Search
Submit Manuscript
2.0CiteScore
Advanced Search
MAP  >  Food Materials Research
2024 Volume 4
Article Contents
Abstract
Introduction
Materials and methods
Materials
Animal experiments
Histopathological analysis
Hematoxylin-eosin (HE) staining
Periodic acid-schiff (PAS) staining
Real-time polymerase chain reaction (RT-PCR)
Western blot analysis
Enzyme-linked immunosorbent assay (ELISA)
Flow cytometry (FCM)
Statistical analysis
Results
Effects of M3G on the body weight gain, DAI score, and food intake of mice with DSS-induced colitis
Effects of M3G on the colonic mucosal barrier function of mice with DSS-induced colitis
Pathological morphology changes of the colon tissue
Effects of M3G on the colonic mucosal barrier function
Effects of M3G on the colonic immune barrier function
Effects of M3G on the Notch signaling pathway in colon tissue
Associations between physiological index and the Notch signaling pathway
Discussion
Conclusions
Author contributions
Data availability
Acknowledgments
Conflict of interest
Rights and permissions
References
About this article
Next Previous
ARTICLE   Open Access    

Edible coatings for fresh produce: exploring chitosan, beeswax, and essential oils in green chillies and pointed gourd

  • Department of Food Technology and Nutrition, Lovely Professional University, Phagwara, Punjab 144411, India

More Information
  • In response to the rising global concerns over food sustainability and the pressing need to minimize waste, finding efficient, eco-friendly preservation techniques have become increasingly urgent to prevent environmental deterioration and ensure food security. The present study investigates the impact of edible coatings on the extended shelf life of pointed gourd and green chillies. A set of 3-point gourds and green chillies were divided into five groups – one was a control group, and the other four combinations of edible coatings were made of chitosan, chitosan with clove essential oil, beeswax, and beeswax with essential oil. Weight loss, visible decay, and visual surface colour change was evaluated. The control groups, to which no coating was applied, showed a loss in weight of 7.5% and visible decay starting from day 6. In contrast, the groups coated with chitosan showed a significantly reduced weight loss of 3.2% and delayed decay appearance until day 15. The most successful coating, however, was a combination of chitosan and clove essential oil. These outperformed the others by not only lowering weight loss to 1.8% but also delaying obvious degradation until day 15 at ambient temperature. The results showed that the coated samples experienced a longer shelf-life and less weight loss than the control sample. Further, the edible coatings with clove essential oil managed to reduce the microbial load of yeast and molds and it also increased antioxidant properties. Among the treated samples, chitosan incorporated with clove essential oil showed superiority in all enlisted parameters.

  • Introduction

    The intestinal mucosal barrier is composed of epithelial cells and intercellular connections, which can effectively regulate the transportation of large molecules in the intestinal lumen, and prevent microorganisms, harmful solutes, toxins, and intraluminal antigens from entering bodies[1]. Mucosal barrier factors such as trefoil factor (TFF) family, diamine oxidase (DAO), and transform growth factor-ɑ (TGF-α) have protective and restorative effects on intestinal mucosal integrity, which are synthesized and secreted by intestinal mucosa[2−4]. The damage to intestinal barrier function can cause the invasion of antigens and bacteria in the lumen, and eventually lead to intestinal diseases, including diarrhea, inflammatory bowel disease (IBD), and Crohn's disease[5−7].

    The Notch signaling pathway plays a crucial role in a series of cellular processes, including proliferation, differentiation, development, migration, and apoptosis. Research suggests that the Notch signaling pathway is involved in intestinal development, and it can be connected to intestinal cell lineage specification[8]. Furthermore, the Notch signaling pathway can regulate intestinal stem cells, CD4+T cells, innate lymphoid cells, macrophages, and intestinal microbiota, and intervene in the intestinal mucosal barriers in cases of ulcerative colitis[9]. The activated Notch signaling pathway can suppress the goblet cells differentiation and mucus secretion, which would result in the disruption of the intestinal mucosal barrier[10]. In addition, the absence of the Notch signaling pathway would cause the dysfunction of tight junctions and adherens junctions of intestinal mucosa, which could lead to increased permeability of epithelial cells and exposure of luminal contents to the immune system and inflammation[11]. Phytochemicals, such as cucurbitacin, honokiol and quercetin have been reported to have therapeutic effects on intestinal diseases by targeting the Notch signaling pathway[12−14].

    Plant-based diets rich in phytochemicals, such as phenolics, anthocyanins, and vitamins, have been related to the prevention of human diseases[15]. Anthocyanins belong to a subclass of flavonoids, and are mainly in the form of different anthocyanin combined with glucose, galactose, and arabinose[16]. The physiological action of anthocyanins, such as antioxidant activity, anti-inflammation, and anti-obesity effects have been widely reported[17,18]. M3G is found naturally in plants and is reported to be the most common anthocyanin in different blueberry varieties[19,20]. Previous researchers reported that M3G from blueberry suppressed the growth and metastasis potential of hepatocellular carcinoma cells, modulated gut microbial dysbiosis, and protected TNF-α induced inflammatory response injury in vascular endothelial cells[21−23]. Anthocyanins with diverse molecular structures and from different dietary sources are bioavailable at diet-relevant dosage rates, and anthocyanins from berry fruit are absorbed and excreted by both humans and rats[24]. Studies have shown that anthocyanins have a protective effect on intestinal barrier damage by regulating gut microbiota, tight junction (TJ) protein expression, and secretion of MUC2[25−27]. In addition to physiological indicators related to the intestinal barrier, the regulation of the Notch signaling pathway was involved in this study. Therefore, it is speculated that M3G could improve the colonic mucosal barrier function via the Notch signaling pathway.

    To prove this hypothesis, the effects of M3G on the colonic mucosal barrier function were investigated in DSS-induced colitis mice. The pathological morphology of the colon tissue, markers of intestinal physical barrier function and immune barrier function and the Notch signaling pathway were evaluated to reveal the mechanism of M3G in improving colonic mucosal barrier function. The results are expected to lay the foundation for the utilization of anthocyanins as a promising natural product for improving intestinal diseases.

    Materials and methods

    Materials

    M3G (CAS: 30113-37-2) used in this study was purchased from Xinyi Science and Technology Instrument Business Department, Baoji, Shanxi, China (HPLC ≥ 98%).

    Animal experiments

    Five-week-old male C57BL/6J mice (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) weighing 16−18 g were housed and given AIN-93M diet (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) feeding. The animal experiment was carried out according to the guidelines of the Standards for Laboratory Animals of China (GB 14922-94, GB 14923-94, and GB/T 14925-94) and the Ethics Committee of Shenyang Agricultural University (IACUC Issue No.: 2023022401). All animal housing and experiments were conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals.

    After acclimating to the breeding environment for one week, the mice were randomly divided into two groups: control group (CG group, n = 6) and model group (n = 12). On days 1−7, the mice of the model group were given 2.5% DSS (CAS: 9011-18-1) dissolved in drinking water, while the mice of the CG group were given the same volume of drinking water as the model group. On days 8−14, mice of the model group were randomly divided into two equal groups (n = 6): DSS group and M3G group. The mice of the CG and DSS groups were administered intragastrically via drinking water, and the mice of the M3G group were administered intragastrically by M3G (5 mg/kg body weight (BW)/d) dissolved in drinking water, and the liquid volume was controlled to be the same. For all groups of mice, the body weight, food consumption, stool consistency, and bloody stool were measured daily during the experiment. On day 15, mice were sacrificed after a 12 h fast, and the colon tissue samples of the mice were collected. The length of the colon tissue was measured and recorded.

    Histopathological analysis

    Hematoxylin-eosin (HE) staining

    Colon tissue was embedded with paraffin and then cut into sections. After being dewaxed from paraffin, the tissue was placed in water, and stained with hematoxylin and eosin solution. The stained tissue was dehydrated and sealed for observation. A microscope (BX53, Olympus Co., Ltd., Tokyo, Japan) was used to observe the stained tissue and photographed using 100× magnification. The damage in epithelial cells of colon tissue was evaluated.

    Periodic acid-schiff (PAS) staining

    The colon tissue was dewaxed and placed in water after being embedded with paraffin, and then stained with schiff and hematoxylin solution. The stained tissue was dehydrated and sealed for observation. A microscope was used to observe the stained tissue and photographed using 100× magnification. The mucosal thickness and the population of goblet cells of the colon tissue were measured and recorded.

    Real-time polymerase chain reaction (RT-PCR)

    The expression of MUC2 in colon tissue was detected by RT-PCR. Total RNA was extracted from colon tissue, and the concentration was determined using an ultraviolet spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The single-stranded cDNA of the extracted RNA (0.1 μL) was synthesized using a Transcriptor First Strand cDNA Synthesis Kit (Roche Co., Ltd., Basel, Kanton Basel, Switzerland). ExicylerTM 96 (Bioneer Corporation, Daejeon, Korea) was used to analyze the fluorescence quantitative cDNA. The reaction conditions were as follows: 94 °C for 5 min, 94 °C for 10 s, 60 °C for 20 s, 72 °C for 30 s, then followed by 40 cycles of 72 °C for 2 min 30 s, 40 °C for 1 min 30 s, and then melting from 60 to 94 °C, and incubating at 25 °C for 1−2 min. The primer sequences are shown in Table 1.

