Search
2025 Volume 5
Article Contents
REVIEW   Open Access    

Advances in the biosynthesis, gene mining, and molecular mechanisms of cucurbitacin in Cucurbitaceae crops

More Information
  • Received: 11 July 2024
    Revised: 25 October 2024
    Accepted: 03 December 2024
    Published online: 09 January 2025
    Vegetable Research  5 Article number: e001 (2025)  |  Cite this article
  • Cucurbitacin, a highly oxidized tetracyclic triterpenoid compound, is a common secondary metabolite in Cucurbitaceae crops. Its presence imparts a bitterness to the fruit, significantly reducing its quality. However, the accumulation of cucurbitacin enhances the plants resistance to pests and diseases, earning it the reputation of a 'green pesticide'. In recent years, cucurbitacin has attracted extensive attention from researchers. Therefore, this review summarizes the identification, gene mapping, and marker development, biosynthesis and regulation, transport mechanisms, and the domestication of non-bitter Cucurbitaceae varieties. Additionally, it provides insights into the breeding of Cucurbitaceae crops and the in vitro biosynthesis of cucurbitacin.
  • 加载中
  • [1] Schaefer H, Heibl C, Renner SS. 2009. Gourds afloat: a dated phylogeny reveals an Asian origin of the gourd family (Cucurbitaceae) and numerous oversea dispersal events. Proceedings of the Royal Society B: Biological Sciences 276(1658):843−851 doi: 10.1098/rspb.2008.1447

    CrossRef   Google Scholar

    [2] Wu X, Wu X, Wang Y, Wang B, Lu Z, et al. 2019. Molecular genetic mapping of two complementary genes underpinning fruit bitterness in the bottle gourd (Lagenaria siceraria [Mol.] Standl.). Frontiers in Plant Science 10:1493 doi: 10.3389/fpls.2019.01493

    CrossRef   Google Scholar

    [3] Yang SJ, Choi JM, Park SE, Rhee EJ, Lee WY, et al. 2015. Preventive effects of bitter melon (Momordica charantia) against insulin resistance and diabetes are associated with the inhibition of NF-κB and JNK pathways in high-fat-fed OLETF rats. The Journal of Nutritional Biochemistry 26(3):234−40 doi: 10.1016/j.jnutbio.2014.10.010

    CrossRef   Google Scholar

    [4] Raina K, Kumar D, Agarwal R. 2016. Promise of bitter melon (Momordica charantia) bioactives in cancer prevention and therapy. Seminars in Cancer Biology 40:116−29 doi: 10.1016/j.semcancer.2016.07.002

    CrossRef   Google Scholar

    [5] Wang J. 2009. Study on extraction, purification, structure, and antioxidant properties of evodia alkaloids. Thesis. Huazhong Agricultural University, China
    [6] Meng Y, Fan Z, Zhai C, Li M, Wang L. 2012. Study on the enrichment of bitter compounds, flavonoids, and polysaccharides in orange peel. Heilongjiang Science and Technology Information 2012:34

    Google Scholar

    [7] Ma Y. 2017. Biosynthesis, regulation, and transport mechanism of cucurbitacins in cucumber. Thesis. Chinese Academy of Agricultural Sciences, China
    [8] Zhang S, Miao H, Cheng Z, Liu M, Zhang Z, et al. 2011. Genetic mapping of the fruit bitterness gene Bt in cucumber (Cucumis sativus L.). Acta Horticulturae Sinica 38(04):709−16

    Google Scholar

    [9] Li M, Gong Y Q, Miao H, Chen W, Sun C, et al. 2010. Mapping of the Bi gene for bitterness in cucumber vegetative parts. Acta Horticulturae Sinica 37(07):1073−78

    Google Scholar

    [10] Zhang S, Miao H, Sun R, Wang X, Huang S, et al. 2013. Localization of a new gene for bitterness in cucumber. Journal of Heredity 104(1):134−39 doi: 10.1093/jhered/ess075

    CrossRef   Google Scholar

    [11] Enslin PR, Hugo JM, Norton KB, Rivett DEA. 1960. Bitter principles of the cucurbitaceae. Part IX. Cucurbitacin A. Journal of the Chemical Society 4779−87 doi: 10.1039/JR9600004779

    CrossRef   Google Scholar

    [12] Thimmappa R, Geisler K, Louveau T, O'Maille P, Osbourn A. 2014. Triterpene biosynthesis in plants. Annual Review of Plant Biology 65(1):225−57 doi: 10.1146/annurev-arplant-050312-120229

    CrossRef   Google Scholar

    [13] Piao X, Gao F, Zhu J, Wang L, Zhao X, et al. 2018. Cucurbitacin B inhibits tumor angiogenesis by triggering the mitochondrial signaling pathway in endothelial cells. International Journal of Molecular Medicine 42(2):1018−25 doi: 10.3892/ijmm.2018.3647

    CrossRef   Google Scholar

    [14] Luan F, Cao H, Gao P, Liu S, Liu S, et al. 2023. Changes of watermelon cucurbitin E and its related gene correlation analysis. Journal of Northeast Agricultural University 4:25−37,54

    Google Scholar

    [15] Li Q, Luo F, Wang C, Luo L, Zhang W. 2020. Research progress on cucurbitacins, the bitter compounds in cucurbit crops. Journal of Plant Physiology 56(06):1137−45

    Google Scholar

    [16] Rice CA, Rymal KS, Chambliss OL, Johnson FA. 1981. Chromatographic and mass spectral analysis of cucurbitacins of three Cucumis sativus cultivars. Journal of Agricultural and Food Chemistry 29(1):194−96 doi: 10.1021/jf00103a051

    CrossRef   Google Scholar

    [17] Andeweg JM, De Bruyn JW. 1959. Breeding of non-bitter cucumbers. Euphytica 8(1):13−20 doi: 10.1007/BF00022084

    CrossRef   Google Scholar

    [18] Wu J, Zhao H. 2010. Determination of cucurbitacin B content in melon stems by high-performance liquid chromatography. Chemistry and Bioengineering 27(01):92−94

    Google Scholar

    [19] Zhou Y, Ma Y, Zeng J, Duan L, Xue X, et al. 2016. Convergence and divergence of bitterness biosynthesis and regulation in Cucurbitaceae. Nature Plants 2(12):16183 doi: 10.1038/nplants.2016.183

    CrossRef   Google Scholar

    [20] Lavie D, Willner D, Merenlender Z. 1964. Constituents of Citrullus colocynthis (L.) Schrad. Phytochemistry 3(1):51−56 doi: 10.1016/S0031-9422(00)83994-1

    CrossRef   Google Scholar

    [21] Gamlath CB, Gunatilaka AAL, Alvi KA, Atta-ur-Rahman, Balasubramaniam S. 1988. Cucurbitacins of Colocynthis vulgaris. Phytochemistry 27(10):3225−29 doi: 10.1016/0031-9422(88)80031-1

    CrossRef   Google Scholar

    [22] Davidovich-Rikanati R, Shalev L, Baranes N, Meir A, Itkin M, et al. 2015. Recombinant yeast as a functional tool for understanding bitterness and cucurbitacin biosynthesis in watermelon (Citrullus spp.). Yeast 32(1):103−14 doi: 10.1002/yea.3049

    CrossRef   Google Scholar

    [23] Martin PAW, Schroder RFW. 2000. The effect of cucurbitacin E glycoside, a feeding stimulant for corn rootworm, on biocontrol fungi: beauveria bassiana and Metarhizium anisopliae. Biocontrol Science and Technology 10(3):315−20 doi: 10.1080/09583150050044583

    CrossRef   Google Scholar

    [24] Martin PAW, Blackburnsmall M, Schroder RFW, Matsuo K, Li BW. 2002. Stabilization of cucurbitacin E-glycoside, a feeding stimulant for diabroticite beetles, extracted from bitter Hawkesbury watermelon. Journal of Insect Science 2(1):19 doi: 10.1093/jis/2.1.19

