Search
Submit Manuscript
3.3CiteScore
Advanced Search
MAP  >  Food Innovation and Advances
2024 Volume 3
Article Contents
Abstract
Introduction
Materials and methods
Plant material
Gene isolation and qRT-PCR analysis
DNA extraction and isolation of genomic CcbHLH1
Phylogenetic analysis and sequence alignment
Subcellular localization of key genes
Yeast two-hybrid assay
Bimolecular luminescence complementary assay
Dual luciferase assay
Transient expression in tobacco leaves
Semiquantitative analysis of anthocyanin
Statistical analysis
Results
Anthocyanin is completely absent in both vegetative and reproductive organs of the white cornflower
A spontaneous mutation of CcbHLH1 occurs in the white cornflower petals
Alternative splicing is responsible for the truncation of CcbHLH1
The subcellular localization analysis of CcbHLH1
CcbHLH1# remains the protein-protein interaction with CcMYB6-1
CcbHLH1# loses the ability to enhance the trans-activation of CcDFR promoter
Anthocyanin content in tobacco leaves decreases after CcbHLH1 mutation
Discussion
Conclusions
Author contributions
Data availability
Acknowledgments
Conflict of interest
Supplementary information
Rights and permissions
References
About this article
Next Previous
ARTICLE   Open Access    

Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway

  • 1.

    College of Food Science, Shenyang Agricultural University, Dongling Road 120, Shenhe District, Shenyang 110161, China

  • 2.

    Lenovo (Beijing) Group Ltd., Beijing 100000, China

  • 3.

    Department of Pharmacognosy, Faculty of Pharmacy, Prince Sattam Bin Abdulaziz University, Al-kharj 11942, Saudi Arabia

  • 4.

    Department of Pharmacognosy, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt

  • 5.

    Key Laboratory of Healthy Food Nutrition and Innovative Manufacturing of Liaoning Province, Shenyang 110161, China

More Information
  • The colonic mucosal barrier is an important component of the intestinal barrier, and its integrity is crucial for maintaining digestive tract homeostasis and normal metabolism in the body. This study aimed to elucidate the mechanisms by which malvidin-3-O-galactoside (M3G) might ameliorate colonic mucosal barrier function, from the perspective of physical barrier function and immune barrier function. Male C57BL/6J mice were given dextran sulfate sodium (DSS) to establish a mice model for colitis and then administrated with or without M3G for one week. The results showed that M3G supplementation significantly improved the disease activity index (DAI) score and colon tissue injury in mice with DSS-induced colitis. M3G improved the colonic physical barrier function by modulating the expression of mucin2 (MUC2), claudin-1, occludin, zona occludens 1 (ZO-1), and intestinal fatty acid binding protein (iFABP) in the colonic mucosa. Additionally, M3G also relieved the colonic immune barrier of mice by increasing the level of secretory immunoglobulin A (SIgA) in colon tissue and the percentages of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in colon lamina propria monocytes in mice. Furthermore, M3G down-regulated Notch signaling pathway-related proteins such as Notch1, notch intracellular domain (NICD), delta-like ligand 4 (DLL4), delta-like ligand 1 (DLL1), and hairy/enhancer of split 1 (Hes1) of colon tissue. The present results demonstrated that M3G can improve colonic mucosal barrier function by inhibiting the Notch signaling pathway.

  • Introduction

    Flower color is one of the most important components in floral traits that help higher plants attract pollinators for successful fertilization. There are abundant flower color variations among species, cultivars, and hybrid progenies, in which the white flowers, commonly as a symbol of purity and holiness, play important roles in ceremonial events and ikebana. It is well known that anthocyanins are the core pigments to generate different degrees of red, violet, or blue flowers[1,2]. Comparatively, there were only some colourless co-pigments like flavanones, flavones and flavonols found in the white flowers, such as that seen in the white petals of cornflower, Scutellaria baicalensis, and Cymbidium ensifolium[3−5]. Namely, anthocyanin absence leads to the white color formation in most higher plants.

    Anthocyanin, a subclass of flavonoids, is an important secondary metabolite catalyzed by a series of enzymes[6,7]. Initially, chalcone synthase (CHS) catalyzes the tetrahydroxychalcone synthesis from 4-coumaroyl CoA and malonyl CoA, which was rapidly isomerized to the naringenin by chalcone isomerase (CHI). Then flavanone 3-hydroxylase (F3H) catalyzes the hydroxylation at its 3-position to generate dihydrokaempferol (DHK), which can be further catalyzed by the flavonoid 3'-hydroxylase (F3'H) and flavonoid 3'5'-hydroxylase (F3'5'H) to yield dihydroquercetin (DHQ) and dihydromyricetin (DHM), respectively. DHK, DHQ, and DHM are further converted to pelargonidin, cyanidin, and delphinidin by dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS), respectively. Finally, sugar molecules and acyl groups are attached to the anthocyanidins by both glycosyltransferase (GT) and acyltransferase (AT). Therefore, any block in the structural genes will trigger anthocyanin deficiency. For example, down-regulation of the early biosynthetic genes, such as CHS and F3H, led to the white flower phenotypes in Ipomoea purpurea, Torenia fournieri, Dahlia variabilis, gentian, and C. kanran[8−13]. Moreover, deficiency of the late biosynthetic genes (DFR, ANS and GT, etc.) also blocked anthocyanin accumulation and facilitated white flower formation, such as the cases in Salvia miltiorrhiza, Aquilegia vulgaris, strawberry, and Iris bulleyana[14−17].

    Anthocyanin biosynthetic genes are under the control of a regulatory complex composed of MYB, bHLH, and WD40[18,19]. MYB transcription factors play crucial roles in this process. The mutation of R2R3 MYB transcription activators resulted in the evolutionary transitions to white flowers in Antirrhinum and Petunia[20,21], while R3 MYBs usually function as transcription inhibitors involved in down-regulating multiple anthocyanin biosynthetic genes, leading to anthocyanin absence in higher plant organs[22−25]. In addition, bHLHs of the IIIf subgroup are involved in anthocyanin biosynthesis, which are further divided into two distinct clades, namely bHLH1 and bHLH2 genes[26]. Usually, the bHLH2 plays essential roles in anthocyanin biosynthesis, and its mutation often results in anthocyanin decrease and color fading[27−30]. Moreover, the bHLH1 proteins in Arabidopsis thaliana and Antirrhinum majus also directly regulate anthocyanin biosynthesis[31−33].

    Our previous study revealed that the transcripts of structural genes involved in anthocyanin biosynthesis, e.g., CcF3H, CcF3'H, and CcDFR were nearly undetectable in the white cornflower petals lacking anthocyanin accumulation[3], which was possibly caused by the upstream transcription factors (TFs). Besides, two TFs, CcMYB6-1, and CcbHLH1, were identified as activators synergistically regulating anthocyanin biosynthesis in cornflower[34]. In the present study, the anthocyanin accumulation in both vegetative and reproductive organs in two cornflower cultivars were first monitored and it clarified that anthocyanins were completely absent in the white cornflower. To further explore the molecular mechanism underlying the white color transition in cornflower, the transcript abundances of both structural genes and transcription factors involved in anthocyanin biosynthesis were detected, and the full-length sequence of CcMYB6-1 and CcbHLH1 were isolated, followed by the multi-sequence alignment and phylogenetic analysis. Subsequently, the genomic sequence of CcbHLH1 was isolated to elucidate its truncation reason. Furthermore, the subcellular localization analysis, yeast-two hybrid, bimolecular luminescence complementary assay, dual-luciferase assay, as well as the transient over-expression in tobacco leaves were conducted to explore the functional changes after CcbHLH1 truncation. The findings will enhance our understanding of the regulation mechanism of anthocyanin biosynthesis in cornflower, and provide new insights on the white color transition in higher plants.

    Materials and methods

    Plant material

    Two Centaurea cyanus cultivars with blue and white petals were used in this study, namely, 'Dwarf Tom Pouce Blue' (DTPB) and 'Dwarf Tom Pouce White' (DTPW) (Fig. 1a). The seeds were purchased from the Outsidepride Seed Source, LLC. Their seeds were sown in an equal volume mixture of peat and vermiculite, then placed in phytotron under 23 °C and 16 h/8 h (light/dark) conditions. After one month of cultivation, the seedlings began to blossom, and capitula were divided into four developmental stages based on our previous publication[3] (Fig. 1b). Briefly, the buds in stage one (S1), stage two (S2), and stage three (S3) were uncolored, less than 50% pigmented, and fully pigmented, respectively, while the petals in stage four (S4) were opened and fully pigmented (Fig. 1c). The roots, stems, leaves, sepals, and petals (S1−S4) were collected into 2 mL RNAase-free tubes, rapidly precooled in liquid nitrogen and stored at −80 °C before use.

    Figure 1.  Different cultivars and developmental stages of cornflower. (a) Two cornflower cultivars with white and blue petals in DTPW and DTPB, respectively. (b) The capitula were classified into four developmental stages, bar = 1 cm. (c) The pigmentation pattern of cornflower petals in different developmental stages, bar = 1 cm.
    DownLoad: Full-Size Img PowerPoint

    Gene isolation and qRT-PCR analysis

    Total RNAs were extracted from petals of DTPW and DTPB, respectively, followed by the first-strand cDNA generation using M-MLV reverse transcriptase (Promega, Germany). Polymerase chain reaction was conducted to amplify the full or partial-length of CcMYB6-1 and CcbHLH1 in the two cornflower cultivars. The 3′-rapid amplification of cDNA ends (3'-RACE) was performed to isolate the CcbHLH1# in DTPW, followed by verification of the obtained sequence using the high-fidelity enzyme of KOD-201 (TOYOBO, Japan). To further explore the expression characteristics of structural and regulatory genes, the qRT-PCR was performed in roots, stems, leaves, sepals, and petals of both DTPW and DTPB using the TB Green® Premix Ex Taq™ II (Takara, Japan). Conflower actin (KY621346) was used as the reference gene. All the primers were designed based on the transcriptome database[34] and listed in Supplementary Table S1.

    DNA extraction and isolation of genomic CcbHLH1

    The fresh leaves were cut from DTPB in the vegetative period, precooled in liquid nitrogen, and ground into a powder. Then the whole-genome DNA was extracted using the super plant genomic DNA kit according to the instructions (TIANGEN, China). To further explore the genomic structure of CcbHLH1, the PrimeSTAR® Max DNA polymerase (Takara, Japan) was used to amplify its genomic sequence. Furthermore, the purified PCR products were ligated into the pCE3 blunt vector, followed by the transformation into Escherichia coli DH5α and sequencing. All the primers are listed in Supplementary Table S1.

