-
Cladosporium endophyticum Tibpromma and KD. Hyde[12], Fig. 1.
Figure 1.
Cladosporium endophyticum. (a) Colony; (b)−(e) Conidiophores with conidial chains; (f) Conidiogenous cell; (g) Conidiophore macronematocyst; (h), (i) Conidia. Scale bars (a) = 10 mm, (b)−(i) = 10 m.
Specimen examined: Iraq Basrah Province: from the air, 3 Feb 2019, coll. ZK. Abdulla
On PDA after 14 d at 25 °C, the colony diameter reached 40 mm, with an olive-green to dark olivaceous color and a wrinkled, undulating surface. The opposite was greenish-black, with a sluggish development rate and an uneven white edge.
Mycelium is superficial and immersed, septate, subhyaline, or pal olivaceous, smooth, branched, thick-walled hyphae. Conidiophores are erect, septate, usually branched, macronematous, micronematous arising single or in clusters, branched, straight, or oblique, up to 122 µm long, 2.4–3.6 µm wide. Conidiogenous cells are cylindrical, 10–25 µm long, 2.5–4 µm wide, terminal, and intercalary. Conidia hyaline to pale-olivaceous, arranged in a series, in long divider chains, smooth, little terminal conidia ovoid with rounded ends, 2.5–7.5 × 2.5–4 µm, intercalary conidia globose to ellipsoid, aseptate or one septate, 6.4–16.5 × 2.4–4.8 µm. Ramoconidia is cylindrical to ellipsoid, 0–2 septate, not constricted 10.4–27.5 × 2.5–4.5 µm.
Phylogeny
-
The alignment of ITS nucleotide sequences indicated the presence of 100% homology with no nucleic acid variations between C. endophyticum S1 in this study and C. endophyticum in GeneBank. This figure compares our sample to the NCBI database (GenBank acc. NR158360.1) and then aligns the sequences with generating these sequences.
There are 554 bp amplicon sequences among the rRNA sequences depicted in Table 1.
Table 1. Cladosporium endophyticum (NR 158360.1) has a ribosomal subunit (rsu) rRNA that was amplified using a 554 bp PCR amplicon.
Amplicon Reference locus sequences (5′ - 3′) Length rRNA TCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTTGACCCCGGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATTAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACCGGCTGGGTCTTCCGTCCCCTCAGCGTTGTGGAAACTATTCGCTAAAGGGTGCCGCGGGAGGTCACGCCGCAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGA 554 bp An rRNA subunit from Cladospoium endophyticum (NR 158360.1) was amplified using the 554 bp PCR amplicons in Fig. 2.
Figure 2.
Comparison of nucleic acid sequences. Cladosporium endophyticum For example, 'ref' is a reference sequence, while 'S1' is a sampling number.
Analyzed fungal samples yielded a full tree of all the fungal genomes studied. DNA sequences from other samples were also included in this phylogenetic tree, constructed using neighbor-joining techniques. Only the nucleic acid sequences from Cladosporium, a single genus, were included in the tree. It is possible to classify our three Cladosporium ribosomal sequences into three broad phylogenetic groups, which indicates that the genus' diversity in these sequences is restricted, see Fig. 3.
Figure 3.
Phylogenetic tree of Cladospoium endophyticum with Cladosporium sphaerospermum and Cladosporium halotolerans. Variable colors represent the variable grouping within the Genbank deposited sequences of the investigated variations. The symbol S1 denotes the code for the sample under investigation in this study.
Impact of numerous environmental factors, including temperature, pH, medium, and carbon and nitrogen supplies, on plant growth
-
For C. endophyticum, temperature had the greatest impact on radial growth (p ≤ 0.05), and RLSD was used to compare temperature and fungal growth (p ≤ 0.001). At 25 °C, fungal growth was at its best, while no growth occurred at 5 and 40 °C (Table 2).
Table 2. Impact of different temperatures on radial growth of C. endophyticum grown on PDA medium for 14 d.
Temperature Mean Std. deviation 5 0 0 10 8.66 0.57 15 17.33 1.52 20 38 1 25 46 2 30 28.66 1.15 35 6.33 1.15 40 0 0 RLSD = 1.698 (P ≤ 0.05) Table 3 showed a significant impact on various pH on radial growth of C. endophyticum, the fungus can grow at a range of pH (4−8), and pH 6 was most suitable for growth.