    CrossRef   Google Scholar

    [25] Kim YC, Choi D, Zhang C, Liu HF, Lee S. 2018. Profiling cucurbitacins from diverse watermelons (Citrullus spp.). Horticulture, Environment, and Biotechnology 59(4):557−66 doi: 10.1007/s13580-018-0066-3

    CrossRef   Google Scholar

    [26] Kumbhalkar BB, Rajopadhye AA, Upadhye AS. 2013. Standardization of family Cucurbitaceae. Current Science 104(12):1595−96

    Google Scholar

    [27] Deng Y, Liu G, Zhang H, Zhou P, Tang X, et al. 2024. Effects of wall materials on the physicochemical properties of spray-dried bitter gourd (Momordica charantia L.) powders. NPJ Science of Food 8(1):37 doi: 10.1038/s41538-024-00278-7

    CrossRef   Google Scholar

    [28] Zhao G. 2015. Study on the chemical constituents and biological activities of bitter melon seeds and physalis. Thesis. Kunming University of Science and Technology, China
    [29] He L. 2007. Study on the chemical constituents of the bitter zucchini TIAN fruit. Thesis. Jilin University, China
    [30] Li L, Ma C, Ying Q, Wang Y. 2007. Preliminary report on the cultivation physiology of bitter bottle gourd. Anhui Agricultural Science Bulletin 2007:98−99,113

    Google Scholar

    [31] Sew CC, Zaini NAM, Anwar F, Hamid AA, Saari N. 2010. Nutritionatiantianl composition and oil fatty acids of kundur [Benincasa hispida (Thunb.) Cogn.] seed. Pakistan Journal of Botany 42(5):3247−55

    Google Scholar

    [32] Zhao G, Wang M, Luo C, Li J, Gong H, et al. 2022. Metabolome and transcriptome analyses of cucurbitacin biosynthesis in Luffa (Luffa acutangula). Frontiers in Plant Science 13:886870 doi: 10.3389/fpls.2022.886870

    CrossRef   Google Scholar

    [33] Venkatesh J, Song K, Lee JH, Kwon JK, Kang BC. 2018. Development of Bi gene-based SNP markers for genotyping for bitter-free cucumber lines. Horticulture, Environment, and Biotechnology 59:231−38 doi: 10.1007/s13580-018-0029-8

    CrossRef   Google Scholar

    [34] Shang Y, Ma Y, Zhou Y, Zhang H, Duan L, et al. 2014. Biosynthesis, regulation, and domestication of bitterness in cucumber. Science 346(6213):1084−88 doi: 10.1126/science.1259215

    CrossRef   Google Scholar

    [35] Wehner TC, Liu JS, Staub JE. 1998. Two-gene interaction and linkage for bitterfree foliage in cucumber. Journal of the American Society for Horticultural Science 123(3):401−03 doi: 10.21273/JASHS.123.3.401

    CrossRef   Google Scholar

    [36] Li Z, Qin Z, Zhou X, Xin M. 2015. Genetic analysis and molecular markers of bitterness in cucumber fruit. Molecular Plant Breeding 13(07):1578−83 doi: 10.13271/j.mpb.013.001578

    CrossRef   Google Scholar

    [37] Walters SA, Shetty NV, Wehner TC. 2001. Segregation and linkage of several genes in cucumber. Journal of the American Society for Horticultural Science 126(4):442−50 doi: 10.21273/JASHS.126.4.442

    CrossRef   Google Scholar

    [38] Gu X, Zhang S, Guo Y, Xu C. 2004. Genetic analysis of bitterness in cucumber. Acta Horticulturae Sinica 5:613−16 doi: 10.16420/j.issn.0513-353x.2004.05.011

    CrossRef   Google Scholar

    [39] Gu X, Zhang S, Chi X. 2005. Inheritance and linkage relationships among the genes of leaf mutant andbitterness with other five major genes in cucumber. Acta Horticulturae Sinica 1:108−10

    Google Scholar

    [40] Cowen NM, Heisel DB. 1983. Inheritance of two genes for spine color and linkages in a cucumber cross. Journal of Heredity 74(4):308−09 doi: 10.1093/oxfordjournals.jhered.a109796

    CrossRef   Google Scholar

    [41] Miao H, Zhang S, Wang X, Zhang Z, Li M, et al. 2011. A linkage map of cultivated cucumber (Cucumis sativus L.) with 248 microsatellite marker loci and seven genes for horticulturally important traits. Euphytica 182(2):167−76 doi: 10.1007/s10681-011-0410-5

    CrossRef   Google Scholar

    [42] Gu X. 2006. AFLP molecular marker for the Bt gene controlling bitterness in cucumber fruit. Acta Horticulturae Sinica 33:567−70

    Google Scholar

    [43] Ma D, Sun L, Gao S, Hu R, Liu M. 1996. Genetic study on bitterness in young melon fruits. Acta Horticulturae Sinica 3:49−52

    Google Scholar

    [44] Liu J P. 2012. Genetic inheritance of major traits and molecular markers in progeny from crosses between wild and cultivated melons. Thesis. Northeast Agricultural University, China
    [45] Shang J, Kong S, Li N, Wang J, Zhou D, et al. 2020. Genetic mapping and localization of major QTL for bitterness in melon (Cucumis melo L.). Scientia Horticulturae 266:109286 doi: 10.1016/j.scienta.2020.109286

    CrossRef   Google Scholar

    [46] Pitrat M. 2002. Gene list for melon. Cucurbit Genetics Cooperative Report 25:76−79

    Google Scholar

    [47] Li N, Shang J, Zhou D, Li N, Wang J, et al. 2020. A presence-absence variation regulates fruit bitterness in melon (Cucumis melo L.). Journal of Plant Genetic Resources 21(02):377−85 doi: 10.13430/j.cnki.jpgr.20190625001

    CrossRef   Google Scholar

    [48] Lee CW, Janick J. 1978. Inheritance of seedling bitterness in Cucumis melo L. HortScience 13(2):193−94 doi: 10.21273/HORTSCI.13.2.193

    CrossRef   Google Scholar

    [49] Zhang H, Wang H, Zhou Z, He X. 2008. Genetic analysis of stem bitterness in melon. China Cucurbits and Vegetables 21:28−29 doi: 10.3969/j.issn.1673-2871.2008.04.009

    CrossRef   Google Scholar

    [50] Navot N, Sarfatti M, Zamir D. 1990. Linkage relationships of genes affecting bitterness and flesh color in watermelon. Journal of Heredity 81:162−65 doi: 10.1093/oxfordjournals.jhered.a110952

    CrossRef   Google Scholar

    [51] Guner N, Wehner TC. 2003. Gene list for watermelon. Cucurbit Genetics Cooperative Report 26:76−92

    Google Scholar

    [52] Zhang Z, Zhang Y, Sun L, Qiu G, Sun Y, et al. 2018. Construction of a genetic map for Citrullus lanatus based on CAPS markers and mapping of three qualitative traits. Scientia Horticulturae 233:532−38 doi: 10.1016/j.scienta.2017.10.029

    CrossRef   Google Scholar

    [53] Li B, Lu X, Dou J, Aslam A, Gao L, et al. 2018. Construction of a high-density genetic map and mapping of fruit traits in watermelon (Citrullus Lanatus L.) based on whole-genome resequencing. International Journal of Molecular Sciences 19(10):3268 doi: 10.3390/ijms19103268

    CrossRef   Google Scholar

    [54] Li B. 2019. Construction of a high-density genetic map and fine mapping of candidate genes related to three fruit traits in watermelon. Thesis. Chinese Academy of Agricultural Sciences, China
    [55] Sun L, Wang X, Zhang Z, Cao P, Li Q, et al. 2019. Construction of a genetic linkage map and localization analysis of three traits in watermelon based on CAPS markers. China Cucurbits and Vegetables 32(08):227−28