    Phylogenetic analysis and sequence alignment

    A maximum likelihood phylogenetic tree was constructed by the Jones-Taylor-Thornton (JTT) model using MEGA11. Deduced protein sequences were firstly aligned using MUSCLE, followed by the phylogeny test with 1,000 bootstrap replications. Besides, gaps or missing data were treated as complete deletions. DNAMAN software was applied to obtain the multi-sequence alignment result.

    Subcellular localization of key genes

    The pCAMBIA vector carrying an EGFP was digested with NcoI and SpeI, followed by the ligation with CcMYB6-1, CcbHLH1 and its mutant without stop codons using homologous recombination. The empty and recombinant plasmids were transformed into Agrobacterium tumefaciens GV3101, respectively. GV3101s were resuspended in the liquid mixture containing 10 mM MgCl2, 10 mM MES, and 200 μM acetosyringone, then were adjusted to the OD600 of 1, followed by the infiltration into Nicotiana benthamiana leaves using needless injections. Before observation, the leaves were immersed in the DAPI (10 μg/mL) for 30 min. Finally, a laser scanning confocal microscope (Leica TCS SP8, Wetzlar, Germany) was used to obtain the fluorescence signal.

    Yeast two-hybrid assay

    The restriction endonucleases EcoRI and BamHI (New England Biolabs) were used to linearize pGBKT7 and pGADT7 empty vectors. The whole length of CcMYB6-1 was cloned into pGADT7 to form AD-CcMYB6-1 recombinant, while CcbHLH1 and its mutant were cloned into pGBKT7 to construct BD-CcbHLH1 and BD-CcbHLH1# recombinants. Then, these empty vector and/or recombinant plasmids were co-transformed into Y2H strain by use of yeastmaker™ yeast transformation system 2 (Clontech, USA) and plated on the SD/-Leu/-Trp solid medium, followed by incubation upside down at 30 °C for three days. The matchmaker™ insert check PCR mix 2 (Takara, Japan) was used to ensure the successful insertion of target genes into the yeast strain, followed by the evaluation on the SD/-Trp-Leu-His-Ade medium supplemented with X-α-Gal and 3-amino-1,2,4-triazole (3AT).

    Bimolecular luminescence complementary assay

    The bimolecular luminescence complementary assay was further conducted to get more evidence of protein-protein interaction between CcMYB6-1, and CcbHLH1, or CcbHLH1#. The empty pCAMBIA1300-cluc (cLUC) and pCAMBIA1300-nluc (nLUC) plasmids were digested with KpnI and SalI for linearization. The full-length sequence of CcMYB6-1 was ligated into linearized cLUC, while CcbHLH1 and CcbHLH1# without stop codons were cloned into linearized nLUC, respectively. Subsequently, the empty or recombinant plasmids were transformed into A. tumefaciens GV3101 severally, followed by the infiltration of GV3101s of different combinations into N. benthamiana leaves at an equal volume ratio of cLUC and nLUC. After three days of co-culture in the dark, the D-luciferin potassium salt solution was sprayed on the leaf abaxial surface, followed by the observation of fluorescence signals using a molecular imaging system (LB983 NightOwl II).

    Dual luciferase assay

    The promoter region of CcDFR, a key structural gene catalyzing anthocyanin biosynthesis, was isolated as in our previous publication[34]. Restriction endonucleases KpnI and BamHI (New England Biolabs) were used to digest pGreenII 0800-LUC empty vector in rCutSmart buffer at 37 °C for 15 min, then CcDFR promoter of 1,510 bp was cloned into the linearized pGreenII 0800-LUC by homologous recombination. The full-length sequences of CcMYB6-1, CcbHLH1 and CcbHLH1# were recombined into pGreenII 62-SK vector. All the recombinants were individually transformed into A. tumefaciens GV3101 and verified as a positive clone by polymerase chain reaction. Subsequently, a total of six groups including SK, SK + CcMYB6-1, SK + CcbHLH1, SK + CcbHLH1#, CcMYB6-1 + CcbHLH1, and CcMYB6-1 + CcbHLH1# were individually mixed with LUC-DFRpro at a ratio of 10:1 (v:v). The GV3101s containing different recombinants were infiltrated into N. benthamiana leaves using a needless injector. After three days of cultivation, the infiltrated leaves were painted with a layer of D-luciferin potassium salt liquid containing 0.1% Triton-x-100, and then photographed using the molecular imaging system (LB983 NightOwl II). Moreover, the firefly luciferase and Renilla luciferase were extracted following the instructions of Dual-Luciferase® Reporter Assay System E1910 (Promega, USA), and detected by EnVision (PerkinElmer, USA).

    Transient expression in tobacco leaves

    To explore the functional changes before and after CcbHLH1 mutation, N. benthamiana were used for transient expression. GV3101s containing mixed plasmids including SK + CcMYB6-1, SK + CcbHLH1, SK + CcbHLH1#, CcMYB6-1 + CcbHLH1, or CcMYB6-1 + CcbHLH1# at a ratio of 1:1 (v:v) was infiltrated into leaves using a needleless injector, followed by cultivation in the dark for three days and photographed after nine days. About 0.1 g infiltrated tobacco leaves were weighed and stored at −80 °C before use.

    Semiquantitative analysis of anthocyanin

    Cyanidin-3-O-glucoside (Cy3G) was used to obtain the regression equation (Y = 2.9301X, R2 = 0.9959) at 525 nm. About 0.1 g of fresh samples were accurately weighed, ground into a powder using a grinding machine, and extracted with 1 mL mixture of methanol : H2O : formic acid : trifluoroacetic acid = 70:27:2:1 (v : v : v : v) at 4 °C overnight, followed by centrifugation at 12,000 rpm for two minutes. As for leaves, stems and sepals, 500 μL chloroform was added to remove chlorophyll before centrifugation. The liquid supernatant was transferred into new tubes for anthocyanin detection using a spectrophotometer.

    Statistical analysis

    Data processing was conducted by use of Excel 2021, and SPSS 20.0 was performed to obtain the significant difference analysis using Ducan's multiple test at 1% level. Origin 2021 was used for visualizing the figures.

    Results

    Anthocyanin is completely absent in both vegetative and reproductive organs of the white cornflower

    The previous research on cornflower has clarified that there were pelargonidin derivatives in the pink and red petals as well as cyanidin derivatives in the blue, mauve, and black petals, while no anthocyanin was detected in the white petals using the ultra-performance liquid chromatography coupled with photodiode array and tandem mass spectrometry[3]. Here, we further attempted to detect the anthocyanins in root, stem, leaf, and sepal, besides, the dynamic changes of anthocyanin content were also traced among four developmental stages of petals (Supplementary Fig. S1). There was no anthocyanin in the DTPW petals, which was consistent with our previous results[3], while the vegetative organs showed no anthocyanin accumulation, either (Fig. 2a & b), suggesting anthocyanins were completely absent in DTPW. Comparatively, the sepals accumulated trace anthocyanins and the anthocyanin contents in petals continuously increased with flower development and peaked at stage four (Fig. 2a & b), suggesting anthocyanins accumulated in both sepals and petals of DTPB.

    Figure 2.  Anthocyanins showed specific accumulation in different cultivars and organs of cornflower. (a) The anthocyanin extracts of distinct organs from DTPW and DTPB. (b) Anthocyanin content in different cultivars and organs. Error bars were the S.E. of four biological replicates with each from three individual plantlets. (c), (d) The spatio and temporal expression patterns of CcMYB6-1 and CcbHLH1 in DTPW and DTPB. Error bars were the S.E. of three technical replicates. Different capital letters indicate significant difference at 1% level by Duncan's multiple test.
    DownLoad: Full-Size Img PowerPoint

    The expression pattern of structural genes was further analyzed including CcF3H, CcF3'H, CcDFR, CcANS, CcGT, and CcAT in the spatio levels to clarify the potential mechanism of anthocyanin absence in DTPW (Supplementary Fig. S2). Notably, the CcDFR was specifically expressed in the reproductive period. All the biosynthetic genes in the blue petals were significantly higher expressed than others, while the white petals only showed a tiny amount of gene expression, which were consistent with our previous publication[3]. These results suggested that the down-regulating of biosynthetic gene expression accounted for the anthocyanin absence in DTPW. Our previous research identified two transcription factors (TFs) positively regulating anthocyanin biosynthesis in cornflower, namely CcMYB6-1 and CcbHLH1[34]. The qRT-PCR results revealed that the white petals showed significantly higher expression of CcMYB6-1 (Fig. 2c), while the CcbHLH1 transcript was nearly undetectable in DTPW (Fig. 2d), indicating CcbHLH1 may be responsible for the down-regulating of biosynthetic genes in DTPW.

    A spontaneous mutation of CcbHLH1 occurs in the white cornflower petals

    Further, an attempt was made to isolate the full-length sequences of those two TFs using the cDNA library constructed from the petals of both DTPW and DTPB. Firstly, a polymerase chain reaction was performed to amplify the whole length of two TFs using primers based on the published sequence information in the blue cornflower cultivar DTPB. The agarose gel electrophoresis showed that CcMYB6-1 could be successfully amplified in DTPW (Supplementary Fig. S3a), and its sequence contained the whole R2 and R3 domains, 100% consistent with that in DTPB (Fig. 3a), suggesting CcMYB6-1 was not the main cause for anthocyanin absence in DTPW. Then, three pairs of primers were designed to amplify different fragments of CcbHLH1 (Supplementary Fig. S3b), and the agarose gel electrophoresis showed that there were clear bands of fragment 1 and fragment 2, however, fragment 3 could only be amplified in DTPB (Supplementary Fig. S3c), suggesting its full-length was possibly missing in the white petals. Then 3' RACE was performed to obtain the whole length of CcbHLH1 in DTPW. Finally, a sequence with 1,125 base pairs was joined and further verified by amplification using high-fidelity enzyme. The multisequence alignment analysis showed that the truncated CcbHLH1 in DTPW lost partial WD activation domain, the whole basic helix-loop-helix domain in the N-terminal, and the aspartokinase, chorismite mutase, TyrA (ACT)-like domain in the C-terminal (Fig. 3b). For convenience, the truncated CcbHLH1 was renamed as CcbHLH1# in the following assays. These results revealed that a naturally spontaneous mutation of CcbHLH1 occurred in DTPW, which may account for its anthocyanin absence.

