with travel-limiting disabilities might be an obstacle to owning these vehicles privately. Furthermore, no automobile manufacturer manufactures accessible vehicles for the disabled market massively[1]. Research shows that the technology will provide mobility solutions to persons with disabilities by giving door-to-door services that promote transportation justice[911]. Also, people with disabilities usually depend on other people's assistance. Autonomous vehicles are expected to increase their independence[12]. The needless driver in autonomous shuttles makes them suitable options for persons with disabilities[1,15]. Hence, reducing the driver's attitude problem is commonly reported to hinder the use of public transportation by persons with travel-limiting disabilities[6,7].

      Autonomous shuttles can address problems faced by persons with disabilities using public transportation services. For example, Mobility on Demand is a transportation service that is possible with autonomous shuttles[1618]. Comfort and increased independence are among a few benefits directly addressing the needs of persons with disabilities[11,19,20]. Literature shows that using autonomous vehicles to provide transportation services to persons with disabilities is getting some acceptance from persons with disabilities[13,14,21].

      A survey of people to study their willingness to use autonomous vehicles has been a widely used data collection tool in studying factors that impact people's perception and acceptance of autonomous vehicles[14,19,2124]. Research by Jinuk & Hwang[21] studied the perception of persons with disabilities on autonomous vehicles as a viable transportation option for mobility. It revealed that persons with disabilities were more accepting of autonomous vehicle transportation. More than 70% believed that autonomous vehicle transportation would solve the transportation problem faced by persons with disabilities and meet their travel needs[21]. In another study, about 15% of occasional public transit riders were willing to ride autonomous buses[14].

      Some preliminary evidence suggests variations in the public perception of autonomous vehicle technology. Payre et al. found a positive attitude toward adopting autonomous vehicles, whereas Haboucha et al. reported a great hesitation towards autonomous vehicle adoption. In the latter investigation, about 25% said they hesitated to travel with an autonomous vehicle even if the services were free[23,25]. Perceived usefulness, perceived safety risks, perceived ease of use, perceived private risks, initial trust, performance expectancy, users' enjoyment, and social influence are some factors that increased the positive attitude toward automated vehicles[24,2628]. A study by Zhang et al. established that the initial trust is enhanced by improving the perceived usefulness and reducing the perceived safety risks. However, people with disabilities were not considered in most of these studies[28].

      Furthermore, a significant number of the existing studies depend on the perceived perception of people who, in one way or another, have limited or absent experience with autonomous vehicles[23]. However, even for the few studies that investigate the interaction of pedestrians and AVs, they do so by testing an AV operating on the roadway; thus, the interaction studied is that when the pedestrian is crossing the road and not on any other areas such as pedestrian walkways[29]. There is a significant research gap evaluating a large group of non-users. Additionally, to the authors' knowledge, none of the previous studies have assessed the interaction of autonomous shuttles with pedestrians on pedestrian walkways. Due to the block-to-block type of transportation services to persons with disabilities, interaction with pedestrians is highly expected and unavoidable. Understanding how the public sympathizes with people with disabilities concerning the need for suitable and effective transportation, the usefulness of these shuttles', safety, comfort, and other factors is a critical research need to advance the technology. This research aimed to close the existing gap by analyzing people's perceptions of the usefulness and safety of the autonomous shuttle with an actual interaction with the shuttle. It also bridges the existing gap on the usefulness of the shuttle services for people with disabilities.

      Consideration of AVs for people with disabilities in campus settings is challenging. While the public might not be willing to share the sidewalk with AVs, their feelings towards the improved mobilities for people with disabilities may change their stand. However, to this point, scarce studies that evaluated such a possibility are available. Furthermore, reasons for people's perceptions of AV operations may differ significantly. With such a great variation, predefined responses make it difficult to capture many reasons. This scenario makes the case for the application of open-ended responses. The next section presents the materials and methods applied in this study.

    • This section presents the materials and methods used in this study. It covers data description, which shows how the data was collected, and analytical approaches, which show the applied methods to analyze the data.