    Google Scholar

    [56] Gong C, Li B, Anees M, Zhu H, Zhao S, et al. 2022. Fine mapping reveals that the bHLH gene Cla011508 regulates the bitterness of watermelon fruit. Scientia Horticulturae 292:110626 doi: 10.1016/j.scienta.2021.110626

    CrossRef   Google Scholar

    [57] Thakur MR, Choudhury B. 1966. Inheritance of some qualitative characters in Luffa species. Indian Journal of Genetics and Plant Breeding 26(1):79−86

    Google Scholar

    [58] Prakash K, Pandey A, Radhamani J, Bisht IS. 2013. Morphological variability in cultivated and wild species of Luffa (Cucurbitaceae) from India. Genetic Resources and Crop Evolution 60(8):2319−29 doi: 10.1007/s10722-013-9999-7

    CrossRef   Google Scholar

    [59] Rabei S, Rizk RM, Khedr AHA. 2013. Keys for and morphological character variation in some Egyptian cultivars of Cucurbitaceae. Genetic Resources and Crop Evolution 60(4):1353−64 doi: 10.1007/s10722-012-9924-5

    CrossRef   Google Scholar

    [60] Song B. 2008. Genetic analysis of interspecific hybrids between ribbed sponge gourd and common sponge gourd. Thesis. Nanjing Agricultural University, China
    [61] Qin Y. 2018. Mapping of the bitterness gene in sponge gourd fruits. Thesis. South China Agricultural University, China
    [62] Wu Z. 2017. Study on molecular markers of fruit bitterness in sponge gourd. Thesis. South China Agricultural University, China
    [63] Zhang G. 1981. Gene interaction and bitterness in bottle gourd. Acta Horticulturae Sinica 4:43−48

    Google Scholar

    [64] Borchers EA, Taylor RT. 1988. Inheritance of fruit bitterness in a cross of Cucurbita mixta × C. pepo. HortScience 23(3):603−04 doi: 10.21273/HORTSCI.23.3.603

    CrossRef   Google Scholar

    [65] Zhang G. 1981. Interaction of genes and the expression of bitterness in Lagenaria siceraria [Gourd]. Acta Horticulturae Sinica 8(4):77−82

    Google Scholar

    [66] Huang S, Li R, Zhang Z, Li L, Gu X, et al. 2009. The genome of the cucumber, Cucumis sativus L. Nature Genetics 41(12):1275−81 doi: 10.1038/ng.475

    CrossRef   Google Scholar

    [67] Zhang S, Miao H, Cheng Z Zhang Z, Wu J, et al. 2011. The insertion-deletion(Indel) marker linked to the fruit bitterness gene (Bt) in cucumber. Journal of Agricultural Biotechnology 19(04):649−53 doi: 10.3969/j.issn.1674-7968.2011.04.008

    CrossRef   Google Scholar

    [68] Zhang S. 2011. Genetic analysis and fine mapping of the bitterness gene in cucumber fruit. Thesis. Chinese Academy of Agricultural Sciences, China
    [69] Liu B, Guan X, Liang W, Chen J, Fang L, et al. 2018. Divergence and evolution of cotton bHLH proteins from diploid to allotetraploid. BMC Genomics 19:162 doi: 10.1186/s12864-018-4543-y

    CrossRef   Google Scholar

    [70] Li Q, Li H, Huang W, Xu Y, Zhou Q, et al. 2019. A chromosome-scale genome assembly of cucumber (Cucumis sativus L.). GigaScience 8(6):giz072 doi: 10.1093/gigascience/giz072

    CrossRef   Google Scholar

    [71] Li J, Luo X, Zhao P, Zeng Y. 2009. Post-modification enzymes in the biosynthesis of plant terpenoids. Acta Botanica Yunnanica 31(05):461−68

    Google Scholar

    [72] Osbourn A. 2010. Gene clusters for secondary metabolic pathways: an emerging theme in plant biology. Plant Physiology 154:531−35 doi: 10.1104/pp.110.161315

    CrossRef   Google Scholar

    [73] Hamberger B, Bak S. 2013. Plant P450s as versatile drivers for evolution of species-specific chemical diversity. Philosophical Transactions of the Royal Society B: Biological Sciences 368:20120426 doi: 10.1098/rstb.2012.0426

    CrossRef   Google Scholar

    [74] Fu J. 2018. Cloning and functional analysis of genes related to bitterness in melon and screening of related molecular markers. Thesis. Tianjin University, China
    [75] Luo F. 2020. Effects of different concentrations of CPPU on the synthesis of Cucurbitacin B, the bitter compound in thin-skinned melon. Thesis. Shenyang Agricultural University, China
    [76] Chen JC, Chiu MH, Nie RL, Cordell GA, Qiu SX. 2005. Cucurbitacins and cucurbitane glycosides: structures and biological activities. Natural Product Reports 22(3):386−99 doi: 10.1039/b418841c

    CrossRef   Google Scholar

    [77] Chen X. 2015. Bitter but tasty cucumber. National Science Review 2(2):129−30 doi: 10.1093/nsr/nwv018

    CrossRef   Google Scholar

    [78] Xu Y, Zhang H, Zhong Y, Jiang N, Zhong X, et al. 2022. Comparative genomics analysis of bHLH genes in cucurbits identifies a novel gene regulating cucurbitacin biosynthesis. Horticulture Research 9:uhac038 doi: 10.1093/hr/uhac038

    CrossRef   Google Scholar

    [79] Leng P, Zhao J. 2020. Transcription factors as molecular switches to regulate drought adaptation in maize. Theoretical and Applied Genetics 133:1455−65 doi: 10.1007/s00122-019-03494-y

    CrossRef   Google Scholar

    [80] Wang M, Jiang N, Xu Y, Chen X, Wang C, et al. 2024. CmBr confers fruit bitterness under CPPU treatment in melon. Plant Biotechnology Journal 22:2724−37 doi: 10.1111/pbi.14399

    CrossRef   Google Scholar

    [81] Zhong Y, Xue X, Liu Z, Ma Y, Zeng K, et al. 2017. Developmentally regulated glucosylation of bitter triterpenoid in cucumber by the UDP-glucosyltransferase UGT73AM3. Molecular Plant 10:1000−03 doi: 10.1016/j.molp.2017.02.005

    CrossRef   Google Scholar

    [82] Zhong Y, Xun W, Wang X, Tian S, Zhang Y, et al. 2022. Root-secreted bitter triterpene modulates the rhizosphere microbiota to improve plant fitness. Nature Plants 8(8):887−96 doi: 10.1038/s41477-022-01201-2

    CrossRef   Google Scholar

    [83] Shang Y, Huang S. 2015. Metabolic regulation and synthetic biology of bitter substances in cucumber. Life Sciences 27(08):1091−94 doi: 10.13376/j.cbls/2015150

    CrossRef   Google Scholar

  • Cite this article

    Chai Y, Sun Y. 2025. Advances in the biosynthesis, gene mining, and molecular mechanisms of cucurbitacin in Cucurbitaceae crops. Vegetable Research 5: e001 doi: 10.48130/vegres-0024-0039
    Chai Y, Sun Y. 2025. Advances in the biosynthesis, gene mining, and molecular mechanisms of cucurbitacin in Cucurbitaceae crops. Vegetable Research 5: e001 doi: 10.48130/vegres-0024-0039

Figures(3)  /  Tables(2)

Article Metrics

Article views(8249) PDF downloads(2074)

Other Articles By Authors

REVIEW   Open Access    

Advances in the biosynthesis, gene mining, and molecular mechanisms of cucurbitacin in Cucurbitaceae crops

Vegetable Research  5 Article number: e001  (2025)  |  Cite this article

Abstract: Cucurbitacin, a highly oxidized tetracyclic triterpenoid compound, is a common secondary metabolite in Cucurbitaceae crops. Its presence imparts a bitterness to the fruit, significantly reducing its quality. However, the accumulation of cucurbitacin enhances the plants resistance to pests and diseases, earning it the reputation of a 'green pesticide'. In recent years, cucurbitacin has attracted extensive attention from researchers. Therefore, this review summarizes the identification, gene mapping, and marker development, biosynthesis and regulation, transport mechanisms, and the domestication of non-bitter Cucurbitaceae varieties. Additionally, it provides insights into the breeding of Cucurbitaceae crops and the in vitro biosynthesis of cucurbitacin.