    Table 1.  The primer sequences used in the RT-PCR analysis.
    Gene Prime Sequence (5'-3') Size (bp)
    MUC2 Forward TGTGCCTGGCTCTAATA 17
    Reverse AGGTGGGTTCTTCTTCA 17
    β-actin Forward CTGTGCCCATCTACGAGGGCTAT 23
    Reverse TTTGATGTCACGCACGATTTCC 22
     | Show Table
    DownLoad: CSV

    Western blot analysis

    The whole proteins from the colon tissue (200 mg) were extracted using a Whole Cell Lysis Assay kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Briefly, colon tissue was cut into pieces, and then mixed with phenylmethylsulfonyl fluorid (PMSF), followed by adding the protein extraction reagents A and B to prepare the tissue homogenate. Protein concentration was then determined using a Bradford Kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The membranes were blocked with 5% non-fat dry milk in TBST buffer for 1 h, followed by incubating overnight at 4 °C with the appropriate monoclonal primary antibody (detailed information in Table 2). Then membranes were washed to remove non-bound antibodies, and then incubated with the secondary antibody (goat anti-rabbit immunoglobin G-horseradish peroxidase (IgG-HRP), 1:5000; Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) at 37 °C for 45 min. The enhanced chemiluminescence (ECL) western blotting detection reagent (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) was used to detect the protein bands, and then the protein bands were visualized by a Gel Imaging System (Beijing Liuyi Biotechnology Co., Ltd., Beijing, China).

    Table 2.  Details of the primary antibodies used in the experiment.
    Primary antibody Dilution ratio Manufacturer
    Claudin-1 1:500 Wanlei Bio Co., Ltd.
    Occludin 1:500 Wanlei Bio Co., Ltd.
    ZO-1 1:500 Wanlei Bio Co., Ltd.
    iFABP 1:1000 ABclonal Technology Co., Ltd.
    DLL1 1:500 Wanlei Bio Co., Ltd.
    DLL4 1:1000 ABclonal Technology Co., Ltd.
    Notch1 1:500 Wanlei Bio Co., Ltd.
    NICD 1:1000 Affinity Biosciences Co., Ltd.
    Hes1 1:1000 ABclonal Technology Co., Ltd.
    TFF3 1:1000 Affinity Biosciences Co., Ltd.
    β-actin 1:1000 Wanlei Bio Co., Ltd.
     | Show Table
    DownLoad: CSV

    Enzyme-linked immunosorbent assay (ELISA)

    The level of SIgA in colon tissue was detected by SIgA ELISA kit (Model number: EM1362, Wuhan Fine Biotech Co., Ltd., Wuhan, Hubei, China). The experiment was carried out according to the ELISA kit instructions.

    Flow cytometry (FCM)

    CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells in colonic lamina propria monocytes (LPMC) were detected by FCM. The colonic epithelial cells were isolated by adding digestive solution to the colon tissue. After digestion, screening, re-suspension precipitation, and centrifugation, the precipitate was collected as colonic LPMC. Labeled antibodies were added to the flow tube and incubated according to the instructions. After washing with phosphate buffered saline (PBS), the cells were re-suspended in PBS solution. The CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells were detected by flow cytometric (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Statistical analysis

    Data are expressed as mean ± standard deviation (SD) based on six replicates. Differences between two groups were assessed using Student's t tests. The results were considered statistically significant at p < 0.05. Data were analyzed using Graph Pad Prism 8.0 (Graph Pad Software, San Diego, CA, USA) and SPSS 17.0 (IBM Corporation, Armonk, NY, USA).

    Results

    Effects of M3G on the body weight gain, DAI score, and food intake of mice with DSS-induced colitis

    The body weight of mice was monitored daily during the experimental period. As shown in Fig. 1a, after being fed with DSS for 7 d, the body weight of the mice in the DSS group was reduced significantly (p < 0.01) compared with that of the CG group. While the body weight of the mice in the M3G group was increased, and exhibited significantly higher (p < 0.01) body weight gain compared with the DSS group. The DAI score of the mice in the DSS group was significantly higher (p < 0.01) than that of the CG group, but M3G supplementation significantly lowered (p < 0.01) the DAI score (Fig. 1b), which demonstrates that the DSS-induced mice colitis model was established successfully and M3G inhibited colon tissue damage in DSS-fed mice. Compared with the CG group, the food intake of the mice fed with DSS was significantly reduced (p < 0.01), and M3G supplementation significantly increased (p < 0.05) the food intake (Fig. 1c).

    Figure 1.  Effect of M3G on body weight gain, DAI score, and food intake in mice. (a) Body weight gain. (b) DAI score (Fecal consistency: 0 = normal, 1 = semi-formed, 2 = soft stool, 3 = diarrhea or watery stool; bloody stool: 0 = occult blood negative, 1 = occult blood positive, 2 = visible bloody stool, 3 = massive hemorrhage; weight loss: 0 = 0%, 1 = 1%−5 %, 2 = 6%−10% ; 3 = 11%−15% reduction). (c) Food intake. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.
    DownLoad: Full-Size Img PowerPoint

    Effects of M3G on the colonic mucosal barrier function of mice with DSS-induced colitis

    Pathological morphology changes of the colon tissue

    Representative HE and PAS-stained sections of the colon are shown in Fig. 2a & b. The morphology of colon tissue in the CG group did not exhibit any damage, while damage in epithelial cells and goblet cells, inflammatory cells infiltration, and separation of the muscle layer and mucosal muscle layer were observed in the DSS group. The above damage to the tissue was changed for the better by M3G supplementation, with only small levels of damage in epithelial cells and goblet cells, inflammatory cell infiltration, and separation of the muscle layer and mucosal muscle layer compared to that in the CG group.

    Figure 2.  Effect of M3G on the pathological morphology of colon tissue. (a) HE staining of colon tissue. Original magnifications: 100×. (b) PAS staining of colon tissue. Original magnifications: 100×. (c) The damage score of colon tissue. (1) Epithelial cell damage: 0 = normal morphology; 1 = regional destruction of the epithelial surface; 2 = diffuse epithelial destruction and/or mucosal ulcers involving submucosa; 3 = severe epithelial damage. (2) Inflammatory cell infiltration: 0 = no infiltration or less than 5 cells; 1 = mild infiltration of the inherent layer; 2 = moderate infiltration of the muscular mucosa; 3 = high infiltration of the muscular mucosa; 4 = severe infiltration involving submucosa. (3) Separation of muscle layer and mucosal muscle layer: 0 = normal; 1 = moderate; 2 = severe. (4) Goblet cell depletion: 0 = no depletion; 1 = presence of disordered goblet cells; 2 = 1 to 3 regions without goblet cells; 3 = more than 3 regions without goblet cells; 4 = complete depletion of goblet cells. (d) The colon length. (e) The mucosal thickness of colon tissue. (f) Number of goblet cells in colon tissue. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.
    DownLoad: Full-Size Img PowerPoint

    HE score was calculated to evaluate the degree of colon tissue damage. The HE score in the DSS group was significantly higher (p < 0.01) than that in the CG group. Supplementation of M3G significantly reduced (p < 0.01) the score, which decreased by almost 50% of that in the DSS group (Fig. 2c). The colon length in the DSS group was significantly lower (p < 0.01) than that in the CG group, which was significantly increased (p < 0.01) by M3G supplementation (Fig. 2d). The mucosal thickness and the number of goblet cells of the colon tissue were determined by PAS staining. Compared with the CG group, the mucosal thickness and the number of goblet cells of the colon tissue were significantly decreased (p < 0.01) in the DSS group, but those were significantly increased (p < 0.01) in the M3G group (Fig. 2e & f). These results suggest that M3G supplementation can decrease the pathological damage in the colon tissue induced by DSS.

    Effects of M3G on the colonic mucosal barrier function

    The mRNA expression level of MUC2 in the colonic mucosa tissue was determined. Compared with the CG group, DSS significantly decreased (p < 0.01) the mRNA level of MUC2, but this effect was significantly suppressed (p < 0.01) by M3G supplementation (Fig. 3a). The protein levels of claudin-1, occludin, ZO-1, iFABP, and TFF3 in the colon tissue were subsequently assessed. The protein expression levels of claudin-1, occludin, and ZO-1 in the DSS group were significantly lower than those in the CG group (p < 0.01). M3G supplementation significantly inhibited (p < 0.01) the reduction in the expression of these proteins (Fig. 3b−d). Regarding the protein expression level of iFABP, it was significantly higher (p < 0.01) in the DSS group than that in the CG group. M3G supplementation significantly decreased (p < 0.01) iFABP expression level compared with the DSS group (Fig. 3e). The protein expression level of TFF3 was significantly higher (p < 0.01) in the DSS group than that in the CG group. However, M3G supplementation significantly intensified (p < 0.01) the increase of TFF3 expression compared with the DSS group (Fig. 3f). These results indicate that M3G can regulate colonic epithelial barrier function.