    • This study used an observational survey conducted from November 1st to December 31st, 2019, among college students to understand their sympathy concerning the need for transportation services specifically for students with disabilities and to investigate the safety of the shuttle operating on pedestrian walkways. This shuttle was designed by researchers from Pratt and Miller Engineering, Western Michigan University (WMU), Comet Mobility, the University of Michigan, Easterseals, and Kevadiya (WMU, 2019). It specifically operated on pedestrian walkways to provide transportation services for students with disabilities from the campus's main bus stop to different classroom blocks. It ran on campus for 11 d from October 21st to November 1st, 2019. The survey collected perceptions from two groups of pedestrians. One group interacted with the shuttle, and the other did not interact with the shuttle.

      Since the shuttle operated on the WMU campus, only WMU students/members could participate in this study. The consistency within interaction and exposure of AV among participants allowed for a single perception assessment survey and legitimate aggregations and comparisons of perceptions. The survey was in English, and the team shared a blind link with participants via email. All participants must complete the survey individually and avoid undue coercion; no identifying information was collected. Participants were supposed to select either of the following responses: not at all, a little, a moderate amount, a lot, and a great deal.

      How do you compare the risk posed by an autonomous shuttle operating on a pedestrian walkway to that of a bicycle?

      How much sympathy did you feel for students with accessibility needs on campus who used this autonomous vehicle service?

      Further, respondents were supposed to rank their perceived risk of AV.

      On a scale of 1−5, where one represents not at all and five represents very high, what level of safety risk does an autonomous vehicle on pedestrian walkways on campus pose to you?

      In addition to the age, gender, and ethnicity of participants, respondents were also provided with a section to express their open-ended views. The question stated that.

      Please share your thoughts on how you feel regarding potentially having a fleet of such autonomous vehicles operating on campus.

    • The Bayesian Ordered Logit Model and Test Network Analysis (TNA) were used to quantify how different demographic factors impact respondents' likelihood of perceptions and perceptions of sympathy and risk related to using autonomous shuttles on campus for students with disabilities.

    • Due to the limited time of data collection, the number of responses collected was relatively low (N = 396), which, upon further cleaning, declined to N = 310. With such a small sample size, Bayesian analysis performs better than traditional frequentist analysis[30,31]. Thus, this study applied a Bayesian approach to analyze the collected data.

      Further, due to the ordinal nature of the responses collected, an ordered logistic regression was performed to investigate factors associated with the differences in the likelihood of pedestrians' perceptions[32]. For an ordinal outcome variable with N number of categories of the ordinal dependent variable, the generalized ordered logistic model is expressed as Eqn (1);

      P(Yi>j)=exp(αj+Xiβj)1+[exp(αj+Xiβj)],j=1,2,3,...N1 (1)

      The probability that Y will fall under any of the values 1 to N is given by Eqns (2)−(4):

      P(Yi=1)=1g(Xiβj) (2)
      P(Yi=j)=g(Xiβj1)g(Xiβj),j=2,3,...N1 (3)
      P(Yi=1)g(XiβN1) (4)

      In the Bayesian approach, priors must consider what is already known. Since no study has analyzed similar data to answer the questions, weakly informative priors (Normal (0,10)) were used[33]. The analysis was performed in the R environment using the brms package[34]. The analysis was performed in four chains with 200 iterations during warm-up and 4000 iterations post-warm-up.

      The results are interpreted based on the estimates and credible intervals. Positive estimates are associated with higher ranking, while the opposite is true for negative estimates. Credible intervals are used to determine the credibility of the results[33,35].

      In addition to the Bayesian Ordered Logit model, the open-ended responses provided an opportunity to understand why students either support or oppose the operation of autonomous shuttles.

    • Open-ended responses were used to understand the reasons for supporting or opposing the autonomous shuttle's operation. The TNA utilized nodes and arcs to expose the hidden pattern of keywords and connections among them[3638]. Figure 1 presents a typical structure of the text network. The nodes represent keywords in this figure, while the links indicate co-occurrence. The distance between two nodes corresponds to the distance between keywords in the open-ended response. Keywords that appear next to each other are called collocated keywords and provide richer insights than co-occurring or single keywords. Furthermore, several keywords with similar themes are grouped to form a community[39,40].

      Figure 1. 

      A typical example of a text network.

      Creating a network requires three main processes: normalization, transformation, and mapping. Normalization involves formatting responses to lower cases, removing special characters, and connecting words. Transformation covers changing the unstructured to structured data. In this process, the open-response text is converted into matrices of keywords with their associated frequencies. Lastly, the keywords are mapped. In this stage, the keywords are mapped from the matrices created in the previous stage[38,40,41].