    • Cucurbit crops are mostly annual herbaceous climbing plants, comprising 118 genera and 825 species. Common examples include the genera Cucumis, Citrullus, Luffa, Momordica, and Cucurbita[1,2]. Cucurbitaceae crops not only have significant edible value but also possess important medicinal properties[3,4]. Currently, due to genetic factors and adverse environmental conditions, Cucurbitaceae crops develop a bitterness, which severely affects their flavor and quality, significantly reducing their commercial value.

      Bitterness compounds are widely present in plants, such as alkaloids[5], flavonoids[6], and terpenoids[7]. The substance causing bitterness in Cucurbitaceae crops is a highly oxidized tetracyclic triterpenoid compound called cucurbitacin[811], with its basic structure shown in Fig.1. The cucurbitaceae crops contain various cucurbitacins, which not only possess high medicinal value in terms of anti-cancer, anti-bacterial, and anti-tumor properties, but also exhibit strong resistance to diseases and pests in cucurbitaceae crops[12,13]. Due to its significant role in human health and plant stress resistance, cucurbitacin has attracted extensive attention. Based on this, this review summarizes the identification of bitterness compounds in Cucurbitaceae crops, gene localization of bitterness traits, biosynthesis of common cucurbitacins, and domestication of non-bitter Cucurbitaceae crops. This provides a reference for future breeding of cucurbit crops with bitter vegetative parts but non-bitter fruits, as well as for the efficient utilization of cucurbitacin.

      Figure 1. 

      The basic skeleton structure of cucurbitacin (adapted from Ma[7]).

    • Research on cucurbitacin began in the 1950s[14]. Since then, it has been widely studied due to its high medicinal value. Currently, based on the molecular structure of cucurbitacin, it is classified into 20 types, from cucurbitacin A to T[15], and the types and compositions of cucurbitacin also exhibit spatio-temporal specificity.

      The bitter compounds most abundant in the opened cotyledons and fruit are cucurbitacins C, while cucurbitacin B is present in the roots of cucumber seedlings and unopened cotyledons[16]. Therefore, the substance primarily responsible for the bitterness in cucumber fruits is cucurbitacin[17].

      There is a noticeable bitterness in both young fruits and stem vines of melons, with various types of cucurbitacins present in their tissues, among which the content of cucurbitacin B accounts for over 80%[18]. Furthermore, Zhou et al.[19] found that 15 d after pollination in melon fruits, there was a large amount of cucurbitacin B in bitter melons, while no cucurbitacin B was detected in non-bitter melons.

      The bitter taste of watermelon root, stem, and vine are closely related to cucurbitin, and the cucurbitin types are different among different species. Lavie et al.[20] identified cucurbitin B and cucurbitin E from the ancestor of cultivated watermelon (Citrullus colocynthis). In addition, this study also identified cucurbitin in watermelon leaves, but did not specify the type of cucurbitin in leaves[20]. Later, cucurbitins I, J, and T were identified from the ancestor of cultivated watermelon (Colocynthis vulgaris), of which cucurbitins T was firstly reported as a novel cucurbitin compound[21]. Davidovich-Rikanati et al.[22] also identified cucurbitins B and E from Citrullus lanatus and cucurbitins from watermelon leaves, suggesting that the types of cucurbitins in leaves may be similar to those in fruits. Studies have shown that these cucurbitins mainly exist in the form of glycosides[23,24]. Cucurbitin B and E were isolated from different germplasm resources of Citrullus spp, and the contents of cucurbitins in watermelon fruits and roots were higher than that in leaves and stems[25].

      Bitter melon is named for its bitterness and the compounds in bitter melon are primarily present in the form of glycosides or aglycones[26]. Currently, 161 types of cucurbitacins have been detected from various organs of bitter melon. The main identified components responsible for the bitterness of bitter melon are triterpenoid saponins (momordicoside I, momordicoside II, momordicoside K, and momordicoside L)[27]. There are two types of cucurbitane triterpenoids: cucurbitane triterpenoids with a C5 and C19 ring structure and cucurbitane triterpenoids without a C5 and C19 ring structure[28]. In addition to cucurbitacins, alkaloids can also contribute to the bitterness of bitter melon.

      Additionally, researchers have found that other cucurbit crops, such as zucchini[29], bottle gourd[30], wax melon[31], and sponge gourd[32], are also rich in cucurbitane-type bitter substances, specifically cucurbitacins.

    • The bitterness in cucumber includes both vegetative and fruit bitterness. There have been numerous studies on the genetic analysis of vegetative bitterness. It has been found that vegetative bitterness vs non-bitterness is controlled by a single dominant gene (Bi)[9,17,33,34]. However, Wenher et al.[35] discovered that, in addition to bi, bi-2 also participates in the regulation of bitter foliage in cucumber, the two loci follow a 9:7 genetic segregation ratio, showing the complementary gene action.

      The fruit bitterness in cucumber is primarily governed by a single dominant gene Bt[8,36], however, Bt and Bt-2 are also responsible for this trait[37]. When Bt-2 and Bt are both present, they exhibit a dominant-recessive epistatic interaction[38]. Additionally, studies have shown that Bt is not linked to femaleness gene F[39,40], while the Bt-2 is linked to fruit skin color gene u and D, and the small spines gene ss[37,41]. Proposed by Walters et al.[37], Bt-2 was present in the wild cucumber Hardiwickii. Since there are no subsequent gene mapping studies on Hardiwickii, this is the only locus with an unknown causal gene.

      In addition, vegetative bitterness in cucumber is not influenced by Bt, but bi exhibits a recessive epistatic effect on Bt. When the vegetative bitterness gene is in a heterozygous state, the fruit exhibits bitterness regardless of the presence of Bt[42]. Subsequently, Shang et al.[34] demonstrated that Bt can regulate the synthesis of cucurbitacin in fruit by directly activating the expression of Bi. Therefore, the formation of bitterness in cucumber vegetative and fruits is controlled by a complex genetic network involving multiple genes and various genetic interactions.

    • Research has found that the Mendelian segregation ratio for the bitterness trait in melon fruits is 9:7, indicating the bitterness is controlled by two pairs of dominant genes, with an epistatic effect[4345]. However, other studies have identified that the genes controlling the bitterness in melon fruits are Bif-1, Bif-2, and Bif-3, which exhibit independent inheritance[46]. Additionally, some research has shown that the segregation ratio for the presence or absence of bitterness in melon fruits is 3:1, with the bitterness trait being controlled by a single dominant gene[17,47]. This discrepancy may be attributed to the differences in the varieties of the parental materials used in the studies.

      In addition, there are also some studies on the bitterness of melon stems and vines. By crossing bitter and non-bitter parental lines, genetic analysis of F1, F2, BC1 and BC2 indicates that the segregation of stem and vine bitterness traits conforms to a 3:1 and 1:1 segregation ratio[48,49], which suggests that the stem and vine bitterness is controlled by one pair of genes, with bitterness being dominant over non-bitterness.

    • The bitterness trait of watermelon fruit is controlled by a single gene. In the 1990s, it was identified that the bitterness of watermelon fruit is governed by a single dominant gene (Bi) using wild watermelon materials[50]. Subsequently, there have also been studies reporting that the bitterness trait of watermelon fruit follows a single-gene independent inheritance[51]. Similarly, many studies have utilized hybridization between bitter and non-bitter parents to construct F2 and backcross populations for genetic analysis, finding that the bitterness trait in watermelon is also controlled by a single gene, with bitterness being dominant over non-bitterness[5256].