Table 3. Impact of different pH values on radial growth of C. endophyticum grown on PDA medium at 25°C for 14 d.
pH Mean Std. deviation 4 21.66 1.52 5 34 1 6 39.33 0.57 7 28.33 1.52 8 18.33 1.52 RLSD = 2 (P ≤ 0.05) Results showed an important impact (P ≤ 0.05) between different culture mediums and C. endophyticum, PDA, and MEA medium were more favorable, and there is no significant effect between SNA and OA media (Table 4).
Table 4. Impact of different media on radial growth of C. endophyticum incubated at 25 °C for 14 d.
Media Mean Std. deviation PDA 44.66 1.52 MEA 42 1 OA 32.33 2.08 SNA 30.66 1.52 RLSD = 2.5 (P ≤ 0.05) The difference between C. endophyticum radial growth on different carbon sources is shown in Table 5. RLSD is used to compare them. Sucrose and glucose appear significantly different from xylose, sorbitol, and manitol.
Table 5. Impact of various carbon sources on radial growth of C. endophyticum incubator at 25 °C for 14 d.
Carbon source Mean Std. deviation Sucrose 45.33 0.57 Glucose 44.00 1 Xylose 32.33 1.15 Sorbitol 27.66 0.57 Mannitol 25.00 1 RLSD = 1.39 (P ≤ 0.05) The results showed the significant difference between C. endophyticum and nitrogen sources. Ammonium nitrate was the best nitrogen source for growth, followed by ammonium phosphate, urea, and potassium nitrate, which were favorable for fungal development (Table 6).
Table 6. Impact of various nitrogen sources on radial growth of C. endophyticum at 25 °C for 14 d.
Nitrogen source Mean Std. deviation Ammonium nitrate 45.66 1.15 Ammonium phosphate 39.66 0.57 Ammonium sulphate 37.00 2 Urea 32.66 2.08 Potasium nitrate 32.33 0.57 RLSD = 2.3 (P ≤ 0.05) -
Cladosporium is a complex genus of hyphomycetes. In this study, C. endophyticum represents a new addition for the Iraqi mycoflora, obtained from the air and identified depending on morphology and molecular characteristics and study the physiological factor effect on growth, temperature, pH, different media, carbon and nitrogen sources. The results indicated they all had significant sources of variation in mycelium radial growth.
-
About this article
Cite this article
Abdulla ZK. 2023. Taxonomy and biology of Cladosporium endophyticum as the first record in Iraq. Studies in Fungi 8:5 doi: 10.48130/SIF-2023-0005
Taxonomy and biology of Cladosporium endophyticum as the first record in Iraq
- Received: 05 December 2022
- Accepted: 04 January 2023
- Published online: 02 February 2023
Abstract: Cladosporium species are cosmopolitan organisms. Conidiogenous loci distinguish this genus. Their spores can be isolated from different sources. The morphological analysis and ITS sequence were used to identify Cladosporium endophyticum isolated from air. The findings demonstrate that C. endophyticum S1 and C. endophyticum Thailand strain were almost identical in this investigation. The C. endophyticum strain is isolated from Thailand, and it has a distinctive phylogenetic clade. This clade resided in the vicinity of Cladosporium sphaerospermum and Cladosporium halotolerans, respectively. In order to study the physiological factor effect on C. endophyticum on solid media, different temperatures were used (5, 10, 15, 20, 25, 30, 35, 40), pH (4, 5, 6, 7), media malt extract agar (MEA), potato dextrose agar (PDA), oatmeal agar (OA), synthetic nutrient-deficient agar (SNA), carbon (sucrose, glucose, sorbitol, xylose, manitol), nitrogen (ammonium nitrate, ammonium sulphat, urea, ammonium phosphate, potassium nitrate). The results showed all factors' highly significant (p ≤ 0.05) effect. The faster growth was found at 25 °C, pH suitable for growth 5 and 6. The maximum radial growth was found on PDA and MEA. The fungus C. endophyticum can utilize all carbon sources, and faster growth was recorded on sucrose, then glucose, xylose, sorbitol, and manitol. The fungus grows on all nitrogen sources, and mycelium growth was good on ammonium nitrate, ammonium phosphate, ammonium sulfate, urea, and potassium nitrate. Cladosporium endophyticum is newly recorded from Basrah, Iraq, and it has been deposited in GenBank with accession numbers for nucleotide sequence (MW298524).
-
Key words:
- Cladosporium /
- Morphology /
- ITS sequence /
- Taxonomy.