      The text network results can be interpreted based on keyword frequency, co-occurred frequency, collocated frequency, degree, centrality, and betweenness centrality, among other factors. However, keyword frequency and collocated keywords are used[36,39]. Only the top 50 most frequent keywords are mapped for computation time and power for analysis.

    • This section presents the results and discussion of the analyses conducted. These include descriptive statistics that provide a general picture of response distribution, the MWU test results, and the Bayesian ordered logistics results.

    • Three hundred ninety-six pedestrians responded to the question asked, of which 148 (37.4%) identified as males and 111 (28%) as females. In addition, about 61.9% of the respondents were pedestrians aged 18−26 years, and 49% were Caucasians. The number of respondents for each question differed depending on the type of questions asked. About 47.2% (187 pedestrians) responded to the question about their sympathy toward using autonomous shuttle services for students with disabilities, and 310 pedestrians (78.3%) responded to the question about the perceived risk of the AV shuttle operating on the sidewalk compared to bicycles—moreover, the question related to the perceived risk of AV shuttles to pedestrians. Table 1 shows the rich demographic distribution of the participants.

      Table 1.  Descriptive analysis results.

      Variable Category Sympathy
      (N = 187)
      Risk to pedestrian
      (N = 310)
      Risk (shuttle vs bicycle
      (N = 310)
      Gender Male 103 146 146
      Female 69 111 111
      Didn't respond 15 53 53
      Ethnicity Caucasian 133 192 192
      Others 38 63 63
      Didn't respond 16 55 55
      Age 18–26 years 174 244 244
      Others 10 34 34
      Didn't respond 3 32 32

      Further, the influence of the interaction with the shuttle was also evaluated in terms of sympathy and risk. Among the respondents, 214 (54%) interacted with the shuttle. Figure 2 shows the distribution of sympathy ratings and ratings by shuttle interaction. It can be observed that respondents who interacted with the shuttle showed a high level of sympathy for people with disabilities, as indicated by the size of the 'a great deal' and 'a lot' categories of sympathy. Further, a relatively large number of respondents who felt either a lot of sympathy or a great deal felt that operating the shuttle was risky to pedestrians. Furthermore, people who felt lower risk levels to pedestrians also showed either moderately lower or much lower risk of the shuttle on the sidewalk compared to the bicycle.

      Figure 2. 

      Ratings of the sympathy and ratings by shuttle interaction.

    • Bayesian Ordered Logistic regression was performed for each question against explanatory variables, as presented in Table 2. For analysis purposes, gender, age, interaction with the autonomous vehicle, and ethnicity were used as binary independent variables. A reference group was created and used for each independent variable. Each survey response was treated as a dependent variable.

      Table 2.  Bayesian ordered regression model results.

      VariableEstimateOREst.
      Error
      [95% CI]EstimateOREst.
      Error
      [95% CI]EstimateOREst.
      Error
      [95% CI]
      SympathyRisk to pedestrianRisk (shuttle vs bicycle)
      Gender
      Female
      Male−0.530.590.29−1.10.04−0.450.640.23−0.91−0.01−0.410.660.23−0.870.05
      Age group (years)
      18–25
      > 25−1.590.200.82−3.28−0.040.111.120.39−0.650.880.421.520.41−0.361.24
      Ethnicity
      Caucasian
      Non-Caucasian0.72.010.350.031.39−0.560.570.28−1.13−0.02−0.540.580.27−1.07−0.01
      Model summary
      /cut1−3.370.030.89−5.15−1.66−0.960.380.43−1.8−0.11−1.730.180.46−2.64−0.82
      /cut2−2.590.080.89−4.4−0.890.421.520.43−0.411.27−0.190.830.45−1.050.7
      /cut3−1.410.240.88−3.190.271.494.440.440.652.371.022.770.450.151.92
      /cut4−0.130.880.87−1.891.542.5813.200.511.63.592.8817.810.521.893.97
      CI = Credible interval, OR = Odds Ratio, Est Error = Estimated error.

      Table 2 presents factors that influence the differences in pedestrian perceptions of the attributes of autonomous shuttles. The 95% credible interval was considered in this study. Other variables were added to the table for comparison purposes.