    Figure 3.  Effects of M3G on the colonic epithelial barrier disruption. (a) The mRNA expression level of MUC2. (b) The protein expression level of claudin-1. (c) The protein expression level of occludin. (d) The protein expression level of ZO-1. (e) The protein expression level of iFABP. (f) The protein expression level of TFF3. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.
    DownLoad: Full-Size Img PowerPoint
    Effects of M3G on the colonic immune barrier function

    The content of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in colonic LPMC of mice in each group were detected by FCM as shown in Fig. 4 and Supplemental Fig. S1. Compared with the CG group, the percentages of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in the DSS group were significantly increased (p < 0.01), and those were significantly decreased (p < 0.05) after M3G supplementation (Fig. 4a & b). SIgA was measured as an indicator of immune barrier function in the colon tissue. The level of SIgA in the DSS group was significantly lower (p < 0.01) than that in the CG group. Supplementation of M3G significantly raised (p < 0.01) the level of SIgA (Fig. 4c). These results indicate that M3G can improve the colonic immune dysfunction induced by DSS.

    Figure 4.  Effect of M3G on the colonic immune barrier function. (a) The percentage of CD4+T (CD3+CD4+) cells in the colon tissue. (b) The percentage of CD8+T (CD3+CD8+) cells in the colon tissue. (c) The level of SIgA in the colonic mucosal tissue. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.
    DownLoad: Full-Size Img PowerPoint

    Effects of M3G on the Notch signaling pathway in colon tissue

    Subsequently, the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in the colon tissue were measured (Fig. 5). DSS significantly up-regulated (p < 0.01) these protein expression levels compared with the CG group. M3G supplementation significantly (p < 0.01) down-regulated the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in comparison with the DSS group. The results indicate that M3G can inhibit the over-activation of the Notch signaling pathway.

    Figure 5.  Effects of M3G on the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in the colon tissue. (a) The protein expression level of Notch1. (b) The protein expression level of NICD. (c) The protein expression level of DLL4. (d) The protein expression level of DLL1. (e) The protein expression level of Hes1. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.
    DownLoad: Full-Size Img PowerPoint

    Associations between physiological index and the Notch signaling pathway

    To explain the relationships between them, the Spearman r correlations between biomarkers and the Notch signaling pathway were analyzed, and represented using a heatmap. As shown in Fig. 6, colon length, food intake, ZO-1, number of goblet, MUC2, SIgA, claudin-1, occludin, body weight gain, and mucosal thickness were significantly (p < 0.01 or p < 0.05) positively correlated with Notch1, NICD, DLL4, DLL1, and Hes1. Conversely, HE score, iFABP, DAI score, CD4+T, and CD8+T were significantly (p < 0.01) negatively correlated with Notch1, NICD, DLL4, DLL1 and Hes1. In particular, TFF3 was only significantly (p < 0.05) positively correlated with DLL1, and Hes1. The results indicate that M3G may ameliorate the colonic mucosal barrier dysfunction via modulation of the Notch signaling pathway.

    Figure 6.  Heatmap of the Spearman r correlations between biomarkers and the Notch signaling pathway. * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.
    DownLoad: Full-Size Img PowerPoint

    Discussion

    Within the last five years, special attention is being paid to the therapeutic effects of anthocyanins. The recent studies could give evidence to prove the therapeutic potential of anthocyanins from different sources against various diseases via in vitro, in vivo, and epidemiological experiments[28]. The anthocyanin supplementation has been demonstrated to have positive effects on intestinal health[29]. The intestinal barrier is one of the crucial factors which can affect intestinal health and normal intestinal barrier function not only maintains intestinal health but also protects overall health by protecting the body from intestine injury, pathogen infection, and disease occurrence[30]. The disruption of intestinal barrier integrity is regarded as an important factor leading to IBD, obesity, and metabolic disorders[31−33]. In this study, the effects of M3G on regulating the colonic physical barrier function and colonic immune barrier function in DSS-induced colitis mice were explored.

    M3G supplementation reduced the DAI score and the HE score of colon tissue, and restored colon length, mucosal thickness, and the number of goblet cells in the colon tissue, indicating that M3G can alleviate DSS-induced colon tissue damage and colitis symptoms in mice. The DAI score was developed as a simplified clinical colitis activity index to assess the severity of colitis[34]. Zhao et al. have found that black rice anthocyanin-rich extract can significantly decrease the DAI and HE scores of colon tissue in DSS-induced colitis mice[35]. Intestinal goblet cells are mainly differentiated from multipotential stem cells. Intestinal stem cells were located at the base of the crypt and distributed in intestinal mucosal epithelial cells, composing around 50% of colon epithelial cells[36]. The mucus layer is formed by goblet cell secretion, it separates the intestinal epithelium from the intestinal lumen, thereby preventing the invasion of pathogenic microorganisms and the translocation of intestinal microbiota[37]. The results suggested that M3G might repair the colonic mucosa by increasing the number of goblet cells.

    MUC2 is the most abundant mucin secreted by goblet cells of the colon, goblet cells, and MUC2 play important roles in maintaining and protecting the intestinal mucosal barrier[38]. M3G supplementation restored the level of MUC2 by nearly double that of the DSS group. Claudin-1, occludin, and ZO-1 are TJ proteins, which is an important component of the intestinal physical barrier[39]. M3G supplementation mitigated the down-regulation of claudin-1, occludin, and ZO-1 in DSS-induced colitis mice. Wang et al. have found that Lonicera caerulea polyphenols can increase the expression levels of occludin in HFD rats[40]. Chen et al. have found that purple-red rice anthocyanins alleviated intestinal barrier dysfunction in cyclophosphamide-induced mice by up-regulating the expression of tight junction proteins[41]. iFABP can serve as a biomarker of small bowel damage in coeliac disease and Crohn's disease, and supplementation of M3G down-regulated the expression level of iFABP in colon tissue[42]. It has been reported that TFF3 alleviated the intestinal barrier function by reducing the expression of TLR4 in rats with nonalcoholic steatohepatitis, and supplementation of M3G increased the expression level of TFF3 in this research[43]. Although the effect of M3G on epithelial TJ proteins and other related proteins were limited, the beneficial effect of M3G on the colonic mucosal barrier function was supported by histological evaluation.

    The intestinal immune barrier is composed of intestinal mucosal lymphoid tissue and intestinal plasma cell secreted antibodies. Inflammatory damage in acute colitis influences the gut microbiota, epithelial barrier, and immune function in subsequent colitis[44]. Fructose can influence colon barrier function by regulating some main physical, immune, and biological factors in rats[45]. SIgA, CD4+T cells, and CD8+T cells play important roles in the functioning of the human immune system. The results indicated that M3G supplementation can maintain the colonic immune barrier function by modulating the level of SIgA, and the percentages of CD4+T cells and CD8+T cells of colon tissue.

    Notch signaling pathways are important for the maintenance of intestinal epithelial barrier integrity, and its abnormal activation is related to IBD and colon cancer[46]. Among the four Notch receptors in mammals, the most scattered in the intestine is Notch1[47]. NICD is the active form of the Notch receptor, NICD enters the nucleus, binds to the recruitment co-activator transcription complex, and then combines with the Hes gene to regulate the fate of cells[48,49]. DLL1 and DLL4 can serve as ligands for Notch signaling receptors[50]. Lin et al. found that qingbai decoction had beneficial effects on the mucus layer and mechanical barrier of DSS-induced colitis by inhibiting Notch signaling[51]. Supplementation with M3G significantly down-regulated Notch1, NICD, DLL4, DLL1, and Hes1 expression levels in the colon tissue, and there is a significant correlation between biomarkers and Notch signaling pathway-related proteins, suggesting that M3G might sustain the colonic barrier function via inhibiting the Notch signaling pathway.

    Conclusions

    The present results showed that M3G exerted an improvement effect on the colonic mucosal barrier (physical barrier and immune barrier) function in DSS-induced colitis mice. The positive impact of M3G on the colonic mucosal barrier function may be ascribed to the modulation of permeability, stability, and integrity of the colonic mucosa by down-regulating the Notch signaling pathway. The results provide theoretical support for anthocyanins as the raw materials of functional products related to intestinal health. However, this study also has limitations, such as lacking intensive research on the effect mechanisms through cell experiments. Therefore, intensive research and clinical tests are the future direction.

    Author contributions

    The authors confirm contribution to the paper as follows: study conception and design: Zhang C, Jiao X; data collection: Zhang L; analysis and interpretation of results: Zhang C, Zhang L, Zhang B, Zhang Y; draft manuscript preparation: Zhang C, Wang Y, Tan H, Li L, Jiao X. All authors reviewed the results and approved the final version of the manuscript.

    Data availability

    The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

    Acknowledgments

    We would like to thank the Liaoning Provincial Department of Education Project - General Project (LJKMZ20221060).

  • The authors declare that they have no conflict of interest.