    Figure 3.  Amino acid sequence alignment of MYBs and bHLHs regulating anthocyanin biosynthesis in different species. (a) Protein sequence alignment of MYBs with the conserved R2 and R3 domains marked in red and green lines, respectively. The blue rectangle indicated conserved motif of [D/E]LX2[K/R]X3LX6LX3R. PhAN2 (P. × hybrida, AAF66727), MaMybA (Muscari armeniacum, AVD68967), GbMYB1 (Gynura bicolor, BAJ17661), CmMYB6 (Chrysanthemum × morifolium, AKP06190). (b) Protein sequence alignment of bHLHs. The MYB-interacting region, WD activation, bHLH, and ACT-like domains were marked with lines in different colors. AtTT8 (A. thaliana, CAC14865), PhAN1 (P. × hybrida, AAG25927), DvIVS (D. variabilis, BAJ33515), and CmbHLH2 (C. × morifolium, ALR72603).
    DownLoad: Full-Size Img PowerPoint

    Alternative splicing is responsible for the truncation of CcbHLH1

    The qRT-PCR results revealed that CcbHLH1# was specifically expressed in the petals, and its abundance in the white petals was significantly higher than that in the blue petals (p < 0.01) (Fig. 4a). To further explore the molecular mechanism underlying the truncation of CcbHLH1, its genomic sequence was isolated in DTPB, which contained four exons and three introns (Fig. 4b). The mature mRNA of CcbHLH1 consisted of four complete exons, carrying the key basic, helix-loop-helix domain (Fig. 4b). Comparatively, the CcbHLH1# transcript consisted of exons 1, 2, and partial retention of intron 2, losing the key bHLH domain (Fig. 4b). Furthermore, phylogenetic analysis of the predicted amino acid sequences of CcbHLH1 and CcbHLH1# with other bHLHs that regulate flavonoid biosynthesis in other species revealed they belong to the bHLH2 clade within the IIIf subgroup (Fig. 4c).

    Figure 4.  Molecular and phylogenetic analysis of CcbHLH1 and CcbHLH1#. (a) The spatio and temporal expression patterns of CcbHLH1# in DTPW and DTPB. Error bars were the S.E. of three technical replicates. Different capital letters indicate significant difference at 1% level by Duncan's multiple test. (b) Structure of CcbHLH1 and CcbHLH1# genes. Exons are numbered in blue rectangles, introns are indicated by black lines, the bHLH domain is indicated in a violet rectangle, and the red triangle represents stop codon. (c) Phylogenetic tree of subgroup IIIf bHLHs. AmDelila (A. majus, AAA32663.1), DvDel (D. pinnata, BAJ33516.1), GMYC1 (Gerbera hybrid, CAA07615.1), InDel (I. nil, XP_019171149.1), PhJAF13 (P. × hybrida, AAC39455.1), AtEGL3 (A. thaliana, OAP12509.1), AtGL3 (A. thaliana, NP_680372.1), TrJAF13 (Trifolium repens, AIT76563.1), AtMYC1 (A. thaliana, NP_001154194), MdbHLH3 (Malus domestica, ADL36597.1), MdbHLH33 (M. domestica, ABB84474.1), VvMYCA1 (Vitis vinifera, NP_001267954.1), LhbHLH1 (Lilium hybrida, BAE20057.1), LhbHLH2 (L. hybrida, BAE20058.1), OsPlw-OsB1 (Oryza sativa, BAB64301.1), ZmLc (Zea mays, AAA33504.1), AtTT8 (A. thaliana, Q9FT81), CmbHLH2 (C. × morifolium, ALR72603.1), InIVS (I. nil, XP_019197480.1), PhAN1 (P. × hybrida, AAG25928.1), TrAN1 (T. repens, AIT76559.1), VvMYC1 (V. vinifera, NP_001268182.1), OsRc (O. sativa, ADK36625.1), ZmIN1 (Z. mays, AAB03841.1).
    DownLoad: Full-Size Img PowerPoint

    The subcellular localization analysis of CcbHLH1

    To further clarify if the functional position changed after CcbHLH1 truncation, the subcellular analysis was conducted using GFP as a reporter gene, whose transcription was activated by the constitutive CaMV 35S promoter. The CcMYB6-1, CcbHLH1, and CcbHLH1# without stop codons were successfully fused with GFP. There were strong GFP fluorescence signals widely found in the whole cell transformed with an empty vector. Comparatively, the GFP fluorescence signals of CcMYB6-1, and CcbHLH1 were mainly focused in the nucleus (Fig. 5), which was consistent with our previous identification that CcMYB6-1 and CcbHLH1 functioned as transcription factors synergistically involved in regulating anthocyanin biosynthesis in cornflower[34]. Similarly, the green fluorescence signals of CcbHLH1# were also observed in the nucleus (Fig. 5), suggesting the loss of multi-domains didn't change its functional position.

    Figure 5.  The subcellular localization analysis of CcMYB6-1, CcbHLH1, and CcbHLH1#. DAPI was used as a nuclear-localized marker. Photos were captured two days after infiltration.
    DownLoad: Full-Size Img PowerPoint

    CcbHLH1# remains the protein-protein interaction with CcMYB6-1

    The yeast two-hybrid assay was conducted to explore whether the protein-protein interaction relationship changed between the truncated CcbHLH1 and CcMYB6-1. Yeast transformed with pGBKT7-53 and pGADT7-T as well as pGBKT7-lam and pGADT7-T were designed for the positive and negative control, respectively. A total of five combinations were performed, and all of them could grow well on the SD/-Trp-Leu plate, suggesting all the target plasmids were successfully transformed into the Y2HGold yeast strain (Fig. 6a). The following observation found that yeast transformed with BD-CcbHLH1/CcbHLH1# and empty AD or empty BD and AD-CcMYB6-1 could not grow on the SD/-Trp-Leu-His-Ade+X-α-gal + 3AT plate, similar as the negative control. Comparatively, yeast co-transformed with CcMYB6-1 and CcbHLH1 or CcbHLH1# grew well and exhibited significant blue color on the same medium, similar as the positive control (Fig. 6a). Moreover, the bimolecular luminescence complementary assay was also conducted to obtain more evidence. There was no fluorescence signal detected in the combinations of nLUC + cLUC, nLUC + cLUC-CcMYB6-1, and nLUC-CcbHLH1/CcbHLH1# + cLUC, while significantly stronger fluorescence signals were found both in the nLUC-CcbHLH1 + cLUC-CcMYB6-1 and nLUC-CcbHLH1# + cLUC-CcMYB6-1, further verifying the protein-protein interaction between CcbHLH1/CcbHLH1# and CcMYB6-1 (Fig. 6b). These results indicated that the truncation of CcbHLH1 didn't change its protein interaction with CcMYB6-1.

    Figure 6.  Protein-protein interaction before and after CcbHLH1 mutation with CcMYB6-1. (a) Y2H strain transformed with targeted plasmids were plated on the SD/-Trp-Leu (left) and SD/-Trp-Leu-His-Ade + X-α-gal + 3AT (right) solid medium. (b) The firefly fluorescence of tobacco leaves injected with different combinations of targeted genes.
    DownLoad: Full-Size Img PowerPoint

    CcbHLH1# loses the ability to enhance the trans-activation of CcDFR promoter

    A previous study indicated that CcMYB6-1 could trans-activate the promoters of structural genes involved in anthocyanin biosynthesis and this trans-activation was significantly enhanced when co-expressed with CcbHLH1[34]. The late anthocyanin biosynthetic gene CcDFR was then chosen to clarify whether the mutational CcbHLH1 could retain the ability to enhance gene expression. Firstly, tobacco leaves were infiltrated with CcbHLH1, CcbHLH1#, and CcMYB6-1, respectively, followed by the visualization of firefly fluorescence using a molecular imaging system. The fluorescence signal in CcMYB6-1 was significantly stronger than that in the CcbHLH1/CcbHLH1#, suggesting CcbHLH1 or its mutant alone could not trans-activate the CcDFR promoter (Supplementary Fig. S4). Then CcbHLH1 and CcMYB6-1 were co-expressed and more stronger fluorescence signal was obtained, however, the signal in CcbHLH1# + CcMYB6-1 was similar as that in the SK + CcMYB6-1, suggesting CcbHLH1# could not enhance the trans-activation of the CcDFR promoter (Fig. 7a). Moreover, the dual luciferase assay was conducted to obtain more concrete statistics. The value of LUC/REN in SK was set as 1 for convenience. The combinations of SK + CcbHLH1/CcbHLH1# could not up-regulate the activity of CcDFR promoter, which was consistent with the molecular imaging results. Comparatively, co-transformed CcMYB6-1 and CcbHLH1 significantly enhanced the activity of the CcDFR promoter with 12.9-fold induction, while there was no significant difference between CcMYB6-1 + CcbHLH1# and SK + CcMYB6-1 (p < 0.01) (Fig. 7b). These results indicated that the truncated CcbHLH1 lost the ability to enhance the trans-activation of CcDFR promoter, which possibly was the main reason for the anthocyanin absence in DTPW.

    Figure 7.  Changes of trans-activation of CcDFR promoter before and after CcbHLH1 mutation. (a) The firefly fluorescence captured by a molecular imaging system after three days infiltration. (b) In vivo interactions between CcMYB6-1, CcbHLH1, and its mutant CcbHLH1# on the CcDFR promoter. Error bars were the S.E. of three biological replicates with each from at least two individual leaves. Different capital letters indicate significant difference at 1% level by Duncan's multiple test.
    DownLoad: Full-Size Img PowerPoint

    Anthocyanin content in tobacco leaves decreases after CcbHLH1 mutation

    Due to the lack of a stable genetic transformation system, the transient over-expression in tobacco leaves were conducted to clarify the functional changes after CcbHLH1 mutation. A total of five combinations were designed, including SK + CcMYB6-1, SK + CcbHLH1, SK + CcbHLH1#, CcMYB6-1 + CcbHLH1, and CcMYB6-1 + CcbHLH1#. After 9 d of co-cultivation, tobacco leaves infiltrated with CcMYB6-1 turned green to red, in which the CcMYB6-1 + CcbHLH1 group exhibited the darkest red, followed by CcMYB6-1 + CcbHLH1#, and SK + CcMYB6-1 groups. On the contrary, tobacco leaves infiltrated with SK + CcbHLH1 or SK + CcbHLH1# retained green (Fig. 8a). These results indicated that only CcMYB6-1 expressed can the tobacco leaves turn red, which was consistent with our previous research[34]. Notably, the leaves exhibited pale red rather than darker red after CcbHLH1 mutation, suggesting its function of synergistically regulating anthocyanin biosynthesis with CcMYB6-1 was also missing. Furthermore, the semi-quantitative interpretation using Cy3G as a standard was performed to obtain more direct evidence. There was no anthocyanin detected in SK + CcbHLH1 and SK + CcbHLH1# groups, while the anthocyanin content in CcMYB6-1 + CcbHLH1 was 10.8 mg/g (fresh weight, FW), significantly higher than that in other combinations. Notably, there was no significant difference between SK + CcMYB6-1 and CcMYB6-1 + CcbHLH1# (p < 0.01) (Fig. 8b), suggesting the truncated CcbHLH1 didn't play a role in stimulating anthocyanin biosynthesis together with CcMYB6-1. These results revealed that the loss of the conserved multi-domains of CcbHLH1 led to the loss of the ability to up-regulate anthocyanin biosynthesis with CcMYB6-1, which can account for the anthocyanin absence in the white petals of cornflower.