    • The earliest study on the genetic rules of bitterness in sponge gourd was conducted by Thakur et al., who proposed that bitterness in sponge gourd is controlled by the Bi gene in Luffa acutangula (L.) Roxb. and the S gene in Luffa cylindrica (L.) Roem.[57]. Through crosses and backcrosses between two reported cultivated varieties, Luffa acutangula (L.) Roxb.[58], and Luffa cylindrica (L.) Roem.[59], it was found that each of the two cultivated varieties of sponge gourd possesses a single dominant gene, with the dominant genes complementing each other to control the bitterness in the fruit[6062].

    • In addition, the inheritance patterns of the bitter taste traits of bottle gourds, zucchini, and gourds were also reported[2,6365]. The bitterness of bottle gourd fruits is jointly regulated by two complementary gene pairs, Bt and I[63]. Borchers & Taylor[64] crossed 'Green Striped Cushaw' zucchini with 'Goldbar' zucchini and genetic analysis revealed that the bitterness trait is controlled by three dominant complementary genes, with two contributed by 'Goldbar' and the third by 'Green Striped Cushaw'. Zhang[65] discovered that the F2 generation from the hybridization of multiple high-quality bottle gourd varieties conformed to a 9:7 segregation ratio, indicating that gene complementation is the cause of the severe bitterness in bottle gourd. Wu et al.[2] demonstrated through the hybridization of two local varieties, 'Hangzhou Gourd' and 'Puxian Gourd', that the genetic segregation ratio for the bitterness trait in bottle gourd is also 9:7, with QBt.1 and QBt.2 complementing each other to produce the bitter fruit.

    • Cucumber is an important model plant for studying agronomic traits in cucurbit crops, and current research on the identification of its bitterness gene is the most in-depth (Table 1). Wenher et al.[35] used the material 'NCG-093' (short petiole mutant) to find that the gene causing the absence of cucurbitin in leaves was named bi-2; however, subsequent gene mapping, cloning, or breeding work did not utilize this locus. It may correspond to the Bl gene specifically expressed in the leaves identified by Shang et al.[34] using E3-231 (wild type 406). Huang et al.[66] localized the Bi gene of cucumber leaves to a region of approximately 35 kb on chromosome 6. Subsequent comparative genomic analysis revealed that a gene in this region shares a high homology of 90% with the cucurbitadienol synthase gene in zucchini, suggesting that this gene maybe involved in the synthesis of cucurbitacin C in cucumber leaves. Similarly, the study conducted a genetic linkage analysis and localization of SSR markers by constructing a population of RILs, and eventually also located the Bi gene on cucumber chromosome 6, with the nearest flanking markers, SSR02309 and SSR00004, being 1.7 and 2.2 cm away from the bitterness gene, respectively[9].

      Table 1.  The bitterness genes of cucurbitaceae crops located in related markers.

      Species Chr Molecular marker Primer sequence (5'-3') Populations Ref.
      Cucumber 6 SSR02309 (1.7 cm), SSR00004 (2.2 cm) SSR02309-F: TGAAATGCCTCTGCAATGAC 9110Gt (bibi) × 9930 (BiBi)→RILs [9]
      SSR02309-R: TCATGACTAGACACGCCAGC
      SSR00004-F: TTCATTGCAAAGCACACACA
      SSR00004-R: TGAAAAGAGGGAACAAAAGCA
      5 E23M66-101 (5 cm), E25M65-213
      (4 cm)
      E23: GACTGCGTACCAATTCTA 931 (Bt) × 932 (bt)→F2 [42]
      M66: GATGAGTCCTGAGTA
      E25: GACTGCGTACCAATTCTG
      M65: GATGAGTCCTGAGTAAGAG
      5 SSR10795 (0.8 cm), SSR07081 (2.5 cm) SSR10795-F: CATCAAAATACCTCCATCTCCA 46GBt (BiBiBtBt) × 931 (BiBibtbt)→F2 [67]
      SSR10795-R: GCATGAATAGCATGGGGTTT
      SSR07081-F: GGCGACTTTGGAGTGTAACAA
      SSR07081-R: GGAAAGATATTCTCAGGGAATCTAA
      6 SSR0004 (1.9 cm), SSR02309 (3.3 cm) 9110Gt (bi-1bi-1) × 9930 (Bi-1Bi-1)→RILs [10]
      5 SSR12291 (1.9 cm), SSR02118 (1.8 cm) SSR12291-F: CGCACGAGAACCTTTATTGA D9320 (Bt) × D0432-2-2 (bt)→BC1 [36]
      SSR12291-R: TCACATCAAATTAACACTTTCATCTC
      SSR02118-F: TGGATTGTCATCTCATTGGC
      SSR02118-R: GGTGAGTGGTAATTTTATGAATTTTG
      Melon 2, 5 2mBiPr21619699, 2mBiPr21653588, 5mBiPr20403004, 5mBiPr20822407, and 5mBiPr21331862 2mBiPr21619699-F: AATGGCATAACCTTTCACCT C68 (Bt) × C69 (bt)→BC1 [45]
      2mBiPr21619699-R: CTTTCTATCACCAACCGACT
      2mBiPr21653588-F: TTATCTAAGTTTCCTCGGTC
      2mBiPr21653588-R: CTTCAACTTGGATGTTTTCT
      5mBiPr20403004-F: GGAATAGGAATAGGAAGAATGT
      5mBiPr20403004-R: AAAAGGGTTAATGATAAGAGAC
      5mBiPr20822407-F: TAGGTTTAACCTGTTTTCACC
      5mBiPr20822407-R: GCATACAAAGCATTTTTTCTT
      5mBiPr21331862-F: ATGGTGAGCATTGTTTTCGA
      5mBiPr21331862-R: TCTTTTGGGTCTTGGGCTTC
      Watermelon 1 W01-2 (0.93 cm), W01-3 (0.99 cm) W1-1 (bt) × PI 186490 (Bt)→BC1 [52]
      Watermelon 1 SNP3162335, SNP3278961 SNP3162335-F: TGTCAAATGGGTTCATGAAGTT 9904(Bt) × Handel (bt)→RILs [54]
      SNP3162335-R: TTCCTGTCTTTTGTGGTTTGG
      SNP3278961-F: TTCGCACTAACCTGGAAAAG
      SNP3278961-R: ATTTGAAACCCGCCCTTAAA
      Sponge gourd 7 LuBt1-2 (1.9 cm), LuBt1A (1.2 cm) 48-1-0-0 (bt) × 4-0-0-0 (bt)→BC1 [61]
      Sponge gourd 7 SGE292 (6.08 cm), SGC196 (3.11 cm) SGE292-F: TGGGGACAACCCGGCTT 48-1-0-0 (bt) × 4-0-0-0 (bt)→BC1 [62]
      SGE292-R: GACTGCGTACGAATTCTG
      SGC196-F: AGCGAGCAAGCCGGTGG
      SGC196-R: GACTGCGTACGAATTATG
      Bottle gourd 6, 7 BGReSe_09031-BGReSe_09068, BGReSe_11107-BGReSe_11032 Hangzhou Gourd (bt) × Puxian Gourd (bt)→F2 [2]

      Combined with BSA-seq and AFLP markers, the Bt gene was located between E23M66-101 and E25M65-213, with genetic distances of 5 and 4 cm, respectively[42]. Zhang et al.[10] constructed an SSR linkage map and used 148 F9 RILs to locate the cucumber fruit bitterness gene bi-1, which identified two flanking SSR markers (SSR0004 and SSR02309) with genetic distance of 1.9 cm and 3.3 cm, respectively. Li et al.[36] mapped the cucumber fruit bitterness gene Bt to chromosome 5, and the closest markers to Bt were SSR12291 and SSR02118, with genetic distances of 1.8 and 1.9 cm, respectively. Zhang et al.[67] located the Bt using Indel markers, and obtained a marker (Bt-InDel-1) linked to Bt gene, with a genetic distance of 0.8 cm from Bt, which laid the theoretical foundation for the fine mapping of the cucumber fruit bitterness gene. In the same year, the cucumber materials of '931' (btbt) and '46GBt' (BtBt) were used as parents to construct an F2 population and the Bt gene was mapped into a 3.3 cm region on the short arm of chromosome 5 through SSR marker genetic linkage analysis, additionally, the Bt was finely mapped into a 1.5 cm region on chromosome 5, achieving the first localization of the cucumber fruit bitterness gene[68]. In 2014, the research group ultimately cloned the Bt gene, laying the foundation for the study of the molecular mechanism of the bitterness gene in Cucurbitaceae crops[34].