  • [1]

    Jeswani HK, Figueroa-Torres G, Azapagic A. 2021. The extent of food waste generation in the UK and its environmental impacts. Sustainable Production and Consumption 26:532−47

    doi: 10.1016/j.spc.2020.12.021

    CrossRef   Google Scholar

    [2]

    Alegbeleye O, Odeyemi OA, Strateva M, Stratev D. 2022. Microbial spoilage of vegetables, fruits and cereals. Applied Food Research 2(1):100122

    doi: 10.1016/j.afres.2022.100122

    CrossRef   Google Scholar

    [3]

    Saikumar A, Singh A, Dobhal A, Arora S, Junaid PM, et al. 2023. A review on the impact of physical, chemical, and novel treatments on the quality and microbial safety of fruits and vegetables. Systems Microbiology and Biomanufacturing 4(2):575−97

    doi: 10.1007/s43393-023-00217-9

    CrossRef   Google Scholar

    [4]

    Ramakrishnan R, Kulandhaivelu SV, Roy S. 2023. Alginate/carboxymethyl cellulose/starch-based active coating with grapefruit seed extract to extend the shelf life of green chilli. Industrial Crops and Products 199:116752

    doi: 10.1016/j.indcrop.2023.116752

    CrossRef   Google Scholar

    [5]

    Chavan P, Lata K, Kaur T, Rezek Jambrak A, Sharma S, et al. 2023. Recent advances in the preservation of postharvest fruits using edible films and coatings: A comprehensive review. Food Che mistry 418:135916

    doi: 10.1016/j.foodchem.2023.135916

    CrossRef   Google Scholar

    [6]

    Khatodiya N, Malik M. 2022. Effects of edible coating on fresh-cut fruits. Journal of Pharmacognosy and Phytochemistry 11(1):192−99

    doi: 10.22271/phyto.2022.v11.i1c.14342

    CrossRef   Google Scholar

    [7]

    Mukherjee PK, Singha S, Kar A, Chanda J, Banerjee S, et al. 2022. Therapeutic importance of Cucurbitaceae: A medicinally important family. Journal of Ethnopharmacology 282:114599

    doi: 10.1016/j.jep.2021.114599

    CrossRef   Google Scholar

    [8]

    Pandey S, Dubey RK. 2023. Crop for future/neglected and underutilized vegetables on FAO perspective for Bharat. International Seminar on Exotic and Underutilized Horticultural Crops: Priorities & Emerging Trends, October 17−19, 2023. Bengaluru: ICAR-IIHR.
    [9]

    Kumar JH, Shaker BRM, Chaitanya V, Ranjitha PS, Kumar KR, et al. 2022. Post-harvest profile and marketing constraints in cultivation of chilli in Khammam district of Telangana. Pharma Research 11(4):1663−69

    Google Scholar

    [10]

    Devi MB, Chanu LJ, Verma VK, Talang HD, Rymbai H, et al. 2022. King chilli (Capsicum chinense Jacq.): a potential species of capsicum for sustainability and income enhancement for tribal farmers of NEH region. PME Publication no. 79. Kisan Mela'on Empowering tribal farmers through technology led farming at ICAR, Mizoram Centre, Kolasib, 14-15 November, 2022. Umiam, Meghalaya, India: ICAR Research Complex for NEH Region. 128 pp.
    [11]

    Perdana T, Kusnandar K, Perdana HH, Hermiatin FR. 2023. Circular supply chain governance for sustainable fresh agricultural products: Minimizing food loss and utilizing agricultural waste. Sustainable Production and Consumption 41:391−403

    doi: 10.1016/j.spc.2023.09.001

    CrossRef   Google Scholar

    [12]

    Gupta V, Biswas D, Roy . 2022. A comprehensive review of biodegradable polymer-based films and coatings and their food packaging applications. Materials 15(17):5899

    doi: 10.3390/ma15175899

    CrossRef   Google Scholar

    [13]

    Pillai ARS, Eapen AS, Zhang W, Roy S. 2024. Polysaccharide-based edible biopolymer-based coatings for fruit preservation: a review. Foods 13(10):1529

    doi: 10.3390/foods13101529

    CrossRef   Google Scholar

    [14]

    Pandita G, de Souza CK, Gonçalves MJ, Jasińska JM, Jamróz E, et al. 2024. Recent progress on Pickering emulsion stabilized essential oil added biopolymer-based film for food packaging applications: A review. International Journal of Biological Macromolecules 269:132067

    doi: 10.1016/j.ijbiomac.2024.132067

    CrossRef   Google Scholar

    [15]

    Díaz-Montes E, Castro-Muñoz R. 2021. Edible films and coatings as food-quality preservers: an overview. Foods 10(2):249

    doi: 10.3390/foods10020249

    CrossRef   Google Scholar

    [16]

    Ghosh T, Dash KK. 2020. Modeling on respiration kinetics and modified atmospheric packaging of fig fruit. Journal of Food Measurement and Characterization 14:1092−104

    doi: 10.1007/s11694-019-00359-2

    CrossRef   Google Scholar

    [17]

    Chhikara S, Kumar D. 2022. Edible coating and edible film as food packaging material: A review. Journal of Packaging Technology and Research 6(1):1−10

    doi: 10.1007/s41783-021-00129-w

    CrossRef   Google Scholar

    [18]

    Donhowe IG, Fennema O. 1993. The effects of plasticizers on crystallinity, permeability, and mechanical properties of methylcellulose films. Journal of Food Processing and Preservation 17(4):247−57

    doi: 10.1111/j.1745-4549.1993.tb00729.x

    CrossRef   Google Scholar

    [19]

    Zuhal OKCU, Yavuz Y, Kerse S. 2018. Edible film and coating applications in fruits and vegetables. Alinteri Journal of Agriculture Science 33(2):221−26

    Google Scholar

    [20]

    Hauzoukim SS, Mohanty B. 2020. Functionality of protein-Based edible coating. Journal of Entomology and Zoology Studies 8(4):1432−40

    Google Scholar

    [21]

    Roy S, Ramakrishnan R, Goksen G, Singh S, Łopusiewicz Ł. 2024. Recent progress on UV-light barrier food packaging films – a systematic review. Innovative Food Science & Emerging Technologies 91:103550

    doi: 10.1016/j.ifset.2023.103550

    CrossRef   Google Scholar

    [22]

    Kocira A, Kozłowicz K, Panasiewicz K, Staniak M, Szpunar-Krok E, et al. 2021. Polysaccharides as edible films and coatings: characteristics and influence on fruit and vegetable quality—a review. Agronomy 11(5):813

    doi: 10.3390/agronomy11050813

    CrossRef   Google Scholar

    [23]

    Nehra A, Biswas D, Siracusa V, Roy S. 2022. Natural gum-based functional bioactive films and coatings: a review. International Journal of Molecular Sciences 24(1):485

    doi: 10.3390/ijms24010485

    CrossRef   Google Scholar

    [24]

    Bose I, Roy S, Pandey VK, Singh R. 2023. A Comprehensive Review on Significance and Advancements of Antimicrobial Agents in Biodegradable Food Packaging. Antibiotics 12(6):968

    doi: 10.3390/antibiotics12060968

    CrossRef   Google Scholar

    [25]

    Bhagath YB, Manjula K. 2019. Influence of composite edible coating systems on preservation of fresh meat cuts and products: a brief review on their trends and applications. International Food Research Journal 26(2):377−92

    Google Scholar

    [26]

    Adiletta G, Di Matteo M, Petriccione M. 2021. Multifunctional role of chitosan edible coatings on antioxidant systems in fruit crops: A review. International Journal of Molecular Sciences 22(5):2633

    doi: 10.3390/ijms22052633

    CrossRef   Google Scholar

    [27]

    Roy S, Min SJ, Rhim JW. 2023. Essential oil-added chitosan/gelatin-based active packaging film: a comparative study. Journal of Composites Science 7(3):126

    doi: 10.3390/jcs7030126

    CrossRef   Google Scholar

    [28]

    Nair MS, Tomar M, Punia S, Kukula-Koch W, Kumar M. 2020. Enhancing the functionality of chitosan-and alginate-based active edible coatings/films for the preservation of fruits and vegetables: a review. International Journal of Biological Macromolecules 164:304−20

    doi: 10.1016/j.ijbiomac.2020.07.083

    CrossRef   Google Scholar

    [29]

    Sousa FF, Pinsetta Junior JS, Oliveira KTEF, Rodrigues ECN, Andrade JP, et al. 2021. Conservation of 'Palmer' mango with an edible coating of hydroxypropyl methylcellulose and beeswax. Food Chemistry 346:128925

    doi: 10.1016/j.foodchem.2020.128925

    CrossRef   Google Scholar

    [30]

    Zhao R, Zhang Y, Chen H, Song R, Li Y. 2022. Performance of eugenol emulsion/chitosan edible coating and application in fresh meat preservation. Journal of Food Processing and Preservation 46(3):e16407

    doi: 10.1111/jfpp.16407

    CrossRef   Google Scholar

    [31]

    Nasrin TAA, Rahman MA, Arfin MS, Islam MN, Ullah MA. 2020. Effect of novel coconut oil and beeswax edible coating on postharvest quality of lemon at ambient storage. Journal of Agriculture and Food Research 2:100019

    doi: 10.1016/j.jafr.2019.100019

    CrossRef   Google Scholar

    [32]

    Bhattacharjee D, Dhua RS. 2018. Enhancing postharvest storage life of pointed gourd (Trichosanthes dioica Roxb.) fruits with edible coatings. Journal of Pharmacognosy and Phytochemistry 7(5):607−11

    Google Scholar

    [33]

    Chitravathi K, Chauhan OP, Raju PS. 2014. Postharvest shelf-life extension of green chillies (Capsicum annuum L.) using shellac-based edible surface coatings. Postharvest Biology and Technology 92:146−48

    doi: 10.1016/j.postharvbio.2014.01.021

    CrossRef   Google Scholar

    [34]