      Results show that gender, age, and ethnicity are important factors contributing to differences in perceptions of the operation of the autonomous shuttle for people with disabilities in the three independent variables studied, specifically the importance of the AV shuttle to students with disabilities, the perceived risk of sidewalk operation of an autonomous shuttle on a pedestrian, and risk comparison between an autonomous shuttle and a bicycle on a sidewalk. It was revealed that while ethnicity was important in explaining the differences in perceptions of the three studied categories, gender, and age were significant in only one of the three independent variables.

      Gender was a significant factor in the perceived risk of autonomous shuttles, and results show that males are 36% less likely than females to perceive high risks of autonomous shuttles on pedestrians. Although gender was not a significant factor at a 95% credible interval on the usefulness of the autonomous, results indicate that male pedestrians are 41% less likely than female pedestrians to perceive the autonomous shuttle as useful among students with a disability. Males are also 37% less likely than females to perceive higher autonomous shuttle risks than bicyclists operating on sidewalks.

      Further, the study revealed that while age is not a significant factor in perceptions of risks of autonomous vehicles to pedestrians, gender and ethnicity were. Results show that male pedestrians were 36% less likely than females to perceive higher risks to pedestrians by an autonomous shuttle operating on sidewalks. In addition, non-Caucasian pedestrians are 43% less likely than Caucasians to perceive higher risks to pedestrians by an autonomous shuttle operating on sidewalks.

      Regarding the perceived risks imposed by an autonomous shuttle to risks imposed by a bicycle operating on a sidewalk, results revealed that gender and ethnicity were the only determinant factors. Specifically, it was found that male pedestrians were 34% less likely to perceive higher risks of autonomous shuttles compared to bicycles than female pedestrians. It was also revealed that Caucasian pedestrians have lower odds (42% less likely) of perceiving higher risks of autonomous shuttles compared to bicycles than other ethnicities.

      Similar results were also observed in the previous studies[14,20,22,42,43]. A survey by Hulse et al. revealed that age was among the factors associated with differences in people's perceptions. In their study, young adults accepted significantly autonomous cars[14,20]. A study by Battistini et al., who investigated contributing factors in autonomous shuttles (AS) for tourist purposes, revealed that gender and age were significant factors in users' perceptions of using the shuttle as a daily commute. Specifically, age was a significant factor in users' perceptions of using the shuttle as a daily commute; however, it was not an important factor in using the shuttle as tourism[22]. Further, a survey conducted among residents of the State of Qatar on the safety concerns of autonomous vehicles revealed that, compared to Arabs, non-Arabs reported higher concerns[43]. However, these studies did not focus on the perceived use of autonomous vehicles by people with disabilities.

      The regression results provided the association between various aspects of autonomous shuttle operations on campus to provide services to students with disabilities. However, the results from open-ended questions were deemed necessary to understand the insights from the actual discussions. The next section presents the text network results.

    • The text network results cover the overall perceived risks for pedestrians, perceived risks comparable to bicycles, and the sympathy for the people with disabilities who utilized the autonomous shuttle. Respondents with a scale of 4 and 5 were considered risky for the overall perceived risk to pedestrians, while the rest considered the autonomous shuttle as not risky. Considering the sympathy level, 'a great deal' and 'a lot' were considered high, while 'a little' and 'not' was considered low. Further, compared with bicycles, 'much' and 'moderately higher' were considered risky.

    • Figure 3 presents the text network for responses to the perceived risk to pedestrians. According to the networks, a relatively small number of people perceived that the AVs are risky to pedestrians, as indicated by the denseness of the network. The network for the respondents who feel that the AV is dangerous to pedestrians focused on multiple issues, as indicated by the co-located and co-occurring keywords. The accessibility issue is one of the main focus points for this group. They perceived that operating AVs on walkways would solve accessibility issues for people with disabilities, but they did not feel safe interacting with them. The typical response stated: 'If it helps students with disabilities and accessibility issues, then it should be implemented for that only. They must be responsibly monitored and controlled to make it safe'. Previous studies have reported similar findings regarding AV interactions with pedestrians[44]. However, such studies did not involve people with disabilities.

      Figure 3. 