    Figure 8.  Transient over-expression in tobacco leaves. (a) Tobacco leaves infiltrated with five different combinations including SK + CcMYB6-1, SK + CcbHLH1, SK + CcbHLH1#, CcMYB6-1 + CcbHLH1, and CcMYB6-1 + CcbHLH1#. The photo was captured 9 d after infiltration. (b) The semi-quantification of anthocyanin accumulating in tobacco leaves. Error bars were the S.E. of four biological replicates with each from at least two individual leaves. Different capital letters indicate significant difference at 1% level by Duncan's multiple test.
    DownLoad: Full-Size Img PowerPoint

    Discussion

    Cornflower is favored by its exquisite capitulum and abundant flower color variation thereby is widely used in garden design, cut flowers, and food decoration. In our previous study, six cornflower cultivars with pure colors were collected. The UPLC-MS/MS analysis revealed that pelargonidin and cyanidin derivatives were the main anthocyanins accumulating in the pink/red and blue/mauve/black petals, respectively, while there was no anthocyanin detected in the white cornflower petals, which only accumulated apigenin derivatives[3]. Here, anthocyanins were further monitored in both vegetative and reproductive organs of cornflower (Fig. 2). There was no anthocyanin detected in roots, stems, and leaves, suggesting the anthocyanin deficiency in vegetative organs of cornflower. Notably, anthocyanins accumulated slightly in the sepals, and increased with petal development in DTPB, while no anthocyanin was found in both sepals and petals of DTPW, indicating its complete anthocyanin absence, which was further explained by the block of structural genes including CcF3'H, CcDFR, CcGT, and CcAT (Supplementary Fig. S2).

    To date, CcMYB6-1 and CcbHLH1 have been functionally characterized as positive regulators involved in the anthocyanin biosynthesis in cornflower. Considering that MYBs mutation usually leads to the anthocyanin deficiency and white phenotype in Raphanus sativus taproots, grapes, strawberries, and citrus[35−38], we focused on the gene expression and sequence isolation of CcMYB6-1. Unexpectedly, the transcript level of CcMYB6-1 was significantly higher in DTPW petals (p < 0.01, Fig. 2), and its full-length sequence in DTPW was entirely consistent with that in DTPB (Fig. 3), which was distinct from the CgsMYB12 mutation caused by a 1-bp deletion in the white basal region of Clarkia gracilis[39], the FaMYB10 mutation caused by an AG insertion in the white-fleshed strawberry[37], as well as the LsTT2 mutation in the white seeds of lettuce[40]. Notably, CcbHLH1 transcript was undetectable in DTPW (Fig. 2), consistent with the absence of structural gene expression and anthocyanin accumulation. The following gene isolation and multi-sequence alignment showed that CcbHLH1 in the white cornflower was spontaneously truncated to 1,125 bp, losing the basic helix-loop-helix domain in the N-terminal and the ACT-like domain in the C-terminal (Fig. 3), two necessary domains in regulatory activity, the mutation of which usually results in anthocyanin decrease[41,42].

    Generally, the base deletion or insertion, transposon insertion, and alternative splicing will give rise to the premature stop codon and frameshift, finally leading to the truncation of coding genes and anthocyanin loss[43−48]. In this study, the truncation of CcbHLH1 is the result of alternative splicing by comparing the genome sequence with two transcripts (Fig. 4). The truncated CcbHLH1# protein is still localized in the nucleus and could interact with CcMYB6-1 (Figs 5 & 6), suggesting the loss of necessary domains doesn't change its functional position and interaction relationship, which may be explained by the invariant MYB-interaction region in the N-terminal[18]. The following dual-luciferase assay revealed that CcbHLH1 alone couldn't stimulate the trans-activity of the CcDFR promoter, suggesting its function in a CcMYB6-1-dependent way (Fig. 7), which was different from petunia anthocyanin1, also a bHLH2 clade TF, that directly activates the expression of the dfrA gene[27]. However, the enhanced trans-activation of CcDFR promoter and anthocyanin biosynthesis ability when co-expressed with CcMYB6-1 disappeared after CcbHLH1 truncation (Figs 7 & 8), suggesting the loss of basic helix-loop-helix domain and ACT-like domain contributed to the regulatory inactivation, similar to the cases in chrysanthemum, tomato and petunia[29,49,50].

    A possible explanation is that the truncated TFs function as inhibitors involved in either competing with the functional protein for activation sites of structural genes or the formation of effective MYB-bHLH-WD40 protein complex, thus significantly affects anthocyanin levels. In maize, the dominant mutant C1-I, a truncated MYB transcription factor acts as anthocyanin inhibitor by competing C1 for activator sites of the biosynthetic genes like R1-nj[51]. Truncated MYBs or bHLHs usually lose the original ability to form the MBW complex thus leading to the anthocyanin decrease and color fading like chrysanthemum, radish, and wheat[29,52,53]. Differently, the truncated CcbHLH1 of cornflower retains its interaction with CcMYB6-1, but this CcbHLH1#-CcMYB6-1 complex can't effectively enhance the trans-activity of CcDFR promoter and anthocyanin accumulation in tobacco leaves like CcbHLH1-CcMYB6-1 complex (Figs 7 & 8), suggesting that the truncated variant inhibits anthocyanin biosynthesis by forming a dysfunctional complex.

    Alternative splicing plays a key regulatory role in anthocyanin accumulation, leading to the color variation of higher plant organs. The anthocyanin-free phenotype of the eggplant efc1 mutant is caused by the retention of the second intron in DFR by improper splicing[54]. In tomato and Brassica napus, alternative splicing brings the truncated R2R3-MYB protein without the key R3 domain, resulting in the non-interaction with bHLH transcription factor, and finally leading to anthocyanin loss[55,56]. Interestingly, there are three kinds of splicing variants of bHLH2 in chrysanthemum, namely, the activator CmbHLH2 with complete domains and the strongest regulatory effect, the activator CmbHLH2.1 with 26 amino acids difference at the C-terminal and less regulatory effect, as well as the dysfunctional CmbHLH2short with only partial MIR domain at the N-terminal[24,29,30], suggesting the more domains lost, the more functions disappear. The missing multi-domains in cornflower CcbHLH1# is also caused by alternative splicing, leading to the complete anthocyanin loss in DTPW. Together, these findings reveal alternative splicing may play a potential role in modulating anthocyanin biosynthesis in cornflower. The regulatory mechanism underlying alternative splicing remains to be seen in the near future.

    Conclusions

    The transcription activator in cornflower, CcbHLH1, was truncated to 1,125 bp because of alternative splicing, losing multi-domains at the C-terminal. The mutated CcbHLH1 protein could interact with CcMYB6-1, but lose the ability to trans-activate promoter activity of anthocyanin biosynthetic genes and to induce anthocyanin biosynthesis thereby, which resulted in the complete anthocyanin absence in the white cornflower. These obtained results provide insights into the molecular mechanism underlying the white color transition in higher plants.

  • The authors confirm contribution to the paper as follows: study conception and design: Deng C, Dai S; data collection and analysis: Deng C, Zheng X, Wang J, Li Y, Li J, Lu M, Gao R, Ji C, Hao Q; draft manuscript preparation: Deng C, Zheng X, Wang J, Li Y, Li J, Lu M, Gao R, Ji C, Hao Q. All authors reviewed the results and approved the final version of the manuscript.

  • All data generated or analyzed during this study are included in this published article and its supplementary information files.

    • Acknowledgments

    This research was supported by the National Natural Science Foundation, China (No. 32101579 and 32171849), the Shandong Province Natural Science Foundation, China (No. ZR2021QC143) and Shandong students' project for innovation training (S202210452029).

  • The authors declare that they have no conflict of interest.

  • Supplemental Fig. S1 (a) Flow cytometric analysis of CD4+T (CD3+ CD4+) cells. (b) Flow cytometry analysis of CD8+T (CD3+ CD8+) cells.
  • [1]

    Ngo PA, Neurath MF, López-Posadas R. 2022. Impact of Epithelial Cell Shedding on Intestinal Homeostasis. International Journal of Molecular Sciences 23:4160

    doi: 10.3390/ijms23084160

    CrossRef   Google Scholar

    [2]

    Lopes C, Almeida TC, Pimentel-Nunes P, Dinis-Ribeiro M, Pereira C. 2023. Linking dysbiosis to precancerous stomach through inflammation: Deeper than and beyond imaging. Frontiers in Immunology 14:1134785

    doi: 10.3389/fimmu.2023.1134785

    CrossRef   Google Scholar

    [3]

    Graziani F, Pinton P, Olleik H, Pujo A, Nicoletti C, et al. 2019. Deoxynivalenol inhibits the expression of trefoil factors (TFF) by intestinal human and porcine goblet cells. Archives of Toxicology 93:1039−49

    doi: 10.1007/s00204-019-02425-6

    CrossRef   Google Scholar

    [4]

    Miao W, Han Y, Yang Y, Hao Z, An N, et al. 2022. Dynamic changes in colonic structure and protein expression suggest regulatory mechanisms of colonic barrier function in torpor-arousal cycles of the daurian ground squirrel. International Journal of Molecular Sciences 23:9026

    doi: 10.3390/ijms23169026

    CrossRef   Google Scholar

    [5]

    An J, Liu Y, Wang Y, Fan R, Hu X, et al. 2022. The role of intestinal mucosal barrier in autoimmune disease: a potential target. Frontiers in Immunology 13:871713

    doi: 10.3389/fimmu.2022.871713

    CrossRef   Google Scholar

    [6]

    Hu Y, He Z, Zhang J, Zhang C, Wang Y, et al. 2023. Effect of Piper nigrum essential oil in dextran sulfate sodium (DSS)-induced colitis and its potential mechanisms. Phytomedicine 119:155024

    doi: 10.1016/j.phymed.2023.155024

    CrossRef   Google Scholar

    [7]

    Zhang Z, Zuo L, Song X, Wang L, Zhang Y, et al. 2024. Arjunolic acid protects the intestinal epithelial barrier, ameliorating Crohn's disease-like colitis by restoring gut microbiota composition and inactivating TLR4 signalling. Phytomedicine 123:155223

    doi: 10.1016/j.phymed.2023.155223

    CrossRef   Google Scholar

    [8]

    Fre S, Huyghe M, Mourikis P, Robine S, Louvard D, et al. 2005. Notch signals control the fate of immature progenitor cells in the intestine. Nature 435:964−968

    doi: 10.1038/nature03589

    CrossRef   Google Scholar

    [9]