    Priyadarshi R, Sauraj, Kumar B, Negi YS. 2018. Chitosan film incorporated with citric acid and glycerol as an active packaging material for extension of green chilli shelf life. Carbohydrate Polymers 195:329−38

    doi: 10.1016/j.carbpol.2018.04.089

    CrossRef   Google Scholar

    [35]

    Abdel-Naeem HHS, Sallam KI, Malak NML. 2021. Improvement of the microbial quality, antioxidant activity, phenolic and flavonoid contents, and shelf life of smoked herring (Clupea harengus) during frozen storage by using chitosan edible coating. Food Control 130:108317

    doi: 10.1016/j.foodcont.2021.108317

    CrossRef   Google Scholar

    [36]

    Kumar N, Neeraj, Pratibha, Singla M. 2020. Enhancement of storage life and quality maintenance of litchi (Litchi chinensis Sonn.) fruit using chitosan: Pullulan blend antimicrobial edible coating. International Journal of Fruit Science 20:S1662−S1680

    doi: 10.1080/15538362.2020.1828224

    CrossRef   Google Scholar

    [37]

    Mihafu FD, Issa JY, Kamiyango MW. 2020. Implication of sensory evaluation and quality assessment in food product development: A review. Current Research in Nutrition and Food Science Journal 8(3):690−702

    doi: 10.12944/CRNFSJ.8.3.03

    CrossRef   Google Scholar

    [38]

    Tokatlı K, Demirdöven A. 2020. Effects of chitosan edible film coatings on the physicochemical and microbiological qualities of sweet cherry (Prunus avium L.). Scientia Horticulturae 259:108656

    doi: 10.1016/j.scienta.2019.108656

    CrossRef   Google Scholar

    [39]

    Ramakrishnan R, Kulandhaivelu SV, Roy S, Viswanathan VP. 2023. Characterisation of ternary blend film of alginate/carboxymethyl cellulose/starch for packaging applications. Industrial Crops and Products 193:116114

    doi: 10.1016/j.indcrop.2022.116114

    CrossRef   Google Scholar

    [40]

    Chitravathi K, Chauhan OP, Raju PS. 2016. Shelf-life extension of green chillies (Capsicum annuum L.) using shellac-based surface coating in combination with modified atmosphere packaging. Journal of Food Science and Technology 53:3320−28

    doi: 10.1007/s13197-016-2309-6

    CrossRef   Google Scholar

    [41]

    Muthmainnah N, Suratman, Solichatun. 2019. Postharvest application of an edible coating based on chitosan and gum Arabic for controlling respiration rate and vitamin C content of chilli (Capsicum frustecens L.). IOP Conference Series: Materials Science and Engineering 633(1):012028

    doi: 10.1088/1757-899x/633/1/012028

    CrossRef   Google Scholar

    [42]

    Petriccione M, Mastrobuoni F, Pasquariello MS, Zampella L, Nobis E, et al. 2015. Effect of chitosan coating on the postharvest quality and antioxidant enzyme system response of strawberry fruit during cold storage. Foods 4(4):501−23

    doi: 10.3390/foods4040501

    CrossRef   Google Scholar

    [43]

    Roy S, Rhim JW. 2021. Gelatin/agar-based functional film integrated with Pickering emulsion of clove essential oil stabilized with nanocellulose for active packaging applications. Colloids and Surfaces A: Physicochemical and Engineering Aspects 627:127220

    doi: 10.1016/j.colsurfa.2021.127220

    CrossRef   Google Scholar

    [44]

    Mwelase S, Kaseke T, Fawole OA. 2023. Development and optimization of methylcellulose-based edible coating using response surface methodology for improved quality management of ready-to-eat pomegranate arils. CyTA - Journal of Food 21(1):656−65

    doi: 10.1080/19476337.2023.2274942

    CrossRef   Google Scholar

  • Cite this article

    Vidyarthi EV, Thakur M, Khela RK, Roy S. 2024. Edible coatings for fresh produce: exploring chitosan, beeswax, and essential oils in green chillies and pointed gourd. Food Materials Research 4: e026 doi: 10.48130/fmr-0024-0017
    Vidyarthi EV, Thakur M, Khela RK, Roy S. 2024. Edible coatings for fresh produce: exploring chitosan, beeswax, and essential oils in green chillies and pointed gourd. Food Materials Research 4: e026 doi: 10.48130/fmr-0024-0017
    shu

Tables(6)

Download PDF

Article Metrics

Article views(2582) PDF downloads(545)

Other Articles By Authors

ARTICLE   Open Access    

Edible coatings for fresh produce: exploring chitosan, beeswax, and essential oils in green chillies and pointed gourd

  • Department of Food Technology and Nutrition, Lovely Professional University, Phagwara, Punjab 144411, India

  • Received: 06 June 2024
  • Revised: 08 July 2024
  • Accepted: 15 July 2024
  • Published online: 09 October 2024
Food Materials Research  4,  Article number: e026  (2024)  |  Cite this article

Abstract: In response to the rising global concerns over food sustainability and the pressing need to minimize waste, finding efficient, eco-friendly preservation techniques have become increasingly urgent to prevent environmental deterioration and ensure food security. The present study investigates the impact of edible coatings on the extended shelf life of pointed gourd and green chillies. A set of 3-point gourds and green chillies were divided into five groups – one was a control group, and the other four combinations of edible coatings were made of chitosan, chitosan with clove essential oil, beeswax, and beeswax with essential oil. Weight loss, visible decay, and visual surface colour change was evaluated. The control groups, to which no coating was applied, showed a loss in weight of 7.5% and visible decay starting from day 6. In contrast, the groups coated with chitosan showed a significantly reduced weight loss of 3.2% and delayed decay appearance until day 15. The most successful coating, however, was a combination of chitosan and clove essential oil. These outperformed the others by not only lowering weight loss to 1.8% but also delaying obvious degradation until day 15 at ambient temperature. The results showed that the coated samples experienced a longer shelf-life and less weight loss than the control sample. Further, the edible coatings with clove essential oil managed to reduce the microbial load of yeast and molds and it also increased antioxidant properties. Among the treated samples, chitosan incorporated with clove essential oil showed superiority in all enlisted parameters.

    HTML

    Introduction

    • The process of degradation and spoilage occurs naturally in all fruits and vegetables. It can happen as soon as the nutrients are removed. During ripening and senescence, these vegetables are at risk of developing decay. A significant portion of the vegetables and fruits produced worldwide are lost due to spoilage[1]. Various microbes capable of causing infections and microbiological decay in fruits and vegetables can contaminate the food at any point from farm to table. Microorganisms such as molds, yeasts, and both beneficial and harmful bacteria contribute to the spoilage of fruits and vegetables. While parasites pose a potential threat to food safety, their impact on the sensory qualities of produce is minimal, and they are not commonly associated with the deterioration of whole or freshly cut vegetables[2]. Maintenance of the microbiological integrity of fresh vegetables and fruits during commercial production and distribution processes is challenging, as produce retains metabolic activity while moving from the time of maturity to the period reaching senescence, and total degeneration. When purchasing fresh fruits, consumers typically evaluate their quality based on appearance and freshness[3]. Coating, a technique involving the application of a protective layer on fruits or vegetables, serves to inhibit microbial intrusion and reduce decay. These coatings, applicable through rubbing, spraying, or immersion, employ environmentally friendly ingredients[4]. In the realm of fresh produce, edible coatings have traditionally served to mitigate harm to vegetable cells, achieving prolonged shelf life by diminishing moisture content, solute dispersion, gas exchange, aerobic respiration, oxidative reactions, and visible disorders[5]. This technology applies not only to whole and freshly cut fruits and vegetables but also to nuts, seeds, and cheese. The simplicity of application and the use of eco-friendly components make these coatings a viable solution for enhancing food preservation and safety in the fresh produce sector[6].

      Belonging to the Cucurbitaceae family, the pointed gourd (Trichosanthes dioica Roxb.), often referred to as the king of gourds, is renowned for its enhanced nutritional and therapeutic properties, particularly in regulating blood sugar and total cholesterol levels. Native to the Indian subcontinent, these gourds are initially classified as non-climacteric but exhibit climacteric behaviour post-harvest, marked by an increased respiration rate. Traditional storage methods prove inefficient as the fruits quickly deteriorate, displaying symptoms such as shrivelling, skin yellowing, hard seed development, and susceptibility to fungal infections[7]. Pointed gourds experience substantial moisture loss (8%–9%) from their initial weight, leading to pronounced surface wrinkling, and they exhibit a very short shelf life of 3–4 d under standard storage conditions. Rapid chlorophyll depletion results in the pulp and skin turning yellow, making such gourds less appealing to consumers. In response, traders and retailers resort to the use of potentially harmful chemicals to enhance the fruits appearance and extend its shelf life. Solutions containing copper sulphate and malachite green are usually applied to mask the undesirable yellow color of the fruit[8].