      Text networks and collocated keywords for perceived risk to pedestrians. (a) Text network for AV as risky to pedestrians, (b) collocated keywords for AV as risky to pedestrians, (c) text Network for AV as not risky to pedestrians, (d) collocated keywords for AV as not risky to pedestrians.

      Furthermore, other respondents compared the AVs operating against the golf carts as indicated by the keywords golf carts. Respondents feel that the AV won't be any better than golf carts, "…I do not see the advantage of using autonomous vehicles over golf carts, though. Wouldn't golf carts be cheaper? And doesn't the autonomous vehicle require a person to be able to operate it?...". Other respondents showed concerns that, as it stands, the walkways are already crowded with other fleets, which makes operating AV more crowding the sidewalks: "Campus pathways are already crowded enough without a fleet of bulky, slow, ugly, and sidewalk-obscuring vehicles."

      On the other hand, people who perceived it as not risky to pedestrians thought it was a great idea, especially for students with disabilities. Most comments pointed toward their greatness to disabled people but cautioned on their operations. Some people talked about hitting pedestrians. A typical response states: 'I think it would be a good idea given they stop if someone is standing in the way or at least slow down as not to hit them. I think it's a great idea for students with disabilities' and 'I don't mind them, but it would make bikes have to pass them and possibly hit a pedestrian'. Others had issues with the number of AVs operating, as indicated by the keyword fleet in Fig. 3c. One of the associated comments stated: 'Depending on the size of 'a fleet', I'd say the realistic risk is that a student may be looking at their phone and not notice a vehicle after turning a corner'.

    • Figure 4 shows the text network for comparable risks of AV to bicycles on the sidewalks. People who feel that AVs are riskier pointed to the crowd-ness of the walkways, arguing that additional fleets of AVs will make things worse. For example, '…Campus sidewalks are already overcrowded with current construction projects claim some pathways and alternate routes to buildings...'. Others thought adding a fleet would increase tuition, which is a waste of money. For example, '…I don't think these vehicles are of good interest or good for money being spent on the vehicles. These will cause the tuition to increase even more and are not needed'.

      Figure 4. 

      Text networks and collocated keywords for perceived risk of AV compared to bicycles. (a) Text network for AV as risky compared to bicycles, (b) collocated keywords for AV were found to be risky compared to bicycles, (c) text network for AV is not risky compared to bicycles, (d) collocated keywords for AV are not risky compared to bicycles.

      On the contrary, people who support the idea think it is great for disabled people and doesn't have much impact compared to a bicycle. The keyword sidewalk is the main topic in Fig. 4c since the discussion concerns the sidewalks. At least ten people mentioned sidewalks in their responses. Some pointed to already crowded sidewalks, others to the people's behavior on sidewalks. There is also a comparison between AVs and golf carts: '…I also think having a fleet of autonomous vehicles would not be more dangerous than having a fleet of golf carts and maybe less dangerous than bicyclists on the sidewalk…'. A sample of comments that showed the greatness of the shuttles stated: 'Great for accessibility and convenience for disabled students, curious to see how it affects bicycle traffic more than foot traffic', and '…The bikers on campus are terrible, I've almost been hit three times this semester'.

    • Lastly, Fig. 5 presents the text networks of the sympathy level for people with disabilities. According to respondents with a high level of sympathy for people with disabilities (Fig.5a & b), operating an AV on the sidewalk is fine as long as it doesn't hit pedestrians. The fleet doesn't pose much safety risk as indicated by the keyword pose, much, and risk. A typical statement states: '…… What I've seen it's not too fast and poses little risk to pedestrians. And it is only a little annoying to walk around if it's blocking your path to class (but not a big deal)'. Some would be happy to see these fleets: 'I would be happy to see a fleet of autonomous vehicles'. However, others cautioned about the possible risks posed by AV operations, although they think it is a good idea for disabled people.

      Figure 5. 

      Text networks and collocated keywords for perceived sympathy level. (a) Text network for high sympathy level, (b) top collocated keywords for high sympathy level, (c) text network for low sympathy level, (d) top collocated keywords for low sympathy level.

      Furthermore, although some people showed low sympathy levels (Fig. 5c & d), they still think that it is a great idea that would benefit people with disabilities. Responses such as: 'I wouldn't mind if it helped people who needed it to get to class' signify such a sentiment. However, they warn about pedestrian obstruction, as indicated in one of the responses: 'If they don't obstruct pedestrians from walking, it is a valid idea'.

