-
M3G (CAS: 30113-37-2) used in this study was purchased from Xinyi Science and Technology Instrument Business Department, Baoji, Shanxi, China (HPLC ≥ 98%).
Animal experiments
-
Five-week-old male C57BL/6J mice (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) weighing 16−18 g were housed and given AIN-93M diet (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) feeding. The animal experiment was carried out according to the guidelines of the Standards for Laboratory Animals of China (GB 14922-94, GB 14923-94, and GB/T 14925-94) and the Ethics Committee of Shenyang Agricultural University (IACUC Issue No.: 2023022401). All animal housing and experiments were conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals.
After acclimating to the breeding environment for one week, the mice were randomly divided into two groups: control group (CG group, n = 6) and model group (n = 12). On days 1−7, the mice of the model group were given 2.5% DSS (CAS: 9011-18-1) dissolved in drinking water, while the mice of the CG group were given the same volume of drinking water as the model group. On days 8−14, mice of the model group were randomly divided into two equal groups (n = 6): DSS group and M3G group. The mice of the CG and DSS groups were administered intragastrically via drinking water, and the mice of the M3G group were administered intragastrically by M3G (5 mg/kg body weight (BW)/d) dissolved in drinking water, and the liquid volume was controlled to be the same. For all groups of mice, the body weight, food consumption, stool consistency, and bloody stool were measured daily during the experiment. On day 15, mice were sacrificed after a 12 h fast, and the colon tissue samples of the mice were collected. The length of the colon tissue was measured and recorded.
Histopathological analysis
Hematoxylin-eosin (HE) staining
-
Colon tissue was embedded with paraffin and then cut into sections. After being dewaxed from paraffin, the tissue was placed in water, and stained with hematoxylin and eosin solution. The stained tissue was dehydrated and sealed for observation. A microscope (BX53, Olympus Co., Ltd., Tokyo, Japan) was used to observe the stained tissue and photographed using 100× magnification. The damage in epithelial cells of colon tissue was evaluated.
Periodic acid-schiff (PAS) staining
-
The colon tissue was dewaxed and placed in water after being embedded with paraffin, and then stained with schiff and hematoxylin solution. The stained tissue was dehydrated and sealed for observation. A microscope was used to observe the stained tissue and photographed using 100× magnification. The mucosal thickness and the population of goblet cells of the colon tissue were measured and recorded.
Real-time polymerase chain reaction (RT-PCR)
-
The expression of MUC2 in colon tissue was detected by RT-PCR. Total RNA was extracted from colon tissue, and the concentration was determined using an ultraviolet spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The single-stranded cDNA of the extracted RNA (0.1 μL) was synthesized using a Transcriptor First Strand cDNA Synthesis Kit (Roche Co., Ltd., Basel, Kanton Basel, Switzerland). ExicylerTM 96 (Bioneer Corporation, Daejeon, Korea) was used to analyze the fluorescence quantitative cDNA. The reaction conditions were as follows: 94 °C for 5 min, 94 °C for 10 s, 60 °C for 20 s, 72 °C for 30 s, then followed by 40 cycles of 72 °C for 2 min 30 s, 40 °C for 1 min 30 s, and then melting from 60 to 94 °C, and incubating at 25 °C for 1−2 min. The primer sequences are shown in Table 1.
Table 1. The primer sequences used in the RT-PCR analysis.
Gene Prime Sequence (5'-3') Size (bp) MUC2 Forward TGTGCCTGGCTCTAATA 17 Reverse AGGTGGGTTCTTCTTCA 17 β-actin Forward CTGTGCCCATCTACGAGGGCTAT 23 Reverse TTTGATGTCACGCACGATTTCC 22 Western blot analysis
-
The whole proteins from the colon tissue (200 mg) were extracted using a Whole Cell Lysis Assay kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Briefly, colon tissue was cut into pieces, and then mixed with phenylmethylsulfonyl fluorid (PMSF), followed by adding the protein extraction reagents A and B to prepare the tissue homogenate. Protein concentration was then determined using a Bradford Kit (BioTeke Co., Ltd., Beijing, China) according to the manufacturer’s protocol. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The membranes were blocked with 5% non-fat dry milk in TBST buffer for 1 h, followed by incubating overnight at 4 °C with the appropriate monoclonal primary antibody (detailed information in Table 2). Then membranes were washed to remove non-bound antibodies, and then incubated with the secondary antibody (goat anti-rabbit immunoglobin G-horseradish peroxidase (IgG-HRP), 1:5000; Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) at 37 °C for 45 min. The enhanced chemiluminescence (ECL) western blotting detection reagent (Wanlei Bio Co., Ltd., Shenyang, Liaoning, China) was used to detect the protein bands, and then the protein bands were visualized by a Gel Imaging System (Beijing Liuyi Biotechnology Co., Ltd., Beijing, China).