      A vital economic crop and commonly used spice, the chilli plant, scientifically known as Capsicum annuum L. and belonging to the Solanaceae family, faces various postharvest challenges. Notably, its short shelf life, high perishability, and susceptibility to fungal diseases result in quality deterioration, chilling damage when stored below 7 °C, and rapid weight loss leading to shrivelling. Despite these challenges, chilli remains a globally significant cash crop, highly valued for its widespread use as a spice[9]. India holds a central position in influencing the global chili market, contributing around 36% of the world's chili production, surpassing 1.4 million tons. Remarkably, India is the foremost chilli exporter globally, claiming a 25% share in international trade and exporting 0.209 million tons, solidifying its dominance in the global chilli landscape[10]. Challenges arise from the innate non-climacteric nature of green chillies. Their vulnerability to microbial infections is exacerbated by the elevated moisture content, ranging from 60% to 85% at harvest. Losses in the chilli supply chain predominantly result from moisture content (15%–25%), field spoilage (1%–10%), transportation from fields to factories (6%–10%), and losses during assembly for distribution (2.5%–5%). Addressing these factors is crucial for mitigating losses and ensuring the efficiency of the chilli supply chain[11].

      An edible coating is a type of barrier that helps to maintain the quality and freshness of vegetables and fruits by preventing oxidation, dehydration, and microbial contamination[12,13]. One possible strategy to lessen postharvest deterioration and maintain quality during storage appears to be the application of a coating that is edible. It enhances the physical attributes and flavor of fruits and vegetables by adding essential oils. Due to their antioxidant, antimicrobial, and flavour-enhancing properties, the addition of essential oils in these coatings has gained widespread attention[14]. In addition to being able to enhance the appearance and flavor of fruits and vegetables, essential oils can also help preserve them by providing natural compounds such as eugenol[15]. The essential goal of consumable coating is to restore or strengthen the natural barricade where it has been eliminated by transporting and cleaning. Additionally, it does not give the product any unfavourable qualities and can be taken without any harm to health. Fruit respiration rate is slowed down, water loss is prevented, texture and flavour are preserved, and fragrance compounds, moisture exchange, and partial barriers to CO2 and O2 are all partially blocked by edible coatings[16].

      By the ingredients utilized during preparation, edible coatings are divided into three categories: (i) lipids like waxes, acylglycerol, and fatty acids; (ii) proteins or polysaccharides, and (iii) composites[17,18]. Lipid coatings have superior water vapour barrier qualities because they are hydrophobic. Lipid materials are often used to improve the appearance of fruits and vegetables even though they are not able to polymerize on their own. Examples consist of waxes and natural resins (gum), essential oils of citrus fruits (camphor), and animal and vegetable oils (coconut, peanut, palm, cacao, butter, fatty acids)[19]. Proteins have more flexible structures than lipids and polysaccharides, which allows them to create bonds in a variety of locations and provide films with better mechanical properties. The dietary quality of the coated foodstuffs is improved by these protein-based films, which also function as efficient coatings. This group includes plant-based proteins like corn, soy, wheat, cottonseed, rice, and peanut as well as proteins like casein, whey protein, gelatine, and egg albumin[20]. Polysaccharide coatings are susceptible to significant moisture absorption due to their hydrophilic properties. They do, however, stick effectively to the cross sections of vegetables and fruits and have minimal permeability to gases[21]. This category includes natural gums (acacia, gum arabic, guar, etc.)[22,23]. Composite-based multicomponent edible coats are also used in this regard. Composite coatings are made up of lipid-based compounds, proteins, and polysaccharides. It can be utilized to decrease the gas permeation and increase the strength and water vapour resistance[24]. Composites can be divided into the following two groups by combined entities and bilayer materials. Double-layer composites are prepared using two layers linked with the same or different coating materials. Examples of these coating materials are protein/protein, polysaccharides + protein, lipid + lipid, lipid + polysaccharides, etc.[25].

      Chitin and chitosan are biopolymers that offer a vast array of structural alterations through chemical and mechanical processes, resulting in the creation of unique properties, functions, and applications. The entire family of linear heteropolysaccharides that are soluble in acid is referred to as chitosan The degree of N-deacetylation has not been used to establish a clear nomenclature border between chitin and chitosan[26,27]. Due to its versatile qualities and numerous applications, chitosan is highly desirable in food packaging. Chitosan finds extensive use in both the food industry and agriculture among its many other applications[28]. In most organic solvents, chitin remains insoluble, whereas chitosan can easily be dissolved in acidic solutions that are diluted with a pH of less than 6.0. The amino groups' presence suggests that chitosan's charged state and other characteristics are significantly changed by pH.

      The complex substance known as beeswax is secreted in liquid form by unique wax glands in the abdomen of immature worker bees, which are between the ages of 12 and 18 d. The material that makes up a honeycomb's structure is beeswax, which is secreted by the bees to construct the structures that hold honey. Beeswax is found in beauty products due to its rich hydrophobic protective properties. Furthermore, beeswax is utilized in the food sector. Pure beeswax is nearly white when it is secreted by the bee; it only takes on a variable, intense yellowish color upon contact with honey and pollen, and after approximately four years, it turns brown due to the presence of the cocoon[29].

      The eugenol present in clove trees and other phenolic compounds extracted from floral buds (Syzygium aromaticum L.) demonstrates notable antibacterial and antioxidant properties. This essential oil, known for its efficacy against significant foodborne pathogens[30], possesses anti-free radicals and metal chelating capabilities, functioning effectively as a bactericide. Despite its powerful attributes, the strong and distinct odour of clove oil has restricted its applications in the food industry. To address this limitation, encapsulation has been proposed as a viable strategy for mitigating the potent smell associated with clove oil[31].

      Recent studies have shown using Carnauba wax (1.0% and 0.50%), the sensory quality of pointed gourd treated with Carnauba wax was initially good to very good but deteriorated significantly by the 6th day of storage which offered benefits such as delayed ripening and reduced water loss, their efficacy in maintaining sensory quality and extending shelf life appears limited[32]. In another study involving coatings developed with starch, ethylenediaminetetraacetic acid (EDTA), and sodium alginate, the composite coatings were effective in extending the shelf life of green chillies[33]. However, the weight loss in coated samples (5.60%−6.90%) was still relatively high compared to the uncoated samples (12.35%)[34]. Priyadarshi et al.[34] has studied the effect of chitosan/citric acid-based packaging film pouches on the shelf-life of green chilli. The authors have shown that the shelf life can be slightly improved or affected by the application of an active packaging system. Therefore, a better alternative is proposed, the combination of chitosan with essential oil and beeswax with essential oil could be a better alternative to Carnauba wax and composite coatings developed with starch, EDTA, and sodium alginate or chitosan/citric acid.

      This research work presents and discusses the chitosan and beeswax-based functional coating to understand the possible applications of these coatings to evaluate the quality and freshness of pointed gourd and green chilli in real-time. These coatings offer enhanced antimicrobial properties, reduced weight loss, and better preservation of sensory quality, making them more effective in extending the shelf life of green chillies and pointed gourds.

    Methodology

      Samples

    • Chitosan (75%–85 % deacetylated) was obtained from Sigma-Aldrich (St. Louis, MO, USA). Glycerol was obtained from Loba Chemie (Mumbai, India). Beeswax and essential oils were purchased from the local market, Phagwara, Punjab, India. Green chillies of equal size, colour, and maturity were purchased from the nearby market, Moga, Punjab, India. Pointed gourds commonly called parwals were also bought from the local market, Phagwara, Punjab, India. The green chillies were chosen based on their uniformity in size, color (green), and maturity (fully ripe), while the pointed gourds were selected for consistency in size, color (green), and maturity (medium stage of ripening). Any other reagents used in this study were of analytical grade and used without any purification.

      Method

    • The experimental requirements consisted of fresh pointed gourd and green chillies, they were carefully selected for their physical condition, devoid of injuries, and exhibiting uniformity in color, size, and maturity. To make sure that optimal hygiene of the experimental fruits was followed and therefore a washing process was initiated utilizing sodium hypochlorite as a chlorine-based cleaner. This process involved immersing the fruits in chlorine-infused water for 10 min. Subsequently, the washed fruits were left to air dry under a fan, ensuring a thorough drying process. The coating application involved immersing the prepared fruits in the respective coating solutions for 5 min. Following each immersion, the fruits were extracted from the solution and allowed to air dry for an additional 10 min post-coating application, both the coated and uncoated samples were systematically arranged on plastic trays and stored at an ambient temperature of 25 ± 2 °C and a relative humidity of 70%−80%.

      Preparation of samples

    • The selection of samples was done with uniform colour, size, and maturity and devoid of any injuries. Then the sample was washed properly for 5−7 min. Washed fruits are then allowed to air dry completely. The selected green chillies and pointed gourd were divided into five groups according to the type of coating (M1 = uncoated fruits, M2 = coated with only chitosan, M3 = coated with chitosan and clove essential oil, M4 = coated with only beeswax, and M5 = coated with beeswax and clove essential oil). Each group contains three green chillies and three pointed gourds. Both chillies and pointed gourd were cleaned with water for 5−7 min and air dried before applying the edible coating. The samples were immersed in the coating solution for 5 min and then were kept for air drying for 10 min. The same procedure was repeated three times for both chillies and the pointed gourd sample.