    • This paper analyzed pedestrians' perceptions of the safety risks of an autonomous shuttle operating on the WMU campus' pedestrian walkways. It leverages perceptual data towards autonomous shuttles to elucidate how using autonomous technology to solve mobility challenges can create safety concerns for other individuals not directly benefiting from the technology. Results show that actual interaction with the shuttle, age, ethnicity, and gender are significant factors affecting the pedestrian perception of the shuttle impacts. In summary, the results revealed the following.

      • Compared to females, males are 41% less likely to perceive higher sympathy towards using autonomous shuttles for students with disabilities.

      • Younger pedestrians are 78% less likely than adult pedestrians to perceive the shuttle as more important to students with disabilities.

      • Caucasians are two times more likely than other ethnicities to perceive higher levels of importance of the shuttle to students with disabilities.

      • Male pedestrians were 36% less likely than females to perceive higher-risk pedestrians by an autonomous shuttle operating on sidewalks.

      • Caucasian pedestrians were 43% less likely than other races to perceive higher risks to pedestrians by an autonomous shuttle operating on sidewalks.

      • Male pedestrians were 34% less likely than female pedestrians to perceive higher risks of autonomous shuttles compared to bicycles.

      • Caucasian pedestrians were 42% less likely than other ethnicities to perceive higher risks of autonomous shuttles than bicycles.

      On the other hand, the text mining results showed several reasons for accepting or rejecting the operation of the autonomous shuttle on the sidewalks. Safety and inconvenience were among the key attributes. Further, respondents showed that the sidewalks are already crowded, which means the operations of autonomous shuttles will complicate sidewalk accessibility even more.

      Results from this research can be used to understand the pedestrian perception of autonomous vehicle operation. It addresses the non-user gap in the body of knowledge. In addition, it highlights the potential of these services to bring about transportation equity to people with disability specifically in providing end-mile transportation services (transportation on a distance that is too short to drive but too far to walk by a person with a disability). The findings from this investigation are expected to assist policymakers and vehicle manufacturers with pedestrian expectations and considerations related to risk and safety when sharing their walkways with the shuttle. Given that the study was performed on a college campus, the results presented here will also provide the impetus for further exploration of using pedestrian walkways on large campuses for autonomous vehicles to support student accessibility needs. A clear understanding of the associated risks of these types of shuttles paves the way to mobility provision to persons with disabilities for block-to-block movements.

      Lastly, given the design of this study, causality cannot be ascertained due to a lack of experimental control. However, the uniqueness of deploying an actual autonomous shuttle and capturing non-users perceptions lends high ecological and external validity to the results presented in this study. These psychological investigations are typically only in controlled environments that compromise generalizability; thus, the authors collected data from a large and diverse sample of participants. Nevertheless, future research should seek to cross-validate the results reported in this study through controlled experimentations with high internal validity. Further, since the current research focused on the university campus, additional research is needed on using pedestrian walkways in other areas for autonomous shuttles to provide block-to-block mobility to persons with travel-limiting disabilities.

    • The authors confirm their contribution to the paper as follows: study conception and design: Lyimo SM, Kwigizile V, Asher ZD; data collection: Lyimo SM; analysis and interpretation of results: Lyimo SM, Kutela B, Kwigizile V; draft manuscript preparation: Lyimo SM, Kutela B, Kwigizile V. All authors reviewed the results and approved the final version of the manuscript.

    • The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

    • The author wishes to acknowledge the contribution of Johan Fanas Rojas, PhD, and his 2018 Michigan Mobility Challenge team in making this study possible.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2024 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (5)  Table (2) References (44)
  • About this article
    Cite this article
    Lyimo SM, Kwigizile V, Kutela B, Asher ZD. 2024. Understanding perceptions of college students on the operation of automated shuttle for persons with disabilities on campus walkways. Digital Transportation and Safety 3(2): 36−45 doi: 10.48130/dts-0024-0004
    Lyimo SM, Kwigizile V, Kutela B, Asher ZD. 2024. Understanding perceptions of college students on the operation of automated shuttle for persons with disabilities on campus walkways. Digital Transportation and Safety 3(2): 36−45 doi: 10.48130/dts-0024-0004

Catalog

  • About this article

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return