      Previous research on the mapping of cucumber bitterness genes had not developed molecular markers based on the Bi gene sequence. Building on previous studies, Venkatesh et al.[33] developed reliable, co-detectable molecular markers using high-resolution melting (HRM) and Kompetitive Allele Specific PCR (KASP) techniques (BiHRM1 and Bi-KASP). These gene-based markers can significantly improve the accuracy and efficiency of breeding non-bitter cucumber lines.

      Liu et al.[69] utilized the 9930 v2.0 genome to study the mapping of bitterness genes in cucumber, including the fruit bitterness gene (Bt) and the leaf bitterness gene (Bl) in the bHLH gene cluster. However, Shang et al.,[34] found that the Bt locus contains gene clusters of bHLH93(Bt) and bHLH95 (Bl) through the modified 9930 v3.0 genome[70], Bi is located on chromosome 6 and encodes enzymes of the oxysqualene cyclase (OSC) family, which catalyzes the generation of cucurbitadienol. Bt and Bl are homologous genes located on chromosome 5, which regulate the formation of bitterness in fruits and leaves, respectively. The discovery of these genes provides an important foundation for the study of cucumber bitterness traits and helps further understand the evolutionary process and genetic mechanisms of cucumbers.

    • Research on the mapping of bitterness genes in melon started relatively late, and there are few studies currently (Table 1). Zhou et al.[19] clarified the biosynthesis pathway of cucurbitacin B in melon, discovering three genes on chromosome 9 that regulate the formation of bitter substances. Li et al.[47] constructed a genetic map comprising 10 linkage groups using 477 SNP markers, with a total length of 337.79 cm and an average marker interval of 0.71 cm, the whole-genome QTL mapping on linkage group 8 (corresponding to chromosome 9) detected a bitterness QTL explaining 20% of the phenotypic variation. Moreover, a genome-wide association study identified seven SNPs related to bitterness traits, all of which were also located in the genomic region of the bitterness QTL on chromosome 9[47]. Shang et al.[45] mapped the candidate genes for melon bitterness into a 7.3 Mb region on chromosome 2 and a 2.2 Mb region on chromosome 5.

    • Research on the genetic mapping of the bitterness gene in watermelons has been quite extensive (Table 1). As early as the 1990s, researchers identified the bitterness gene (Bi) from wild watermelons, which is closely linked to the isoenzyme marker Pgm-1 at a distance of 11.3 cm[50]. Zhang et al.[52] used CAPS markers to construct a genetic map and located the bitterness gene within a 1.01 Mb interval between two markers w01-2 and w01-3 on chromosome 1. Sun et al.[55] mapped a QTL controlling fruit bitterness in watermelon into the interval between markers w01-2 and w01-3 on chromosome 1, with a high LOD value of 95.0931, explaining 99.5904% of the phenotypic variation, and the distances to the flanking markers were 0.93 cm and 0.99 cm, respectively. Li et al.[53] used '9904' (bitter) and 'Handel' (non-bitter) as parents to map the Bt gene into a 6.16 Mb candidate interval on chromosome 1. The following year, Li[54] further narrowed the interval into a 116.7 kb segment between the two markers SNP3162335 and SNP3278967. This interval contains four candidate genes (Cla011507, Cla011508, Cla011509, and Cla011510). Since then, the study further utilized 16 watermelon materials, combined with qRT-PCR results, to hypothesize that the bHLH gene Cl011508 may regulate watermelon fruit bitterness[56].

    • The sponge gourd variety '48-1-0-0' was utilized as a parent crossing with '4-0-0-0' to obtain F2 and a backcross population, the bitterness gene Bt was integrated into linkage group 3 and was initially located between SGE292 and SGC196 with genetic distances of 6.08 and 3.11 cm, respectively[63] (Table 1). Qin[61] located a bitterness gene Labt in Luffa acutangula (L.) Roxb. on chromosome 7, between markers Lubt1-2 and Lubt1A, with the genetic distances of 1.9 and 1.2 cm, respectively; moreover, a bitterness gene Lcbt in Luffa cylindrica (L.) Roem was also identified with a genetic distance of 6.3 cm[61] (Table 1). The results also indicated that the bitterness gene of Luffa acutangula (L.) Roxb. was probably homologous to cucumber Csa1G044 (GenBank Accession: KM655), which encodes oxysqualene cyclase (OSC)[61]. Given this, it was hypothesized that this gene might be the Bi gene reported by Thakur et al.[57]. Since then, few studies related to the localization of bitter taste genes in sponge gourd have been reported.

    • There are reports on the mapping of bitterness genes in bottle gourd (Table 1). Wu et al.[2] crossed 'Hangzhou bottle Gourd' with 'Puxian bottle Gourd' to construct an F2 population, conducted bitterness gene mapping, and detected two QTLs, with QBt.1 locating in a 17.62 cm interval on LG2, corresponding to a 1.6 Mb region on chromosome 6, and QBt.2 locating in an 8.44 cm interval on LG9, corresponding to a 1.9 Mb region on chromosome 7.

    • Cucurbitacins are synthesized through the mevalonate (MVA) pathway to forms the basic skeleton of cucurbitane-type triterpenoids[34]. Starting with acetyl-CoA as the substrate, MVA is formed through a series of enzyme-catalyzed reactions, which then produces dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP). Two molecules of IPP and one molecule of DMAPP, under the action of farnesyl pyrophosphate synthase (FPS), form farnesyl pyrophosphate (FPP). Subsequently, under the action of squalene synthase (SQS) and squalene epoxidase (SQE), 2,3-oxidosqualene is produced. Finally, the basic skeleton structure of cucurbitacins is formed through the catalysis of the oxidosqualene cyclase (OSC) family.

      After the formation of the basic skeleton of cucurbitane-type triterpenoids, various cucurbitane-type triterpenoids are produced through the action of multiple modifying enzymes. These multi-site modifying enzymes include oxidoreductases and acyltransferases[71,72]. The most common oxidoreductases in this process are the cytochrome P450 (CYP-450) family, which can modify multiple sites to produce hydroxyl, carboxyl, aldehyde, keto, and epoxy groups (Fig. 2)[73]. This lays the foundation for further modifications by acyltransferases and other enzymes.

      Figure 2. 

      Cucurbitacin biosynthesis process (adapted from Ma[7]). FPS: Fanesyl pyrophosphate synthase; SQS: Squalene synthase; SQE: Oxidoqualene synthase; OSC: Oxidoqualene cyclase; P450: Cytochrome P450 monooxygenase; ACT: Acetyltransferase. The dotted line indicates that there are multiple steps involved.

    • The biosynthesis of cucurchinin in melon, cucumber and watermelon all involves enzymes such as squalene oxidizing cyclase (OSC) and cytochrome P450 (CYP450), which are regulated by specific transcription factors[19]. CmBt and CmBr in melon regulate the synthesis of cucurbitin B in fruits, and roots, respectively[19]. CsBl, CsBt, and CsBr genes in cucumber regulate cucurbiturin C synthesis in leaves, fruits, and roots, respectively[34]. The ClBt and ClBr regulate the synthesis of cucurbitin E in watermelon fruits, and roots, respectively[19].