    Ning H, Liu J, Tan J, Yi M, Lin X. 2024. The role of the Notch signalling pathway in the pathogenesis of ulcerative colitis: from the perspective of intestinal mucosal barrier. Frontiers in Medicine 10:1333531

    doi: 10.3389/fmed.2023.1333531

    CrossRef   Google Scholar

    [10]

    Zhang S, Zhang S, Hou Y, Huang Y, Cai J, et al. 2023. Porcine deltacoronavirus infection disrupts the intestinal mucosal barrier and inhibits intestinal stem cell differentiation to goblet cells via the notch signaling pathway. Journal of Virology 97:e0068923

    doi: 10.1128/jvi.00689-23

    CrossRef   Google Scholar

    [11]

    Ahmed I, Roy BC, Raach RMT, Owens SM, Xia LJ, et al. 2018. Enteric infection coupled with chronic Notch pathway inhibition alters colonic mucus composition leading to dysbiosis, barrier disruption and colitis. PLoS One 13:e0206701

    doi: 10.1371/journal.pone.0206701

    CrossRef   Google Scholar

    [12]

    Dandawate P, Subramaniam D, Panovich P, Standing D, Krishnamachary B, et al. 2020. Cucurbitacin B and I inhibits colon cancer growth by targeting the Notch signaling pathway. Scientific Reports 10:1290

    doi: 10.1038/s41598-020-57940-9

    CrossRef   Google Scholar

    [13]

    Avila-Carrasco L, Majano P, Sánchez-Toméro JA, Selgas R, López-Cabrera M, et al. 2019. Natural plants compounds as modulators of epithelial-to-mesenchymal transition. Frontiers in Pharmacology 10:715

    doi: 10.3389/fphar.2019.00715

    CrossRef   Google Scholar

    [14]

    Li Y, Wang Z, Jin J, Zhu SX, He GQ, et al. 2020. Quercetin pretreatment enhances the radiosensitivity of colon cancer cells by targeting Notch-1 pathway. Biochemical and Biophysical Research Communications 523:947−53

    doi: 10.1016/j.bbrc.2020.01.048

    CrossRef   Google Scholar

    [15]

    Jideani AIO, Silungwe H, Takalani T, Omolola AO, Udeh HO, et al. 2021. Antioxidant-rich natural fruit and vegetable products and human health. International Journal of Food Properties 24:41−67

    doi: 10.1080/10942912.2020.1866597

    CrossRef   Google Scholar

    [16]

    Ren S, Giusti MM. 2021. The effect of whey protein concentration and preheating temperature on the color and stability of purple corn, grape and black carrot anthocyanins in the presence of ascorbic acid. Food Research International 144:110350

    doi: 10.1016/j.foodres.2021.110350

    CrossRef   Google Scholar

    [17]

    Fallah AA, Sarmast E, Jafari T. 2020. Effect of dietary anthocyanins on biomarkers of oxidative stress and antioxidative capacity: A systematic review and meta-analysis of randomized controlled trials. Journal of Functional Foods 68:103912

    doi: 10.1016/j.jff.2020.103912

    CrossRef   Google Scholar

    [18]

    Tang S, Kan J, Sun R, Cai HH, Hong JH, et al. 2021. Anthocyanins from purple sweet potato alleviate doxorubicin-induced cardiotoxicity in vitro and in vivo. Journal of Food Biochemistry 45:e13869

    doi: 10.1111/jfbc.13869

    CrossRef   Google Scholar

    [19]

    Liu J, Zhang W, Jing H, Popovich DG. 2010. Bog bilberry (Vaccinium uliginosum L.) extract reduces cultured hep-g2, caco-2, and 3t3-l1 cell viability, affects cell cycle progression, and has variable effects on membrane permeability. Journal of Food Science 75:H103−H107

    doi: 10.1111/j.1750-3841.2010.01546.x

    CrossRef   Google Scholar

    [20]

    Chen J, Zhao Y, Tao X, Zhang M, Sun AD. 2015. Protective effect of blueberry anthocyanins in a CCL4-induced liver cell model. LWT - Food Science and Technology 60:1105−12

    doi: 10.1016/j.lwt.2014.10.010

    CrossRef   Google Scholar

    [21]

    Lin J, Tian J, Shu C, Cheng Z, Liu Y, et al. 2020. Malvidin-3-galactoside from blueberry suppresses the growth and metastasis potential of hepatocellular carcinoma cell Huh-7 by regulating apoptosis and metastases pathways. Food Science and Human Wellness 9:136−45

    doi: 10.1016/j.fshw.2020.02.004

    CrossRef   Google Scholar

    [22]

    Cheng Z, Lin J, Gao N, Sun X, Meng X, et al. 2020. Blueberry malvidin-3-galactoside modulated gut microbial dysbiosis and microbial TCA cycle KEGG pathway disrupted in a liver cancer model induced by HepG2 cells. Food Science and Human Wellness 9:245−55

    doi: 10.1016/j.fshw.2020.04.006

    CrossRef   Google Scholar

    [23]

    Huang WY, Liu YM, Wang J, Wang XN, Li CY. 2014. Anti-inflammatory effect of the blueberry anthocyanins malvidin-3-glucoside and malvidin-3-galactoside in endothelial cells. Molecules 19:12827−41

    doi: 10.3390/molecules190812827

    CrossRef   Google Scholar

    [24]

    Li F, Sun Q, Chen L, Zhang R, Zhang Z. 2024. Unlocking the health potential of anthocyanins: a structural insight into their varied biological effects. Critical Reviews In Food Science And Nutrition 00:1−21

    doi: 10.1080/10408398.2024.2328176

    CrossRef   Google Scholar

    [25]

    Li J, Wu T, Li N, Wang X, Chen G, et al. 2019. Bilberry anthocyanin extract promotes intestinal barrier function and inhibits digestive enzyme activity by regulating the gut microbiota in aging rats. Food & Function 10:333−43

    doi: 10.1039/c8fo01962b

    CrossRef   Google Scholar

    [26]

    Cremonini E, Daveri E, Mastaloudis A, Adamo AM, Mills D, et al. 2019. Anthocyanins protect the gastrointestinal tract from high fat diet-induced alterations in redox signaling, barrier integrity and dysbiosis. Redox Biology 26:101269

    doi: 10.1016/j.redox.2019.101269

    CrossRef   Google Scholar

    [27]

    Valdez JC, Cho J, Bolling BW. 2020. Aronia berry inhibits disruption of Caco-2 intestinal barrier function. Archives of Biochemistry And Biophysics 688:108409

    doi: 10.1016/j.abb.2020.108409

    CrossRef   Google Scholar

    [28]

    Ayvaz H, Cabaroglu T, Akyildiz A, Pala CU, Temizkan R, et al. 2022. Anthocyanins: Metabolic Digestion, Bioavailability, Therapeutic Effects, Current Pharmaceutical/Industrial Use, and Innovation Potential. Antioxidants 12:48

    doi: 10.3390/antiox12010048

    CrossRef   Google Scholar

    [29]

    Verediano TA, Stampini Duarte Martino H, Dias Paes MC, Tako E. 2021. Effects of Anthocyanin on Intestinal Health: A Systematic Review. Nutrients 13:1331

    doi: 10.3390/nu13041331

    CrossRef   Google Scholar

    [30]

    Wan MLY, Ling KH, El-Nezami H, Wang MF. 2019. Influence of functional food components on gut health. Critical Reviews in Food Science and Nutrition 59:1927−36

    doi: 10.1080/10408398.2018.1433629

    CrossRef   Google Scholar

    [31]

    Adolph TE, Zhang J. 2022. Diet fuelling inflammatory bowel diseases: preclinical and clinical concepts. Gut 71:2574−86

    doi: 10.1136/gutjnl-2021-326575

    CrossRef   Google Scholar

    [32]

    Ye C, Liu L, Ma X, Tong H, Gao J, et al. 2019. Obesity aggravates acute pancreatitis via damaging intestinal mucosal barrier and changing microbiota composition in rats. Scientific Reports 9:69

    doi: 10.1038/s41598-018-36266-7

    CrossRef   Google Scholar

    [33]

    Horowitz A, Chanez-Paredes SD, Haest X, Turner JR. 2023. Paracellular permeability and tight junction regulation in gut health and disease. Nature Reviews Gastroenterology & Hepatology 20:417−32

    doi: 10.1038/s41575-023-00766-3

    CrossRef   Google Scholar

    [34]

    Walmsley RS, Ayres RC, Pounder RE, Allan RN. 1998. A simple clinical colitis activity index. Gut 43:29−32

    doi: 10.1136/gut.43.1.29

    CrossRef   Google Scholar

    [35]

    Zhao L, Zhang Y, Liu G, Hao S, Wang C, et al. 2018. Black rice anthocyanin-rich extract and rosmarinic acid, alone and in combination, protect against DSS-induced colitis in mice. Food & Function 9:2796−808

    doi: 10.1039/c7fo01490b

    CrossRef   Google Scholar

    [36]

    Noah TK, Donahue B, Shroyer NF. 2011. Intestinal development and differentiation. Experimental Cell Research 317:2702−2710

    doi: 10.1016/j.yexcr.2011.09.006

    CrossRef   Google Scholar

    [37]

    Okumura R, Takeda K. 2017. Roles of intestinal epithelial cells in the maintenance of gut homeostasis. Experimental & Molecular Medicine 49:e338

    doi: 10.1038/emm.2017.20

    CrossRef   Google Scholar

    [38]

    Rivera CA, Lennon-Duménil AM. 2023. Gut immune cells and intestinal niche imprinting. Seminars In Cell & Developmental Bio logy 150−151:50−57

    doi: 10.1016/j.semcdb.2023.01.006

    CrossRef   Google Scholar

    [39]

    Slifer ZM, Blikslager AT. 2020. The Integral Role of Tight Junction Proteins in the Repair of Injured Intestinal Epithelium. International Journal of Molecular Sciences 21:972

    doi: 10.3390/ijms21030972

    CrossRef   Google Scholar

    [40]

    Wang Y, Gao N, Nieto-Veloza A, Zhou L, Sun X, et al. 2023. Lonicera caerulea polyphenols inhibit fat absorption by regulating Nrf2-ARE pathway mediated epithelial barrier dysfunction and special microbiota. Food Science and Human Wellness 12:1309−22

    doi: 10.1016/j.fshw.2022.10.013

    CrossRef   Google Scholar

    [41]

    Chen T, Shen M, Yu Q, Chen Y, Wen H, et al. 2022. Purple red rice anthocyanins alleviate intestinal damage in cyclophosphamide-induced mice associated with modulation of intestinal barrier function and gut microbiota. Food Chemistry 397:133768

    doi: 10.1016/j.foodchem.2022.133768

    CrossRef   Google Scholar

    [42]