      Preparation for coating

    • There were five treatments: M1 (control sample), M2 (only chitosan coating 2%), M3 (chitosan 2% + 0.1% (w/w) clove essential oil), M4 (only beeswax coating), and M5 (beeswax + 0.1% (w/w) clove essential oil).

      Chitosan coating (M2) - prepared by taking 2 g chitosan and dissolving it in 0.5% acetic acid in distilled water. This was then placed on a magnetic stirrer for 8−10 h. The pH was adjusted to 5.60 by adding 50% citric acid. Then 0.2 mL glycerol was added to act as a plasticizer.

      Chitosan incorporated with clove essential oil coating (M3) – chitosan solution - prepared by taking 2 g chitosan and dissolving it in 0.5% acetic acid in distilled water. This was then placed on a magnetic stirrer for 8−10 h. Then the pH was adjusted to 5.60 due to the addition of 50% citric acid. Then 0.2 mL glycerol was added. Essential oil solution - prepared by combining 1 mL of clove essential oil, 0.5 mL of Tween-20, and 8.5 mL distilled water in a test tube. 1 mL of this essential oil solution was then added to the previously prepared chitosan solution and thoroughly mixed for 15−20 min on a magnetic stirrer.

      Beeswax coating (M4) – prepared by taking 20 g beeswax, melting it at 55−60 °C and then filtering it. 80 mL of edible oil (rice bran oil) and 0.2 mL glycerol were dissolved in melted beeswax and then thoroughly mixing and used for coating.

      Beeswax incorporated with clove essential oil coating (M5) – prepared by taking 20 g beeswax and melting it at 55−60 °C and then filtering it. 80 mL of edible oil (rice bran oil) and 0.2 mL of glycerol were added along with melted beeswax. The solution was then stirred until homogenous. Clove essential oil solution. One mL of this essential oil solution was added to the beeswax solution and mixed thoroughly.

      Antioxidant activity test

    • The evaluation of scavenging activity for the blended sample was carried out using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) method. DPPH solution was prepared by mixing 4 mg of DPPH in 100 mL of methanol. A 50 mg aliquot of the sample solution was blended with a 10 mL DPPH solution, and absorbance values were recorded post 30-min incubation in the dark. The baseline values were established at 517 nm, the specific wavelength for the DPPH assay. Methanol was used as a blank and only the DPPH solution was referred to as control. The quantification of sample scavenging activity was achieved through a designated equation, and the entire experiment was executed in replicates to ensure the accuracy and reliability of the results. This methodology provides insights into the antioxidant potential of the blended sample through DPPH radical scavenging assessment[35].

      Freeradicalscavengingactivity(%)=Ac−AsAc×100

      where, AC and AS were the absorbances of DPPH of the control and sample, respectively.

      Application of coating

    • The application of four distinct coatings on green chilli and pointed gourd surfaces was executed utilizing the immersion method to enhance the adhesion and retention of the coatings. Following each dipping of the chilli and pointed gourd, the residual coating material was allowed to drip off, and this process was iterated three times. Subsequently, the coated pointed gourds and chilli were air-dried until complete desiccation. The dried specimens were then stored under ambient conditions with a temperature of 25 ± 2 °C for subsequent physiochemical analysis by established research protocols.

      Shelf-life analysis

    • The soil on the pointed gourd and green chillies was removed by washing with tap water. To assess the efficiency of the coating solution in preservation, samples were immersed in the solution containing the coating material. Uncoated samples were used as a reference for comparison. The samples were kept in different petri plates and were placed under ambient temperature, with continuous monitoring and recording[36]. Over an 8-d and 15-d storage-life test period an ambient temperature of 25 ± 2 °C and a relative humidity of 70%−80%. The changes in skin color, texture, and weight loss were observed for both coated and uncoated pointed gourds as well as for the chillies. The initial weight of the fruits was recorded at the start of the experiment, and subsequent weights were measured.

      Sensory assessment

    • Throughout the research duration, sensory characteristics were meticulously evaluated using a 9-point Hedonic scale. Various aspects, including physical attributes, texture, and overall acceptance, were scrutinized by panellists. For the sensory analysis, a panel of four trained evaluators was assembled, comprising three male teachers and one female teacher. The panellists were selected from the faculty members of the college conducting the research, representing a diverse age range. The ages of the panellists varied between 30 and 50 years. As the sensory analysis was repeated at fixed intervals the faculty members were familiar with the experimental protocol and provided valuable insights into the changes observed in the appearance and colour of the pointed gourds and green chillies. This approach ensured rigorous and reliable sensory evaluations. The scale, ranging from extremely liked (9) to extremely disliked (1), provided a nuanced assessment of the sensory attributes. This comprehensive approach enabled a detailed exploration of the subjective preferences and responses to the sensory qualities of the subject under investigation[37].

      Weight loss

    • The assessment of the storage impact on the 3-pointed gourd and green chillies involved weighing both samples at the commencement and conclusion of each storage interval. The total weight loss during storage was calculated by determining the difference between the initial and final weights of the fruit. To quantify this loss, percentages were computed based on the fresh weight of the fruit. This methodology provides insights into the perishability and stability of three pointed gourd and green chillies over time, aiding in understanding their post-harvest behaviour and potential shelf life[38].

      Lossinweight(%)=(Initialwt.−Finalwt.)(Initialwt.)×100%
    Results and discussion

    • The coating formulation was successfully prepared using chitosan and beeswax alone and in combination with clove essential oils. The developed formulation was applied for coating applications. Shelf-life analysis of pointed gourds and green chillies was performed by coating them with an edible coating made from chitosan, beeswax, chitosan with clove essential oil, beeswax with essential oil and one control sample with no coating. The results are displayed in Tables 1−6. Tables 1 & 2 shows the sensory analysis and weight loss for pointed gourd and Tables 3 & 4 show the sensory analysis and weight loss for green chillies, while the effect of coating on pointed gourd and green chillies are presented in Tables 5 & 6 respectively. M1 in the tables represents a sample without any coating to assess the impact of edible coating on raw fruit, M2 represents the coating with chitosan, M3 represents coating with chitosan and clove essential oil, M4 represents coating with beeswax and M5 represents coating with beeswax and clove essential oil. Pointed gourd samples were analyzed for 8 d and the observation was made every 2 d. The samples were analyzed based on sensory analysis and weight loss. The sensory evaluation was based on the changes in the color and the overall appearance of the pointed gourd

      Table 1.  Representing sensory evaluation of pointed gourds.

      Treatments Sensory properties (days in storage)
      2 4 6 8
      M1 7.67 ± 0.82 5.67 ± 0.47 3.33 ± 0.47 1.33 ± 0.47
      M2 8.33 ± 0.47 7.67 ± 0.47 5.67 ± 0.47 5.33 ± 0.47
      M3 8.67 ± 0.47 8.33 ± 0.47 7.63 ± 0.47 7.07 ± 0.47
      M4 7.67 ± 0.47 7.33 ± 0.47 6.3 ± 0.47 4.67 ± 0.47
      M5 8.33 ± 0.47 7.67 ± 0.47 7.21 ± 0.47 6.84 ± 0.82

      Table 2.  Representing weight loss of pointed gourds during storage.

      Treatments Physiological loss in weight (%) (days in starage)
      2 4 6 8
      M1 12.71 ± 2.91 18.57 ± 2.68 22.11 ± 1.18 24.72 ± 0.21
      M2 1.70 ± 0.16 3.40 ± 0.32 5.91 ± 0.45 7.60 ± 0.26
      M3 0.05 ± 0.01 0.25 ± 0.11 0.59 ± 0.20 0.82 ± 0.33
      M4 2.39 ± 0.21 5.46 ± 0.48 9.97 ± 1.10 11.3 ± 0.78
      M5 0.89 ± 0.30 1.76 ± 0.52 3.82 ± 0.41 4.67 ± 0.31

      Table 3.  Representing sensory evaluation of green chillies.

      Treatments Sensory properties (days in storage)
      3 6 9 12 15
      M1 7.67 ± 0.47 6.3 ± 0.47 4.67 ± 0.47 2.67 ± 0.94 1.67 ± 0.47
      M2 8.33 ± 0.47 7.67 ± 0.47 6.33 ± 0.94 6.00 ± 1.41 5.00 ± 0.82
      M3 8.67 ± 0.47 8.33 ± 0.47 8.00 ± 0.82 7.67 ± 0.47 7.33 ± 0.47
      M4 7.67 ± 0.47 6.84 ± 0.47 5.33 ± 0.47 5.00 ± 0.81 4.66 ± 0.47
      M5 8.67 ± 0.47 8.33 ± 0.47 7.67 ± 0.47 7.33 ± 0.47 6.67 ± 0.47

      Table 4.  Representing weight loss of green chillies during storage.

      Treatments Physiological loss in weight (%) (days in storage)
      3 6 9 12 15
      M1 3.26 ± 0.73 4.37 ± 1.2 6.36 ± 0.92 11.67 ± 1.3 15.34 ± 1.10
      M2 0.92 ± 0.31 1.23 ± 0.35 3.86 ± 0.75 5.45 ± 0.23 8.45 ± 1.20
      M3 0.40 ± 0.21 0.96 ± 0.23 1.40 ± 0.46 1.95 ± 0.74 2.30 ± 0.36
      M4 1.81 ± 0.73 2.62 ± 0.47 4.77 ± 0.18 5.11 ± 0.54 6.21 ± 0.27
      M5 0.69 ± 0.19 0.98 ± 0.23 3.21 ± 0.46 3.40 ± 0.36 4.47 ± 0.63

      Table 5.  Visual records of pointed gourd coated and uncoated for 8 d.