      In melon, the biosynthesis of cucurbitacin B involves one OSC gene (CmBi), six CYP450 genes, and one ACT gene. These eight genes are co-expressed in various tissues of melon, regulating the biosynthesis of cucurbitacin B[19]. The key steps in cucurbitacin B biosynthesis are as follows: First, the cucurbitadiol is produced under the action of CmBi, which encodes cucurbitadienol synthase. Second, the Cm890-encoded oxidoreductase catalyzes the C-11 carbonylation and C-20 hydroxylation, forming 11-carbonyl, 20-hydroxyl cucurbitadienol. Third, Cm180-encoded oxidase generates 11-carbonyl, 2,20-dihydroxy cucurbitadienol. Finally, cucurbitacin B is produced through the action of CmACT (Table 2, Fig. 3)[74,75].

      Table 2.  Gene related to biosynthesis and regulation of cucurbitacin B, C, and E in melon, cucumber, and watermelon.

      Gene name Gene ID Gene types Notes Structure of Cucurbitacins
      Cucurbitacin B CmBi Melo3C022374 OSC Cucurbitadienol synthase
      CmACT Melo3C022373 ACT Acyltransferase
      Cm160 Melo3C022377 CYP81Q58
      Cm170 Melo3C022376 CYP89A140
      Cm180 Melo3C022375 CYP81Q59 C2 hydroxylase
      Cm710 Melo3C022372 CYP87D19
      Cm890 Melo3C002192 CYP87D20 C11 carbonylase + C20 hydroxylase
      Cm490 Melo3C023960 CYP712D8
      CmBt Melo3C005611 bHLH TF Specifically expressed in fruits
      CmBr Melo3C005610 bHLH TF Specifically expressed in roots
      Cucurbitacin C CsBi Csa6G088690 OSC Cucurbitadienol synthase
      CsACT Csa6G088700 ACT Acyltransferase
      Cs160 Csa6G088160 CYP81Q58 19,25-Dihydroxy-cucurbitadienol
      Cs170 Csa6G088170 CYP89A140
      Cs710 Csa6G088710 CYP89D19
      Cs490 Csa3G698490 CYP712D8
      Cs540 Csa3G903540 CYP88L2 19-Hydroxy-cucurbitadienol
      Cs550 Csa3G903550 CYP88L3
      Cs890 Csa1G044890 CYP87D20
      CsBt Csa5G157230 bHLH TF Specifically expressed in fruits
      CsBl Csa5G156220 bHLH TF Specifically expressed in leaves
      Cucurbitacin E ClBi Cla007080 OSC Cucurbitadienol synthase
      ClACT Cla007081 ACT Acyltransferase
      Cl160 Cla007077 CYP81Q58
      Cl170 Cla007078 CYP89A140
      Cl180 Cla007079 CYP81Q59 C2 hydroxylase
      Cl710 Cla007082 CYP89D19
      Cl890A Cla008355 CYP87D20 C11 carbonylase + C20 hydroxylase
      Cl890B Cla008354 CYP87D20 C11 carbonylase + C20 hydroxylase
      Cl490 Cla017252 CYP712D8
      Cl510 Cla016164 CYP88A60
      ClBt Cla011508 bHLH TF Specifically expressed in fruits
      ClBr Cla011510 bHLH TF Specifically expressed in roots

      Figure 3. 

      Cucurbitacin B, C, and E gene clusters (adapted from Ma[7]). Orange squares represent OSC family genes, pink squares represent ACT genes, and blue squares represent CYP450 family genes.

      The biosynthesis of cucurbitacin C involves one OSC gene (CsBi), eight CYP450 genes, and one acyltransferase (ACT) gene[76,77]. The first step in the biosynthesis of cucurbitacin C is similar to that of cucurbitacin B. It is catalyzed by an enzyme from the oxidosqualene cyclase (OSC) family encoded by CsBi, producing cucurbitadienol. Then, the enzyme encoded by Cs540 modifies cucurbitadienol at the C-19 position to produce 19-hydroxy cucurbitadienol. Subsequently, the enzyme encoded by Cs160 catalyzes the C-25 position, resulting in 19,25-dihydroxy cucurbitadienol. Finally, cucurbitacin C is produced through the action of the acyltransferase encoded by CsACT (Table 2, Fig. 3)[76].

      The genes involved in the biosynthesis of cucurbitacin E include one OSC gene (ClBi), seven CYP450 genes, and one ACT gene[19]. In the first step of CuE biosynthesis, the enzyme catalyzing the production of cucurbitadienol is encoded by ClBi. In the second step, both Cl890A and Cl890B encode cytochrome P450 oxidases that form 11-hydroxy cucurbitadienol and 11-carbonyl-20β-hydroxy cucurbitadienol. This is followed by the oxidation catalyzed by the enzyme encoded by Cl180, forming 11-carbonyl-2β,20β-dihydroxy cucurbitadienol. Finally, cucurbitacin E is produced through the action of the acetyltransferase encoded by ClACT (Table 2, Fig. 3)[15].

    • The bHLH transcription factors include a basic region and a helix-loop-helix domain, comprising a class of transcription factors with a basic helix-loop-helix structure[34,69]. bHLH TFs activate the transcription of genes related to gourd toxin synthesis by binding to the promoter regions of these genes[78]. Due to its key role in the regulatory process, it can turn the cucurbitine biosynthesis pathway on or off, so it is called the 'switch' gene[79]. Xu et al.[78] conducted a homology and phylogenetic tree analysis of the Bt gene cluster regulating the biosynthesis of cucurbitacin C. They found that the genes in this cluster originated from three ancestral genes following a shared whole-genome tetraploidization event in the Cucurbitaceae family. Additionally, a new conserved gene cluster, which is paralogous to the Bt cluster, was identified. This new cluster includes two tandemly repeated bHLH genes. The evolutionary relationship and gene expression characteristics of these two genes in the paralogous cluster indicate that one of the genes (Brp) is involved in regulating the biosynthesis of cucurbitacin C in roots[78]. These findings provide new insights into the function and evolution of bHLH genes in cucurbit crops and offer new perspectives on the regulation of cucurbitacin biosynthesis.

    • CmBr and CmBt can regulate the expression of cucurbitacin B biosynthesis genes, with CmBt and CmBr specifically regulating the biosynthesis of bitter substances in melon fruits and roots, respectively. Zhou et al.[19] discovered CmBr and CmBt in the bHLH gene cluster on chromosome 9, the expression and content of CmBr and CmBi were detected by different melon materials, and the expression of CmBr and CmBi were positively correlated. In addition, Wang et al.[80] knocked out the CmBr using CRISPR/Cas9 and obtained a CmBr near-isogenic line combined with backcross breeding, the cucurbitin B content in wild-type fruits was significantly increased after CPPU (a crop growth regulator that can induce bitter taste in cucurbitae) treatment, and the content of cucurbitin B in mutant fruit did not change significantly, but the fruit was still not bitter. Based on this, it can be concluded that CmBt is the 'switch' gene regulating the formation of bitterness in melon fruits, while CmBr is the 'switch' gene regulating the formation of bitterness in melon roots.

    • Nine genes involved in cucurbitacin C biosynthesis are directly regulated by two bHLH-type transcription factors (Bl and Bt). The Bl controls the formation of bitterness in cucumber leaves, while Bt controls the formation of bitterness in cucumber fruits, through re-sequencing of cucumber mutants, it was found that the Bl gene interacts with the Bi promoter to regulate Bi expression[34]. Based on a genome-wide association analysis of 115 cucumber core germplasms, an SNP site closely linked to leaf bitterness was identified, this SNP causes the amino acid substitution from cysteine to tyrosine at position 393 amino acid in Csa6G088690, resulting in leaves from bitter to non-bitter[34]. Therefore, it can be concluded that Bl is the 'switch' gene specifically regulating the synthesis of bitterness in cucumber leaves.