    Logan M, MacKinder M, Clark CM, Kountouri A, Jere M, et al. 2022. Intestinal fatty acid binding protein is a disease biomarker in paediatric coeliac disease and Crohn's disease. BMC Gastroenter ology 22:260

    doi: 10.1186/s12876-022-02334-6

    CrossRef   Google Scholar

    [43]

    Wang Y, Liang K, Kong W. 2019. Intestinal Trefoil Factor 3 Alleviates the Intestinal Barrier Function Through Reducing the Expression of TLR4 in Rats with Nonalcoholic Steatohepatitis. Archives of Medical Research 50:2−9

    doi: 10.1016/j.arcmed.2019.03.004

    CrossRef   Google Scholar

    [44]

    Wardill HR, Choo JM, Dmochowska N, Mavrangelos C, Campaniello MA, et al. 2019. Acute Colitis Drives Tolerance by Persistently Altering the Epithelial Barrier and Innate and Adaptive Immunity. Inflammatory Bowel Diseases 25:1196−207

    doi: 10.1093/ibd/izz011

    CrossRef   Google Scholar

    [45]

    Gan Q, Song G, Fang W, Wang Y, Qi W. 2024. Fructose dose-dependently influences colon barrier function by regulation of some main physical, immune, and biological factors in rats. Journal of Nutritional Biochemistry 126:109582

    doi: 10.1016/j.jnutbio.2024.109582

    CrossRef   Google Scholar

    [46]

    Pu Z, Yang F, Wang L, Diao Y, Chen D. 2021. Advancements of compounds targeting Wnt and Notch signalling pathways in the treatment of inflammatory bowel disease and colon cancer. Journal of Drug Targeting 29:507−19

    doi: 10.1080/1061186X.2020.1864741

    CrossRef   Google Scholar

    [47]

    Artavanis-Tsakonas S, Rand MD, Lake RJ. 1999. Notch signaling: cell fate control and signal integration in development. Science 284:770−76

    doi: 10.1126/science.284.5415.770

    CrossRef   Google Scholar

    [48]

    Bray SJ. 2006. Notch signalling: a simple pathway becomes complex. Nature Reviews Molecular Cell Biology 7:678−89

    doi: 10.1038/nrm2009

    CrossRef   Google Scholar

    [49]

    Carulli AJ, Keeley TM, Demitrack ES, Chung J, Maillard I, et al. 2015. Notch receptor regulation of intestinal stem cell homeostasis and crypt regeneration. Developmental Biology 402:98−108

    doi: 10.1016/j.ydbio.2015.03.012

    CrossRef   Google Scholar

    [50]

    Andersson ER, Lendahl U. 2014. Therapeutic modulation of Notch signalling-are we there yet? Nature Reviews Drug Discovery 13:357−78

    doi: 10.1038/nrd4252

    CrossRef   Google Scholar

    [51]

    Lin JC, Wu JQ, Wang F, Tang FY, Sun J, et al. 2019. QingBai decoction regulates intestinal permeability of dextran sulphate sodium-induced colitis through the modulation of notch and NF-κ B signalling. Cell Proliferation 52:e12547

    doi: 10.1111/cpr.12547

    CrossRef   Google Scholar

  • Cite this article

    Zhang C, Zhang B, Zhang L, Adel Ashour A, Wang Y, et al. 2024. Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway. Food Innovation and Advances 3(3): 279−287 doi: 10.48130/fia-0024-0026
    Zhang C, Zhang B, Zhang L, Adel Ashour A, Wang Y, et al. 2024. Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway. Food Innovation and Advances 3(3): 279−287 doi: 10.48130/fia-0024-0026
    shu

Figures(6)  /  Tables(2)

Download PDF

Article Metrics

Article views(2102) PDF downloads(312)

Other Articles By Authors

ARTICLE   Open Access    

Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway

  • 1.

    College of Food Science, Shenyang Agricultural University, Dongling Road 120, Shenhe District, Shenyang 110161, China

  • 2.

    Lenovo (Beijing) Group Ltd., Beijing 100000, China

  • 3.

    Department of Pharmacognosy, Faculty of Pharmacy, Prince Sattam Bin Abdulaziz University, Al-kharj 11942, Saudi Arabia

  • 4.

    Department of Pharmacognosy, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt

  • 5.

    Key Laboratory of Healthy Food Nutrition and Innovative Manufacturing of Liaoning Province, Shenyang 110161, China

  • Received: 24 May 2024
  • Revised: 19 July 2024
  • Accepted: 05 August 2024
  • Published online: 23 August 2024
Food Innovation and Advances  3,  2024, 3(3): 279−287  |  Cite this article

Abstract: The colonic mucosal barrier is an important component of the intestinal barrier, and its integrity is crucial for maintaining digestive tract homeostasis and normal metabolism in the body. This study aimed to elucidate the mechanisms by which malvidin-3-O-galactoside (M3G) might ameliorate colonic mucosal barrier function, from the perspective of physical barrier function and immune barrier function. Male C57BL/6J mice were given dextran sulfate sodium (DSS) to establish a mice model for colitis and then administrated with or without M3G for one week. The results showed that M3G supplementation significantly improved the disease activity index (DAI) score and colon tissue injury in mice with DSS-induced colitis. M3G improved the colonic physical barrier function by modulating the expression of mucin2 (MUC2), claudin-1, occludin, zona occludens 1 (ZO-1), and intestinal fatty acid binding protein (iFABP) in the colonic mucosa. Additionally, M3G also relieved the colonic immune barrier of mice by increasing the level of secretory immunoglobulin A (SIgA) in colon tissue and the percentages of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in colon lamina propria monocytes in mice. Furthermore, M3G down-regulated Notch signaling pathway-related proteins such as Notch1, notch intracellular domain (NICD), delta-like ligand 4 (DLL4), delta-like ligand 1 (DLL1), and hairy/enhancer of split 1 (Hes1) of colon tissue. The present results demonstrated that M3G can improve colonic mucosal barrier function by inhibiting the Notch signaling pathway.

    HTML

    Introduction

    • The intestinal mucosal barrier is composed of epithelial cells and intercellular connections, which can effectively regulate the transportation of large molecules in the intestinal lumen, and prevent microorganisms, harmful solutes, toxins, and intraluminal antigens from entering bodies[1]. Mucosal barrier factors such as trefoil factor (TFF) family, diamine oxidase (DAO), and transform growth factor-ɑ (TGF-α) have protective and restorative effects on intestinal mucosal integrity, which are synthesized and secreted by intestinal mucosa[2−4]. The damage to intestinal barrier function can cause the invasion of antigens and bacteria in the lumen, and eventually lead to intestinal diseases, including diarrhea, inflammatory bowel disease (IBD), and Crohn's disease[5−7].

      The Notch signaling pathway plays a crucial role in a series of cellular processes, including proliferation, differentiation, development, migration, and apoptosis. Research suggests that the Notch signaling pathway is involved in intestinal development, and it can be connected to intestinal cell lineage specification[8]. Furthermore, the Notch signaling pathway can regulate intestinal stem cells, CD4+T cells, innate lymphoid cells, macrophages, and intestinal microbiota, and intervene in the intestinal mucosal barriers in cases of ulcerative colitis[9]. The activated Notch signaling pathway can suppress the goblet cells differentiation and mucus secretion, which would result in the disruption of the intestinal mucosal barrier[10]. In addition, the absence of the Notch signaling pathway would cause the dysfunction of tight junctions and adherens junctions of intestinal mucosa, which could lead to increased permeability of epithelial cells and exposure of luminal contents to the immune system and inflammation[11]. Phytochemicals, such as cucurbitacin, honokiol and quercetin have been reported to have therapeutic effects on intestinal diseases by targeting the Notch signaling pathway[12−14].

      Plant-based diets rich in phytochemicals, such as phenolics, anthocyanins, and vitamins, have been related to the prevention of human diseases[15]. Anthocyanins belong to a subclass of flavonoids, and are mainly in the form of different anthocyanin combined with glucose, galactose, and arabinose[16]. The physiological action of anthocyanins, such as antioxidant activity, anti-inflammation, and anti-obesity effects have been widely reported[17,18]. M3G is found naturally in plants and is reported to be the most common anthocyanin in different blueberry varieties[19,20]. Previous researchers reported that M3G from blueberry suppressed the growth and metastasis potential of hepatocellular carcinoma cells, modulated gut microbial dysbiosis, and protected TNF-α induced inflammatory response injury in vascular endothelial cells[21−23]. Anthocyanins with diverse molecular structures and from different dietary sources are bioavailable at diet-relevant dosage rates, and anthocyanins from berry fruit are absorbed and excreted by both humans and rats[24]. Studies have shown that anthocyanins have a protective effect on intestinal barrier damage by regulating gut microbiota, tight junction (TJ) protein expression, and secretion of MUC2[25−27]. In addition to physiological indicators related to the intestinal barrier, the regulation of the Notch signaling pathway was involved in this study. Therefore, it is speculated that M3G could improve the colonic mucosal barrier function via the Notch signaling pathway.

      To prove this hypothesis, the effects of M3G on the colonic mucosal barrier function were investigated in DSS-induced colitis mice. The pathological morphology of the colon tissue, markers of intestinal physical barrier function and immune barrier function and the Notch signaling pathway were evaluated to reveal the mechanism of M3G in improving colonic mucosal barrier function. The results are expected to lay the foundation for the utilization of anthocyanins as a promising natural product for improving intestinal diseases.

    Materials and methods

      Materials

    • M3G (CAS: 30113-37-2) used in this study was purchased from Xinyi Science and Technology Instrument Business Department, Baoji, Shanxi, China (HPLC ≥ 98%).

      Animal experiments

    • Five-week-old male C57BL/6J mice (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) weighing 16−18 g were housed and given AIN-93M diet (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) feeding. The animal experiment was carried out according to the guidelines of the Standards for Laboratory Animals of China (GB 14922-94, GB 14923-94, and GB/T 14925-94) and the Ethics Committee of Shenyang Agricultural University (IACUC Issue No.: 2023022401). All animal housing and experiments were conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals.

      After acclimating to the breeding environment for one week, the mice were randomly divided into two groups: control group (CG group, n = 6) and model group (n = 12). On days 1−7, the mice of the model group were given 2.5% DSS (CAS: 9011-18-1) dissolved in drinking water, while the mice of the CG group were given the same volume of drinking water as the model group. On days 8−14, mice of the model group were randomly divided into two equal groups (n = 6): DSS group and M3G group. The mice of the CG and DSS groups were administered intragastrically via drinking water, and the mice of the M3G group were administered intragastrically by M3G (5 mg/kg body weight (BW)/d) dissolved in drinking water, and the liquid volume was controlled to be the same. For all groups of mice, the body weight, food consumption, stool consistency, and bloody stool were measured daily during the experiment. On day 15, mice were sacrificed after a 12 h fast, and the colon tissue samples of the mice were collected. The length of the colon tissue was measured and recorded.