      Days M1 M2 M3 M4 M5
      2
      4
      6
      8

      Table 6.  Visual records of green chillies coated and uncoated for 15 d.

      Days M1 M2 M3 M4 M5
      3
      6
      9
      12
      15

      Based on the obtained results and per the evaluation it can be concluded that there was a minimum change in the pointed gourd and chillies sample coated with chitosan + clove essential oil which is followed by pointed gourd and chillies coated with beeswax + clove essential oil. The control sample showed the maximum change in the overall appearance in both cases. Physiological losses in weight increase gradually in all the treatments with the advancement of the storage period. The loss in weight in uncoated pointed gourd was observed from 12.71% to 24.72%. The pointed gourd sample coated with chitosan and chitosan + clove essential oil showed an increase in weight loss from 1.7% to 7.60%, and 0.05% to 0.82% respectively. The pointed gourd coated with beeswax and beeswax + clove essential oil showed an increment of weight loss from 2.39% to 11.3%, and from 0.89% to 4.67% respectively. Only limited work has been done on pointed gourd coating and the Carnauba wax (1.0% and 0.50%) coating on the pointed gourd showed earlier some promising results[32]. The sensory quality of pointed gourd treated with Carnauba wax was found to be primarily appealing, but the shelf life declined meaningfully after storage for 6 d which indicates although the coating is beneficial for delaying ripening and reducing water loss, its usefulness in preserving sensory quality and extending shelf life still appears restricted.

      The sample of fresh green chillies was analyzed for 15 d and the observation was made every 3 d and analysis was done based on sensory analysis and weight loss. The sensory evaluation focused on color and overall appearance changes in the chillies. The findings suggest minimal alterations in the chilli sample coated with chitosan + clove essential oil, followed closely by chillies coated with beeswax + clove essential oil. In contrast, the control sample exhibited the most significant changes in overall appearance. Notably, the chitosan-only coating displayed better color retention compared to the sole beeswax coating. These results underscore the effectiveness of combined coatings, particularly with chitosan and clove essential oil, in preserving the visual attributes of chillies, highlighting their potential for enhancing the shelf life and consumer appeal of the produce.

      During storage at room temperature, changes in weight loss were observed in both the control and coated green chillies samples. Uncoated green chillies experienced a notable increase in weight loss, escalating from 3.26% to 15.34%. In contrast, chillies coated with chitosan and chitosan + clove essential oil showed a rise from 0.92% to 8.45%, and 0.40% to 2.30%, respectively. Additionally, chillies coated with beeswax and beeswax + clove essential oil demonstrated an increase in weight loss from 1.81% to 6.21% and from 0.69% to 4.47%. These findings indicate the potential of coatings, particularly chitosan and beeswax, in mitigating weight loss during storage, contributing to the preservation of green chillies. A similar result was reported in the case of alginate/carboxymethyl cellulose/starch-based coating for green chilli preservation[39]. The application of an edible coating of green chilli significantly enhanced the shelf life by reducing moisture loss. The color and texture of the coated chilli were superior compared to the uncoated counterpart. Similarly, coatings were developed using starch, EDTA, and sodium alginate, and used in maintaining the shelf life of green chillies[33]. The authors showed that the weight loss in coated chillies samples (5.60%−6.90%) was still relatively high compared to the uncoated samples (12.35%). The same authors also studied the shellac-based surface coating on green chillies in combination with modified atmosphere packaging (MAP)[40]. The coated chillies exhibited longer shelf life compared to the uncoated counterpart and the use of MAP in combination with coating further extended the shelf life of chilli. Thus, the combined treatment could be very effective in preserving the shelf life of chilli. The effect of edible gum arabic and chitosan-based coating on green chillies has also been recently studied[41]. The obtained results showed that the application of the edible coating on chilli significantly improved the shelf life by maintaining the respiration rate and vitamin C content. In another work, chitosan/citric acid film was used to make pouches for green chilli packaging[34]. The biopolymer-made pouches used for green chilli packaging showed some effect on the color and shelf life of chilli due to the presence of citric acid but the effect was not pronounced due to the lack of presence of a strong functional ingredient in the packaging system. The presence of essential oil in the current packaging system and direct coating application showed an overall better effect in improving the shelf-life of chilli.

      Antioxidant activity

    • DPPH analysis was carried out for the control sample, chitosan-coated sample, chitosan with clove essential oil-coated sample, and clove essential oil sample. No antioxidant activity was observed in the control, whereas in the chitosan-coated sample, it was found to be 17.3% ± 0.1%, in the case of the chitosan with clove essential oil-coated sample it was found to be 31.4% ± 1.0%, while in the case of clove essential oil 67.1% ± 1.5%. Therefore, it can be concluded that the control sample shows no radical scavenging activity since it has no added antioxidant coating. The chitosan-coated sample exhibits moderate antioxidant activity compared to the control as chitosan is known for its antioxidant action owing to the presence of function hydroxyl and amine group at carbon number six and two respectively[42]. The chitosan with clove essential oil-coated sample shows a much higher antioxidant activity compared to the control and chitosan-coated samples but less than only clove essential oil. The clove essential oil-coated sample shows the highest antioxidant activity among all three tested samples which is presumably due to the presence of strong antioxidant compounds such as eugenol, monoterpenes, propanoids, caryophyllene, etc.[43,44].

    Conclusions

    • Coating is an effective method for the improvement of the shelf life of fruits and vegetables. Chitosan, known for its biodegradability and environmental friendliness, boasts potent antimicrobial properties that make it a superior choice for various applications including food packaging. Beeswax, a natural and renewable resource offers remarkable water-repellent qualities, providing surfaces with robust protection against moisture and physical damage. Combining chitosan with clove essential oil results in a coating with heightened antimicrobial activity, offering broader protection against diverse microorganisms while enhancing the flavour and aroma of coated products. Similarly, blending beeswax with clove essential oil yields a coating with enhanced antimicrobial efficacy that may improve adhesion, and a delightful sensory experience, making it an excellent choice for preserving the freshness and quality of various products.

      The edible coating can be used in the shelf-life extension of pointed guard and green chillies. Weight loss, visible decay, and visual surface color change of the tested food were evaluated for 15 d. The results showed that the coated samples experienced more self-life and less weight loss than the control sample. The samples coated with chitosan + clove essential oil showed minimum changes in the appearance making it a suitable combination for shelf-life extension. After chitosan + clove essential oil, the samples coated with beeswax + clove essential oil showed minimum changes in the samples. Pointed gourd and green chilli samples coated with chitosan and beeswax displayed little variation in the physical appearance and made them fall behind the samples coated with beeswax + clove essential oil respectively. Hence inference can be drawn that chitosan with clove essential oil and beeswax with clove essential oil are the most potent methods for shelf-life extension in the case of pointed gourd and green chillies. Still, there is scope as well as the need for further improvement in edible functional coating. The work presented here is a preliminary study and thus needs further research for the practical implementation of this work for active food packaging purposes.

    Author contributions

    • The authors confirm contribution to the paper as follows: conceptualization, validation: Vidyarthi EV, Khela RK, Thakur M, Roy S; methodology: Vidyarthi E, Khela RK, Thakur M; writing—original draft preparation: Vidyarthi EV, Khela RK, Thakur M; writing—review and editing, visualization, supervision: Roy S. All authors have read and agreed to the published version of the manuscript.

    Data availability

    • All data generated or analyzed during this study are included in this published article.

      Conflict of interest

      • The authors declare that they have no conflict of interest.

      Rights and permissions
      • Copyright: © 2024 by the author(s). Published by Maximum Academic Press on behalf of Nanjing Agricultural University. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Table (6) References (44)
  • About this article
    Cite this article
    Vidyarthi EV, Thakur M, Khela RK, Roy S. 2024. Edible coatings for fresh produce: exploring chitosan, beeswax, and essential oils in green chillies and pointed gourd. Food Materials Research 4: e026 doi: 10.48130/fmr-0024-0017
    Vidyarthi EV, Thakur M, Khela RK, Roy S. 2024. Edible coatings for fresh produce: exploring chitosan, beeswax, and essential oils in green chillies and pointed gourd. Food Materials Research 4: e026 doi: 10.48130/fmr-0024-0017
    shu

Catalog

  • HTML

  • Introduction
  • Methodology

  • Samples

  • Method

  • Preparation of samples

  • Preparation for coating

  • Antioxidant activity test

  • Application of coating

  • Shelf-life analysis

  • Sensory assessment

  • Weight loss

  • Results and discussion

  • Antioxidant activity

  • Conclusions
  • Author contributions
  • Data availability
  • Conflict of interest
  • Rights and permissions
  • About this article
logo

Contents

Policies

Services

Partnerships

© 2025 Maximum Academic Press, except Open Access articles. MAP is a member of ALPSP, COPE, CrossRef, cOAlition S, OASPA and STM.

Privacy Policy  |  Site Map  |  Terms and Conditions

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return