Table 2. Details of the primary antibodies used in the experiment.
Primary antibody Dilution ratio Manufacturer Claudin-1 1:500 Wanlei Bio Co., Ltd. Occludin 1:500 Wanlei Bio Co., Ltd. ZO-1 1:500 Wanlei Bio Co., Ltd. iFABP 1:1000 ABclonal Technology Co., Ltd. DLL1 1:500 Wanlei Bio Co., Ltd. DLL4 1:1000 ABclonal Technology Co., Ltd. Notch1 1:500 Wanlei Bio Co., Ltd. NICD 1:1000 Affinity Biosciences Co., Ltd. Hes1 1:1000 ABclonal Technology Co., Ltd. TFF3 1:1000 Affinity Biosciences Co., Ltd. β-actin 1:1000 Wanlei Bio Co., Ltd. Enzyme-linked immunosorbent assay (ELISA)
-
The level of SIgA in colon tissue was detected by SIgA ELISA kit (Model number: EM1362, Wuhan Fine Biotech Co., Ltd., Wuhan, Hubei, China). The experiment was carried out according to the ELISA kit instructions.
Flow cytometry (FCM)
-
CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells in colonic lamina propria monocytes (LPMC) were detected by FCM. The colonic epithelial cells were isolated by adding digestive solution to the colon tissue. After digestion, screening, re-suspension precipitation, and centrifugation, the precipitate was collected as colonic LPMC. Labeled antibodies were added to the flow tube and incubated according to the instructions. After washing with phosphate buffered saline (PBS), the cells were re-suspended in PBS solution. The CD4+T (CD3+CD4+) cells and CD8+T (CD3+CD8+) cells were detected by flow cytometric (Agilent Technologies, Inc., Santa Clara, CA, USA).
Statistical analysis
-
Data are expressed as mean ± standard deviation (SD) based on six replicates. Differences between two groups were assessed using Student's t tests. The results were considered statistically significant at p < 0.05. Data were analyzed using Graph Pad Prism 8.0 (Graph Pad Software, San Diego, CA, USA) and SPSS 17.0 (IBM Corporation, Armonk, NY, USA).
-
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
-
About this article
Cite this article
Zhang C, Zhang B, Zhang L, Adel Ashour A, Wang Y, et al. 2024. Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway. Food Innovation and Advances 3(3): 279−287 doi: 10.48130/fia-0024-0026
Malvidin-3-O-galactoside ameliorates colonic mucosal barrier function via the Notch signaling pathway
- Received: 24 May 2024
- Revised: 19 July 2024
- Accepted: 05 August 2024
- Published online: 23 August 2024
Abstract: The colonic mucosal barrier is an important component of the intestinal barrier, and its integrity is crucial for maintaining digestive tract homeostasis and normal metabolism in the body. This study aimed to elucidate the mechanisms by which malvidin-3-O-galactoside (M3G) might ameliorate colonic mucosal barrier function, from the perspective of physical barrier function and immune barrier function. Male C57BL/6J mice were given dextran sulfate sodium (DSS) to establish a mice model for colitis and then administrated with or without M3G for one week. The results showed that M3G supplementation significantly improved the disease activity index (DAI) score and colon tissue injury in mice with DSS-induced colitis. M3G improved the colonic physical barrier function by modulating the expression of mucin2 (MUC2), claudin-1, occludin, zona occludens 1 (ZO-1), and intestinal fatty acid binding protein (iFABP) in the colonic mucosa. Additionally, M3G also relieved the colonic immune barrier of mice by increasing the level of secretory immunoglobulin A (SIgA) in colon tissue and the percentages of CD4+T (CD3+CD4+) and CD8+T (CD3+CD8+) cells in colon lamina propria monocytes in mice. Furthermore, M3G down-regulated Notch signaling pathway-related proteins such as Notch1, notch intracellular domain (NICD), delta-like ligand 4 (DLL4), delta-like ligand 1 (DLL1), and hairy/enhancer of split 1 (Hes1) of colon tissue. The present results demonstrated that M3G can improve colonic mucosal barrier function by inhibiting the Notch signaling pathway.
-
Key words:
- Malvidin-3-O-galactoside /
- Colonic mucosal barrier /
- Notch signaling pathway /
- Colitis