      Histopathological analysis

      Hematoxylin-eosin (HE) staining

    • Colon tissue was embedded with paraffin and then cut into sections. After being dewaxed from paraffin, the tissue was placed in water, and stained with hematoxylin and eosin solution. The stained tissue was dehydrated and sealed for observation. A microscope (BX53, Olympus Co., Ltd., Tokyo, Japan) was used to observe the stained tissue and photographed using 100× magnification. The damage in epithelial cells of colon tissue was evaluated.

      Periodic acid-schiff (PAS) staining

    • The colon tissue was dewaxed and placed in water after being embedded with paraffin, and then stained with schiff and hematoxylin solution. The stained tissue was dehydrated and sealed for observation. A microscope was used to observe the stained tissue and photographed using 100× magnification. The mucosal thickness and the population of goblet cells of the colon tissue were measured and recorded.

      Real-time polymerase chain reaction (RT-PCR)

    • The expression of MUC2 in colon tissue was detected by RT-PCR. Total RNA was extracted from colon tissue, and the concentration was determined using an ultraviolet spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The single-stranded cDNA of the extracted RNA (0.1 μL) was synthesized using a Transcriptor First Strand cDNA Synthesis Kit (Roche Co., Ltd., Basel, Kanton Basel, Switzerland). ExicylerTM 96 (Bioneer Corporation, Daejeon, Korea) was used to analyze the fluorescence quantitative cDNA. The reaction conditions were as follows: 94 °C for 5 min, 94 °C for 10 s, 60 °C for 20 s, 72 °C for 30 s, then followed by 40 cycles of 72 °C for 2 min 30 s, 40 °C for 1 min 30 s, and then melting from 60 to 94 °C, and incubating at 25 °C for 1−2 min. The primer sequences are shown in Table 1.

      Table 1.  The primer sequences used in the RT-PCR analysis.

      Gene Prime Sequence (5'-3') Size (bp)
      MUC2 Forward TGTGCCTGGCTCTAATA 17
      Reverse AGGTGGGTTCTTCTTCA 17
      β-actin Forward CTGTGCCCATCTACGAGGGCTAT 23
      Reverse TTTGATGTCACGCACGATTTCC 22

      Western blot analysis

    • The whole proteins from the colon tissue (200 mg) were extracted using a Whole Cell Lysis Assay kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Briefly, colon tissue was cut into pieces, and then mixed with phenylmethylsulfonyl fluorid (PMSF), followed by adding the protein extraction reagents A and B to prepare the tissue homogenate. Protein concentration was then determined using a Bradford Kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The membranes were blocked with 5% non-fat dry milk in TBST buffer for 1 h, followed by incubating overnight at 4 °C with the appropriate monoclonal primary antibody (detailed information in Table 2). Then membranes were washed to remove non-bound antibodies, and then incubated with the secondary antibody (goat anti-rabbit immunoglobin G-horseradish peroxidase (IgG-HRP), 1:5000; Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) at 37 °C for 45 min. The enhanced chemiluminescence (ECL) western blotting detection reagent (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) was used to detect the protein bands, and then the protein bands were visualized by a Gel Imaging System (Beijing Liuyi Biotechnology Co., Ltd., Beijing, China).

      Table 2.  Details of the primary antibodies used in the experiment.

      Primary antibody Dilution ratio Manufacturer
      Claudin-1 1:500 Wanlei Bio Co., Ltd.
      Occludin 1:500 Wanlei Bio Co., Ltd.
      ZO-1 1:500 Wanlei Bio Co., Ltd.
      iFABP 1:1000 ABclonal Technology Co., Ltd.
      DLL1 1:500 Wanlei Bio Co., Ltd.
      DLL4 1:1000 ABclonal Technology Co., Ltd.
      Notch1 1:500 Wanlei Bio Co., Ltd.
      NICD 1:1000 Affinity Biosciences Co., Ltd.
      Hes1 1:1000 ABclonal Technology Co., Ltd.
      TFF3 1:1000 Affinity Biosciences Co., Ltd.
      β-actin 1:1000 Wanlei Bio Co., Ltd.

      Enzyme-linked immunosorbent assay (ELISA)

    • The level of SIgA in colon tissue was detected by SIgA ELISA kit (Model number: EM1362, Wuhan Fine Biotech Co., Ltd., Wuhan, Hubei, China). The experiment was carried out according to the ELISA kit instructions.

      Flow cytometry (FCM)

    • CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells in colonic lamina propria monocytes (LPMC) were detected by FCM. The colonic epithelial cells were isolated by adding digestive solution to the colon tissue. After digestion, screening, re-suspension precipitation, and centrifugation, the precipitate was collected as colonic LPMC. Labeled antibodies were added to the flow tube and incubated according to the instructions. After washing with phosphate buffered saline (PBS), the cells were re-suspended in PBS solution. The CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells were detected by flow cytometric (Agilent Technologies, Inc., Santa Clara, CA, USA).

      Statistical analysis

    • Data are expressed as mean ± standard deviation (SD) based on six replicates. Differences between two groups were assessed using Student's t tests. The results were considered statistically significant at p < 0.05. Data were analyzed using Graph Pad Prism 8.0 (Graph Pad Software, San Diego, CA, USA) and SPSS 17.0 (IBM Corporation, Armonk, NY, USA).

    Results

      Effects of M3G on the body weight gain, DAI score, and food intake of mice with DSS-induced colitis

    • The body weight of mice was monitored daily during the experimental period. As shown in Fig. 1a, after being fed with DSS for 7 d, the body weight of the mice in the DSS group was reduced significantly (p < 0.01) compared with that of the CG group. While the body weight of the mice in the M3G group was increased, and exhibited significantly higher (p < 0.01) body weight gain compared with the DSS group. The DAI score of the mice in the DSS group was significantly higher (p < 0.01) than that of the CG group, but M3G supplementation significantly lowered (p < 0.01) the DAI score (Fig. 1b), which demonstrates that the DSS-induced mice colitis model was established successfully and M3G inhibited colon tissue damage in DSS-fed mice. Compared with the CG group, the food intake of the mice fed with DSS was significantly reduced (p < 0.01), and M3G supplementation significantly increased (p < 0.05) the food intake (Fig. 1c).

      Figure 1. 

      Effect of M3G on body weight gain, DAI score, and food intake in mice. (a) Body weight gain. (b) DAI score (Fecal consistency: 0 = normal, 1 = semi-formed, 2 = soft stool, 3 = diarrhea or watery stool; bloody stool: 0 = occult blood negative, 1 = occult blood positive, 2 = visible bloody stool, 3 = massive hemorrhage; weight loss: 0 = 0%, 1 = 1%−5 %, 2 = 6%−10% ; 3 = 11%−15% reduction). (c) Food intake. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

      Effects of M3G on the colonic mucosal barrier function of mice with DSS-induced colitis

      Pathological morphology changes of the colon tissue

    • Representative HE and PAS-stained sections of the colon are shown in Fig. 2a & b. The morphology of colon tissue in the CG group did not exhibit any damage, while damage in epithelial cells and goblet cells, inflammatory cells infiltration, and separation of the muscle layer and mucosal muscle layer were observed in the DSS group. The above damage to the tissue was changed for the better by M3G supplementation, with only small levels of damage in epithelial cells and goblet cells, inflammatory cell infiltration, and separation of the muscle layer and mucosal muscle layer compared to that in the CG group.

      Figure 2. 

      Effect of M3G on the pathological morphology of colon tissue. (a) HE staining of colon tissue. Original magnifications: 100×. (b) PAS staining of colon tissue. Original magnifications: 100×. (c) The damage score of colon tissue. (1) Epithelial cell damage: 0 = normal morphology; 1 = regional destruction of the epithelial surface; 2 = diffuse epithelial destruction and/or mucosal ulcers involving submucosa; 3 = severe epithelial damage. (2) Inflammatory cell infiltration: 0 = no infiltration or less than 5 cells; 1 = mild infiltration of the inherent layer; 2 = moderate infiltration of the muscular mucosa; 3 = high infiltration of the muscular mucosa; 4 = severe infiltration involving submucosa. (3) Separation of muscle layer and mucosal muscle layer: 0 = normal; 1 = moderate; 2 = severe. (4) Goblet cell depletion: 0 = no depletion; 1 = presence of disordered goblet cells; 2 = 1 to 3 regions without goblet cells; 3 = more than 3 regions without goblet cells; 4 = complete depletion of goblet cells. (d) The colon length. (e) The mucosal thickness of colon tissue. (f) Number of goblet cells in colon tissue. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

      HE score was calculated to evaluate the degree of colon tissue damage. The HE score in the DSS group was significantly higher (p < 0.01) than that in the CG group. Supplementation of M3G significantly reduced (p < 0.01) the score, which decreased by almost 50% of that in the DSS group (Fig. 2c). The colon length in the DSS group was significantly lower (p < 0.01) than that in the CG group, which was significantly increased (p < 0.01) by M3G supplementation (Fig. 2d). The mucosal thickness and the number of goblet cells of the colon tissue were determined by PAS staining. Compared with the CG group, the mucosal thickness and the number of goblet cells of the colon tissue were significantly decreased (p < 0.01) in the DSS group, but those were significantly increased (p < 0.01) in the M3G group (Fig. 2e & f). These results suggest that M3G supplementation can decrease the pathological damage in the colon tissue induced by DSS.

      Effects of M3G on the colonic mucosal barrier function

    • The mRNA expression level of MUC2 in the colonic mucosa tissue was determined. Compared with the CG group, DSS significantly decreased (p < 0.01) the mRNA level of MUC2, but this effect was significantly suppressed (p < 0.01) by M3G supplementation (Fig. 3a). The protein levels of claudin-1, occludin, ZO-1, iFABP, and TFF3 in the colon tissue were subsequently assessed. The protein expression levels of claudin-1, occludin, and ZO-1 in the DSS group were significantly lower than those in the CG group (p < 0.01). M3G supplementation significantly inhibited (p < 0.01) the reduction in the expression of these proteins (Fig. 3b−d). Regarding the protein expression level of iFABP, it was significantly higher (p < 0.01) in the DSS group than that in the CG group. M3G supplementation significantly decreased (p < 0.01) iFABP expression level compared with the DSS group (Fig. 3e). The protein expression level of TFF3 was significantly higher (p < 0.01) in the DSS group than that in the CG group. However, M3G supplementation significantly intensified (p < 0.01) the increase of TFF3 expression compared with the DSS group (Fig. 3f). These results indicate that M3G can regulate colonic epithelial barrier function.

      Figure 3. 