      Based on 115 cucumbers, Csa5G157230 and Bi were highly expressed in wild fruits, but not expressed in cultivated fruits, and Csa5G157230 was positively correlated with Bi expression. It was inferred that Csa5G157230 may be a Bt gene regulating the formation of bitter taste in cucumber fruits. It is the 'switch' gene that regulates the synthesis of bitter fruit[78].

    • In cucumber, CsBl and CsBt are specific transcription factors that regulate the biosynthesis of cucurbitacin C in leaves and fruits, respectively. The mutation of CsBt leads to the domestication of the wild type with bitterness. The biosynthesis of cucurbitacins is conserved among Cucurbitaceae crops[34]. Based on this, it can be speculated that the biosynthesis of cucurbitacin E in watermelon is also regulated by conserved transcription factors. In 2016, Zhou et al.[19] established a transient Agrobacterium infiltration expression system in cotyledons and confirmed that transient expression of ClBt or ClBr in watermelon cotyledons induces the biosynthesis of cucurbitacin E. Therefore, Zhou et al.[19] speculated that ClBt and ClBr are the 'switch' genes regulating the synthesis of bitterness in watermelon fruits and roots, respectively.

    • Although cucurbitacins are hailed as 'green pesticides', they can also be toxic to the plant's cells. To prevent self-toxicity, plants have gradually evolved a detoxification mechanism[15], wherein cucurbitacins produced by the cells are transported to adjacent cells or even other tissues or organs through specific transport proteins, thereby reducing self-toxicity. With the advancement of molecular biology, researchers have begun to pay more attention to the study of transport proteins within plants.

      Through transcriptome analysis of wild and cultivated cucumbers, Shang et al.[34] discovered a transport protein co-expressed with cucurbitacin C biosynthesis genes, named CsABC1, which is located on the vacuolar membrane of cucumber leaf cells. This transport protein can transport cucurbitacin C from the cytoplasm to the vacuole, thereby protecting the cell from self-toxicity. Zhong et al.[81] further confirmed the results of Shang et al.'s experiment.

      Additionally, in 2022, Zhong et al.[82] discovered the transport proteins for cucurbitacin B and E in melon and watermelon through gene mining and comparative genomics. These MATE genes, Melo3C002190 and Cla008357, were named as CmMATE1 and ClMATE1, respectively. Cucurbitacin B is transported to the rhizosphere via CmMATE1, selectively enriching two bacterial genera in the soil (Enterobacter and Bacillus). The enrichment of these two bacterial genera, in turn, increases resistance to the soil-borne fungal pathogen Fusarium oxysporum, thereby enhancing plant adaptability[82].

    • In the genetic analysis of bitterness traits in Cucurbitaceae crops, a high similarity was observed among crops such as cucumber, melon, watermelon, and bottle gourd. The research identified a genetic segregation ratio of 9:7 for bitterness across multiple species[2,35,4345,65]. This phenomenon suggests the existence of a conserved regulatory network for cucurbitacin biosynthesis in Cucurbitaceae crops. For instance, the CsBt in cucumber and the ClBt in watermelon can induce the synthesis of cucurbitacin E[19,45], demonstrating their functional conservation across different species. This synergistic effect of gene regulation not only supports the hypothesis that bitterness domestication occurred before the diversification of Cucurbitaceae but also provides new perspectives for understanding the complex regulatory mechanisms of cucurbitacin biosynthesis through cross-species validation. In the future, these findings may offer crucial evidence for improving bitterness traits of Cucurbitaceae crops through molecular breeding and gene editing technologies, thereby supporting a variety improvement and production optimization on a global scale.

    • Currently, the genetic populations used for the positioning research of bitter genes in Cucurbitaceae crops are mostly F2 and backcross populations, which has resulted in a series of issues such as inaccurate positioning of bitterness genes, poor experimental repeatability and stability. It is necessary to continuously overcome difficulties and utilize permanent populations to construct genetic maps, moreover, there should be a vigorous collection of wild and foreign germplasm resources for germplasm innovation. In addition, when constructing genetic maps for Cucurbitaceae crops, outdated markers such as RFLP, AFLP, RAPD, and SSR are still being used, which places the genetic markers relatively far from the target genes. There should be ongoing development of functional SNP markers and continuous technological innovation to accelerate the fine mapping and cloning process of bitter genes in cucurbit crops. Although a large number of genes related to the bitter traits in cucurbit crops have been identified, the lack of a mature genetic transformation system has led to insufficient research on the functional analysis of these related genes. Therefore, optimizing the genetic transformation system of cucurbit crops and improving gene editing efficiency is also one of the key focuses for the future breeding of new varieties of cucurbit crops without bitterness.

      Cucurbitacins produced by cucurbit crops have certain disease and pest-resistance capabilities. Over the years, researchers have domesticated these crops to gradually eliminate fruit bitterness while retaining vegetative bitterness to resist pests and diseases[81]. However, due to incomplete domestication, cucurbit crops still exhibit bitterness when subjecting to environmental stress. Therefore, researchers have proposed a new breeding approach for non-bitter cucurbit crops by regulating the 'switch' genes of cucurbitacin biosynthesis, it is possible to cultivate superior varieties with bitter vegetative parts but non-bitter fruits. This approach ensures that cucurbit crops are protected from pests and diseases while significantly improving fruit quality.

    • The medicinal values of cucurbitacins, such as anti-tumor, anti-inflammatory, antioxidant, and blood sugar-lowering effects, are well known. However, the extremely low content of cucurbitacins in cucurbit crops pose a significant challenge for extraction. Therefore, while optimizing extraction processes, large-scale in vitro synthesis is also necessary. Currently, the high cost of synthesis hinders large-scale production. Some researchers have proposed introducing the entire cucurbitacin biosynthetic pathway into the yeast genome, enabling rapid and efficient synthesis and modification of cucurbitacins through fermentation. This approach offers new insights and references for developing new anticancer drugs in the future[83]. Additionally, due to the large molecular weight and complex structure of cucurbitacins, there are few reports on the physiological and biochemical mechanisms of cucurbitacin production, which significantly hinders the in vitro synthesis process. By thoroughly studying the physiological and biochemical mechanisms of cucurbitacin production in various cucurbit crops, we can provide a theoretical foundation for the large-scale in vitro synthesis of cucurbitacins and greatly enhance their medicinal value.

      • This work was supported by grants from the Zhejiang Major Science and Technology Project for New Vegetable Variety Breeding (2021C02065), Zhejiang Provincial Accurate Phenotypic Identification of Cucurbits and Vegetables Germplasm Resources, and the Zhejiang Provincial 'Three Agriculture and Nine Sides' Agricultural Science and Technology Cooperation Program (2023SNJF011).

      • The authors confirm contribution to the paper as follows: draft manuscript preparation: Chai Y; concept design and manuscript revision: Sun Y. All authors reviewed the results and approved the final version of the manuscript.

      • Data sharing not applicable to this article as no datasets were generated or analyzed during the current study.

      • The authors declare that they have no conflict of interest.

      • Copyright: © 2025 by the author(s). Published by Maximum Academic Press, Fayetteville, GA. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (3)  Table (2) References (83)
  • About this article
    Cite this article
    Chai Y, Sun Y. 2025. Advances in the biosynthesis, gene mining, and molecular mechanisms of cucurbitacin in Cucurbitaceae crops. Vegetable Research 5: e001 doi: 10.48130/vegres-0024-0039
    Chai Y, Sun Y. 2025. Advances in the biosynthesis, gene mining, and molecular mechanisms of cucurbitacin in Cucurbitaceae crops. Vegetable Research 5: e001 doi: 10.48130/vegres-0024-0039

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return