      Effects of M3G on the colonic epithelial barrier disruption. (a) The mRNA expression level of MUC2. (b) The protein expression level of claudin-1. (c) The protein expression level of occludin. (d) The protein expression level of ZO-1. (e) The protein expression level of iFABP. (f) The protein expression level of TFF3. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

      Effects of M3G on the colonic immune barrier function

    • The content of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in colonic LPMC of mice in each group were detected by FCM as shown in Fig. 4 and Supplemental Fig. S1. Compared with the CG group, the percentages of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in the DSS group were significantly increased (p < 0.01), and those were significantly decreased (p < 0.05) after M3G supplementation (Fig. 4a & b). SIgA was measured as an indicator of immune barrier function in the colon tissue. The level of SIgA in the DSS group was significantly lower (p < 0.01) than that in the CG group. Supplementation of M3G significantly raised (p < 0.01) the level of SIgA (Fig. 4c). These results indicate that M3G can improve the colonic immune dysfunction induced by DSS.

      Figure 4. 

      Effect of M3G on the colonic immune barrier function. (a) The percentage of CD4+T (CD3+CD4+) cells in the colon tissue. (b) The percentage of CD8+T (CD3+CD8+) cells in the colon tissue. (c) The level of SIgA in the colonic mucosal tissue. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

      Effects of M3G on the Notch signaling pathway in colon tissue

    • Subsequently, the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in the colon tissue were measured (Fig. 5). DSS significantly up-regulated (p < 0.01) these protein expression levels compared with the CG group. M3G supplementation significantly (p < 0.01) down-regulated the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in comparison with the DSS group. The results indicate that M3G can inhibit the over-activation of the Notch signaling pathway.

      Figure 5. 

      Effects of M3G on the protein expression levels of Notch1, NICD, DLL4, DLL1, and Hes1 in the colon tissue. (a) The protein expression level of Notch1. (b) The protein expression level of NICD. (c) The protein expression level of DLL4. (d) The protein expression level of DLL1. (e) The protein expression level of Hes1. Results are expressed as the mean ± SD (n = 6). * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

      Associations between physiological index and the Notch signaling pathway

    • To explain the relationships between them, the Spearman r correlations between biomarkers and the Notch signaling pathway were analyzed, and represented using a heatmap. As shown in Fig. 6, colon length, food intake, ZO-1, number of goblet, MUC2, SIgA, claudin-1, occludin, body weight gain, and mucosal thickness were significantly (p < 0.01 or p < 0.05) positively correlated with Notch1, NICD, DLL4, DLL1, and Hes1. Conversely, HE score, iFABP, DAI score, CD4+T, and CD8+T were significantly (p < 0.01) negatively correlated with Notch1, NICD, DLL4, DLL1 and Hes1. In particular, TFF3 was only significantly (p < 0.05) positively correlated with DLL1, and Hes1. The results indicate that M3G may ameliorate the colonic mucosal barrier dysfunction via modulation of the Notch signaling pathway.

      Figure 6. 

      Heatmap of the Spearman r correlations between biomarkers and the Notch signaling pathway. * p < 0.05 and ** p < 0.01 indicate significant differences between two groups.

    Discussion

    • Within the last five years, special attention is being paid to the therapeutic effects of anthocyanins. The recent studies could give evidence to prove the therapeutic potential of anthocyanins from different sources against various diseases via in vitro, in vivo, and epidemiological experiments[28]. The anthocyanin supplementation has been demonstrated to have positive effects on intestinal health[29]. The intestinal barrier is one of the crucial factors which can affect intestinal health and normal intestinal barrier function not only maintains intestinal health but also protects overall health by protecting the body from intestine injury, pathogen infection, and disease occurrence[30]. The disruption of intestinal barrier integrity is regarded as an important factor leading to IBD, obesity, and metabolic disorders[31−33]. In this study, the effects of M3G on regulating the colonic physical barrier function and colonic immune barrier function in DSS-induced colitis mice were explored.

      M3G supplementation reduced the DAI score and the HE score of colon tissue, and restored colon length, mucosal thickness, and the number of goblet cells in the colon tissue, indicating that M3G can alleviate DSS-induced colon tissue damage and colitis symptoms in mice. The DAI score was developed as a simplified clinical colitis activity index to assess the severity of colitis[34]. Zhao et al. have found that black rice anthocyanin-rich extract can significantly decrease the DAI and HE scores of colon tissue in DSS-induced colitis mice[35]. Intestinal goblet cells are mainly differentiated from multipotential stem cells. Intestinal stem cells were located at the base of the crypt and distributed in intestinal mucosal epithelial cells, composing around 50% of colon epithelial cells[36]. The mucus layer is formed by goblet cell secretion, it separates the intestinal epithelium from the intestinal lumen, thereby preventing the invasion of pathogenic microorganisms and the translocation of intestinal microbiota[37]. The results suggested that M3G might repair the colonic mucosa by increasing the number of goblet cells.

      MUC2 is the most abundant mucin secreted by goblet cells of the colon, goblet cells, and MUC2 play important roles in maintaining and protecting the intestinal mucosal barrier[38]. M3G supplementation restored the level of MUC2 by nearly double that of the DSS group. Claudin-1, occludin, and ZO-1 are TJ proteins, which is an important component of the intestinal physical barrier[39]. M3G supplementation mitigated the down-regulation of claudin-1, occludin, and ZO-1 in DSS-induced colitis mice. Wang et al. have found that Lonicera caerulea polyphenols can increase the expression levels of occludin in HFD rats[40]. Chen et al. have found that purple-red rice anthocyanins alleviated intestinal barrier dysfunction in cyclophosphamide-induced mice by up-regulating the expression of tight junction proteins[41]. iFABP can serve as a biomarker of small bowel damage in coeliac disease and Crohn's disease, and supplementation of M3G down-regulated the expression level of iFABP in colon tissue[42]. It has been reported that TFF3 alleviated the intestinal barrier function by reducing the expression of TLR4 in rats with nonalcoholic steatohepatitis, and supplementation of M3G increased the expression level of TFF3 in this research[43]. Although the effect of M3G on epithelial TJ proteins and other related proteins were limited, the beneficial effect of M3G on the colonic mucosal barrier function was supported by histological evaluation.

      The intestinal immune barrier is composed of intestinal mucosal lymphoid tissue and intestinal plasma cell secreted antibodies. Inflammatory damage in acute colitis influences the gut microbiota, epithelial barrier, and immune function in subsequent colitis[44]. Fructose can influence colon barrier function by regulating some main physical, immune, and biological factors in rats[45]. SIgA, CD4+T cells, and CD8+T cells play important roles in the functioning of the human immune system. The results indicated that M3G supplementation can maintain the colonic immune barrier function by modulating the level of SIgA, and the percentages of CD4+T cells and CD8+T cells of colon tissue.

      Notch signaling pathways are important for the maintenance of intestinal epithelial barrier integrity, and its abnormal activation is related to IBD and colon cancer[46]. Among the four Notch receptors in mammals, the most scattered in the intestine is Notch1[47]. NICD is the active form of the Notch receptor, NICD enters the nucleus, binds to the recruitment co-activator transcription complex, and then combines with the Hes gene to regulate the fate of cells[48,49]. DLL1 and DLL4 can serve as ligands for Notch signaling receptors[50]. Lin et al. found that qingbai decoction had beneficial effects on the mucus layer and mechanical barrier of DSS-induced colitis by inhibiting Notch signaling[51]. Supplementation with M3G significantly down-regulated Notch1, NICD, DLL4, DLL1, and Hes1 expression levels in the colon tissue, and there is a significant correlation between biomarkers and Notch signaling pathway-related proteins, suggesting that M3G might sustain the colonic barrier function via inhibiting the Notch signaling pathway.

    Conclusions

    • The present results showed that M3G exerted an improvement effect on the colonic mucosal barrier (physical barrier and immune barrier) function in DSS-induced colitis mice. The positive impact of M3G on the colonic mucosal barrier function may be ascribed to the modulation of permeability, stability, and integrity of the colonic mucosa by down-regulating the Notch signaling pathway. The results provide theoretical support for anthocyanins as the raw materials of functional products related to intestinal health. However, this study also has limitations, such as lacking intensive research on the effect mechanisms through cell experiments. Therefore, intensive research and clinical tests are the future direction.

    Author contributions

    • The authors confirm contribution to the paper as follows: study conception and design: Zhang C, Jiao X; data collection: Zhang L; analysis and interpretation of results: Zhang C, Zhang L, Zhang B, Zhang Y; draft manuscript preparation: Zhang C, Wang Y, Tan H, Li L, Jiao X. All authors reviewed the results and approved the final version of the manuscript.

    Data availability

    • The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

      Acknowledgments

      • We would like to thank the Liaoning Provincial Department of Education Project - General Project (LJKMZ20221060).

      Conflict of interest

      • The authors declare that they have no conflict of interest.

      Supplementary information
      • Supplemental Fig. S1 (a) Flow cytometric analysis of CD4+T (CD3+ CD4+) cells. (b) Flow cytometry analysis of CD8+T (CD3+ CD8+) cells.
      Rights and permissions
      • Copyright: © 2024 by the author(s). Published by Maximum Academic Press on behalf of China Agricultural University, Zhejiang University and Shenyang Agricultural University. This article is an open access article distributed under Creative Commons Attribution License (CC BY 4.0), visit https://creativecommons.org/licenses/by/4.0/.
    Figure (6)  Table (2) References (51)
  • About this article
    Cite this article
    Zhang C, Zhang B, Zhang L, Adel Ashour A, Wang Y, et al. 2024. Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway. Food Innovation and Advances 3(3): 279−287 doi: 10.48130/fia-0024-0026
    Zhang C, Zhang B, Zhang L, Adel Ashour A, Wang Y, et al. 2024. Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway. Food Innovation and Advances 3(3): 279−287 doi: 10.48130/fia-0024-0026
    shu

Catalog

  • HTML

  • Introduction
  • Materials and methods

  • Materials

  • Animal experiments

  • Histopathological analysis

  • Hematoxylin-eosin (HE) staining
  • Periodic acid-schiff (PAS) staining

  • Real-time polymerase chain reaction (RT-PCR)

  • Western blot analysis

  • Enzyme-linked immunosorbent assay (ELISA)

  • Flow cytometry (FCM)

  • Statistical analysis

  • Results

  • Effects of M3G on the body weight gain, DAI score, and food intake of mice with DSS-induced colitis

  • Effects of M3G on the colonic mucosal barrier function of mice with DSS-induced colitis

  • Pathological morphology changes of the colon tissue
  • Effects of M3G on the colonic mucosal barrier function
  • Effects of M3G on the colonic immune barrier function

  • Effects of M3G on the Notch signaling pathway in colon tissue

  • Associations between physiological index and the Notch signaling pathway

  • Discussion
  • Conclusions
  • Author contributions
  • Data availability
  • Acknowledgments
  • Conflict of interest
  • Supplementary information
  • Rights and permissions
  • About this article

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return